ID: 1152551331

View in Genome Browser
Species Human (GRCh38)
Location 17:81031900-81031922
Sequence CATGCACACAGGGCGCCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152551331_1152551345 26 Left 1152551331 17:81031900-81031922 CCGCTCGGCGCCCTGTGTGCATG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1152551345 17:81031949-81031971 CAGACCCCTGGCTCAGAGCTGGG 0: 1
1: 0
2: 3
3: 40
4: 332
1152551331_1152551344 25 Left 1152551331 17:81031900-81031922 CCGCTCGGCGCCCTGTGTGCATG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1152551344 17:81031948-81031970 GCAGACCCCTGGCTCAGAGCTGG 0: 1
1: 0
2: 1
3: 39
4: 344
1152551331_1152551336 -8 Left 1152551331 17:81031900-81031922 CCGCTCGGCGCCCTGTGTGCATG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1152551336 17:81031915-81031937 TGTGCATGAGGGCCCATCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 59
1152551331_1152551341 14 Left 1152551331 17:81031900-81031922 CCGCTCGGCGCCCTGTGTGCATG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1152551341 17:81031937-81031959 GTGCCCGGGTTGCAGACCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 138
1152551331_1152551337 -1 Left 1152551331 17:81031900-81031922 CCGCTCGGCGCCCTGTGTGCATG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1152551337 17:81031922-81031944 GAGGGCCCATCGCTGGTGCCCGG 0: 1
1: 0
2: 0
3: 13
4: 180
1152551331_1152551346 27 Left 1152551331 17:81031900-81031922 CCGCTCGGCGCCCTGTGTGCATG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1152551346 17:81031950-81031972 AGACCCCTGGCTCAGAGCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 324
1152551331_1152551338 0 Left 1152551331 17:81031900-81031922 CCGCTCGGCGCCCTGTGTGCATG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1152551338 17:81031923-81031945 AGGGCCCATCGCTGGTGCCCGGG 0: 1
1: 0
2: 2
3: 23
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152551331 Original CRISPR CATGCACACAGGGCGCCGAG CGG (reversed) Intergenic
900431316 1:2604419-2604441 CGGGCACACAGAGTGCCGAGTGG + Intronic
900952948 1:5868234-5868256 CATGCACACAGGGTGTCGGGAGG - Intronic
903130437 1:21275858-21275880 CAGGCACCCAGGCCGCTGAGGGG - Intronic
920306573 1:205022005-205022027 CATGGCCACAGGGTGCAGAGAGG + Exonic
922100471 1:222474010-222474032 CATCCAGAGAGGCCGCCGAGAGG + Intergenic
1062971670 10:1653489-1653511 CAGGCACACAAGGCGTCGGGTGG - Intronic
1066452887 10:35547689-35547711 CATCCACACAGGGCTCCGGCAGG - Intronic
1070279159 10:75036420-75036442 CATGCACACAGGGCTTGGGGGGG - Intergenic
1070328539 10:75402857-75402879 GGTGCGCCCAGGGCGCCGAGAGG + Intergenic
1071598567 10:86945005-86945027 CAGGCTCACAGGGCCCCCAGCGG - Intronic
1075739194 10:124683551-124683573 CATGCACTCAGGGGGCTGTGTGG - Intronic
1076427496 10:130378232-130378254 CAGACGCACACGGCGCCGAGGGG + Intergenic
1077136337 11:1001176-1001198 ACTGCACACAGGGAGCCGGGAGG - Intronic
1085031474 11:73273509-73273531 CAGCCACACAGGGAGTCGAGGGG - Intronic
1088897928 11:114091996-114092018 CACGCCCACTGGGCACCGAGGGG - Intronic
1089687966 11:120169072-120169094 CCGGCAAAGAGGGCGCCGAGGGG + Exonic
1091124604 11:133083155-133083177 CACGCACACACCCCGCCGAGCGG + Intronic
1094393442 12:29978441-29978463 CAGCCACACAGGGCACCGTGAGG - Intergenic
1094846705 12:34364536-34364558 CGTGCACGCAGGGGGCCCAGGGG - Intergenic
1096531255 12:52244186-52244208 CAGGCCCACAGGGCTCCAAGGGG - Intronic
1097601206 12:61695134-61695156 CATGCTAACAGGGAGCCTAGTGG - Intergenic
1098049126 12:66434764-66434786 CATGCACACTGGGGGCAGAGAGG + Intronic
1102042881 12:109811856-109811878 CACACACACAGGCCACCGAGAGG + Intronic
1102455543 12:113068745-113068767 CATTCTCACATGGCGCCGGGGGG - Intronic
1104721717 12:131048174-131048196 TATGCACACAGTGTGCTGAGTGG + Intronic
1105612406 13:21980535-21980557 CATCCACACAGGGCACCCTGAGG + Intergenic
1112171086 13:96972370-96972392 CATGGACACAGGGAGGGGAGGGG + Intergenic
1118063310 14:62164291-62164313 CATGCACACAGGGCCCCAGGAGG + Intergenic
1119765603 14:77185669-77185691 CATGCACCCAGGGCCCTGTGGGG + Intronic
1123488586 15:20762621-20762643 GATGCACCCAGGCCGCAGAGGGG - Intergenic
1124409701 15:29426845-29426867 TATGCACACTGGGCGCCGAGTGG + Intronic
1127309866 15:57743176-57743198 CAGGCAGACAGGGCCCTGAGGGG - Intronic
1130537805 15:84799495-84799517 CATGCACCCCTGGGGCCGAGAGG + Intronic
1132768639 16:1548302-1548324 CATGCACACAGGTGGCAGAGTGG - Intronic
1134879652 16:17734017-17734039 CATGCAAACAGGGTGTGGAGTGG + Intergenic
1141225897 16:82114550-82114572 GATGCACACAAGGCCCCGTGGGG + Intergenic
1141883889 16:86878801-86878823 CAGGCACACAGAGCGCCGCCAGG + Intergenic
1142016410 16:87750573-87750595 GTTCCACACAGGGCGCAGAGAGG + Intronic
1145014214 17:19386354-19386376 CAGGCACACTGGGGCCCGAGGGG + Exonic
1150463696 17:65373664-65373686 CATGCAGACAGGGTCTCGAGAGG + Intergenic
1151043561 17:70893531-70893553 CATGCACACAGGGCACCAATTGG - Intergenic
1152551331 17:81031900-81031922 CATGCACACAGGGCGCCGAGCGG - Intergenic
1152581073 17:81165849-81165871 CATGCAAACCGGGAGCCGTGGGG + Intronic
1157304438 18:46506993-46507015 CAGGCAGACAGGGCACCCAGAGG - Intronic
1159595418 18:70378360-70378382 CATGCACTCAGGGAGCAGTGGGG - Intergenic
1160443480 18:78911098-78911120 CATGCACACACATCGCCAAGAGG + Intergenic
1163798788 19:19352795-19352817 CAGGGACACAGGGAGCAGAGGGG - Intronic
926683071 2:15678614-15678636 CATGGACACAGGGAGCAGCGGGG + Intergenic
926840475 2:17074268-17074290 GATGCTCACAGGGTGCTGAGTGG - Intergenic
929808779 2:45170360-45170382 CATGCACACAAGGCGCCCGCGGG - Intergenic
930613993 2:53574401-53574423 AATCCTCACATGGCGCCGAGAGG - Intronic
933649611 2:84840032-84840054 CATGCACCCAGGGGGAGGAGTGG - Intronic
939969474 2:148644279-148644301 CTTGCGCACAGGGCGCCTTGGGG + Intergenic
940737393 2:157468830-157468852 TATGAACACAGGGCCCCAAGTGG + Intronic
1169645422 20:7804017-7804039 CAGGCAGACGAGGCGCCGAGAGG + Intergenic
1171967272 20:31540056-31540078 CAAGCACACAGTGAGCCTAGTGG + Intronic
1174353875 20:49985813-49985835 CGGGGACAAAGGGCGCCGAGGGG - Intronic
1175800371 20:61797936-61797958 CCAGCACACAGGGCCCCGTGAGG - Intronic
1176044623 20:63086026-63086048 CATGCACACACGGCGGGGAGAGG - Intergenic
1176051336 20:63121011-63121033 CATGCACACAGGGTGAGGCGGGG + Intergenic
1176207075 20:63895029-63895051 CATGCGCTCAGAGAGCCGAGCGG - Intergenic
1176871218 21:14084455-14084477 AATGCACAGCGGGCGCCGATGGG + Intergenic
951330829 3:21365718-21365740 CAGGCACACAGGGCCTGGAGTGG + Intergenic
954292128 3:49655307-49655329 CAGGCACACTGGGGGCCGGGTGG - Exonic
954751742 3:52817851-52817873 CCTGCACACAAGGTGCCCAGTGG + Intronic
955562920 3:60212308-60212330 CATGCAGCCAGGACGCCAAGTGG + Intronic
955770083 3:62377285-62377307 GAAGGACACAGGCCGCCGAGGGG - Intergenic
956678868 3:71759485-71759507 CATGCACTCTGGGAGCCCAGAGG - Intergenic
961648148 3:128403583-128403605 CTGGCACACAGGGCACCGTGTGG + Intronic
968699228 4:2046911-2046933 CAGGCCCACAGGGCGCCTAACGG - Intergenic
969529353 4:7722131-7722153 CAGGAACACAAGGCCCCGAGAGG + Intronic
969534485 4:7747461-7747483 CCTGCAGAGAGGGCGCCCAGGGG + Intergenic
973826271 4:54710247-54710269 AATGCACACGGGGCCCAGAGTGG - Intronic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571135 5:645954-645976 CATCCACACAGGGCGCCAACGGG - Intronic
985571154 5:646084-646106 CATCCACACAGGCCGCCAATGGG - Intronic
986757697 5:10853553-10853575 CAGGCAGACAGGATGCCGAGAGG - Intergenic
994612083 5:102055887-102055909 CATGCATATAGGGAGCCAAGGGG + Intergenic
1006460129 6:34153264-34153286 CACGCACGCAGGGCCCAGAGAGG + Intronic
1016376586 6:143427408-143427430 GAGGCACACAGTGCGCCCAGAGG + Exonic
1017057558 6:150451914-150451936 CATGCACACAGGGCTCTTTGTGG + Intergenic
1018031063 6:159842215-159842237 CATGCAAATAGGCCGCCTAGTGG - Intergenic
1018172239 6:161152281-161152303 CAGGCACACAGAGGGGCGAGGGG + Intronic
1018745305 6:166757368-166757390 CATGAACACAGGTCTCGGAGCGG - Intronic
1021801980 7:24316525-24316547 CATGCACACAGGGCAGGGCGGGG - Intergenic
1022530292 7:31062718-31062740 CATGCACAGAGGGTGCAGATGGG + Intronic
1034157537 7:148967865-148967887 CATACACACAGGGAGCAGAATGG + Intergenic
1034469099 7:151246285-151246307 CAGGGACACAGGGAGCAGAGTGG - Intronic
1035821890 8:2602064-2602086 CATGCACACAGAGCCCCCACAGG + Intergenic
1039005447 8:33031554-33031576 CATGGACACAGGGCACAGGGAGG + Intergenic
1044279191 8:90336871-90336893 CATGGACACAGGGAGAAGAGAGG - Intergenic
1047716312 8:127598699-127598721 CATGGACACAGGGCGGTGGGGGG + Intergenic
1056789874 9:89618425-89618447 GTTGCACACAGGGAGCCGTGGGG + Intergenic
1060213325 9:121723710-121723732 CATCCACACAGGGCCTCTAGGGG - Intronic
1061426576 9:130502237-130502259 CATGGACACAGGCAGCGGAGTGG - Intergenic
1062578108 9:137217875-137217897 CAGGCACTCAGGGCCCAGAGAGG - Intergenic
1062588955 9:137264385-137264407 GATGCACGCAGGGCCCTGAGGGG - Intronic
1198827352 X:140713298-140713320 GATGCCCTCAGGGCCCCGAGGGG + Intergenic
1199135253 X:144242840-144242862 CATGGACACAGGGTGGCAAGGGG - Intergenic
1200056429 X:153463756-153463778 CATGCGCACAGGGCCCCAGGTGG - Intronic
1201410975 Y:13699227-13699249 CATCCACTCAGGTCGCTGAGAGG - Intergenic
1201472326 Y:14347305-14347327 CATGAACACAGGGCCCCTATGGG - Intergenic