ID: 1152552002

View in Genome Browser
Species Human (GRCh38)
Location 17:81034784-81034806
Sequence CCGCCTCCCCGCCCCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1574
Summary {0: 1, 1: 4, 2: 26, 3: 200, 4: 1343}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152551984_1152552002 29 Left 1152551984 17:81034732-81034754 CCCCGCTCTCCTCCCCGCACCTT 0: 1
1: 0
2: 2
3: 38
4: 608
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551988_1152552002 17 Left 1152551988 17:81034744-81034766 CCCCGCACCTTCTGCTCCTTCTT 0: 1
1: 0
2: 1
3: 43
4: 481
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551986_1152552002 27 Left 1152551986 17:81034734-81034756 CCGCTCTCCTCCCCGCACCTTCT 0: 1
1: 0
2: 14
3: 221
4: 2154
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551985_1152552002 28 Left 1152551985 17:81034733-81034755 CCCGCTCTCCTCCCCGCACCTTC 0: 1
1: 0
2: 10
3: 89
4: 788
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551993_1152552002 -6 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551989_1152552002 16 Left 1152551989 17:81034745-81034767 CCCGCACCTTCTGCTCCTTCTTC 0: 1
1: 0
2: 17
3: 262
4: 2619
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551987_1152552002 20 Left 1152551987 17:81034741-81034763 CCTCCCCGCACCTTCTGCTCCTT 0: 1
1: 0
2: 2
3: 60
4: 541
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551990_1152552002 15 Left 1152551990 17:81034746-81034768 CCGCACCTTCTGCTCCTTCTTCC 0: 1
1: 0
2: 21
3: 196
4: 1583
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551991_1152552002 10 Left 1152551991 17:81034751-81034773 CCTTCTGCTCCTTCTTCCTGCGC 0: 1
1: 0
2: 0
3: 71
4: 690
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551992_1152552002 1 Left 1152551992 17:81034760-81034782 CCTTCTTCCTGCGCCACCCCGCC 0: 1
1: 0
2: 3
3: 32
4: 429
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343
1152551983_1152552002 30 Left 1152551983 17:81034731-81034753 CCCCCGCTCTCCTCCCCGCACCT 0: 1
1: 1
2: 13
3: 320
4: 3711
Right 1152552002 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 4
2: 26
3: 200
4: 1343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152552002 Original CRISPR CCGCCTCCCCGCCCCCAGCC CGG Intergenic