ID: 1152551993

View in Genome Browser
Species Human (GRCh38)
Location 17:81034767-81034789
Sequence AGGCGGGGGCGGGGTGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1682
Summary {0: 1, 1: 1, 2: 17, 3: 189, 4: 1474}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152551993_1152552018 27 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552018 17:81034817-81034839 GGCCCCCTCAGGCTGCTCCCAGG 0: 1
1: 0
2: 2
3: 37
4: 354
1152551993_1152552008 5 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551993_1152552015 16 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552015 17:81034806-81034828 GCTGTTGCCCGGGCCCCCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 194
1152551993_1152552019 28 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551993_1152552002 -6 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551993_1152552010 6 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552010 17:81034796-81034818 CCCCAGCCCGGCTGTTGCCCGGG 0: 1
1: 1
2: 2
3: 36
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152551993 Original CRISPR AGGCGGGGGCGGGGTGGCGC AGG (reversed) Intergenic