ID: 1152552008

View in Genome Browser
Species Human (GRCh38)
Location 17:81034795-81034817
Sequence CCCCCAGCCCGGCTGTTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 274}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152551991_1152552008 21 Left 1152551991 17:81034751-81034773 CCTTCTGCTCCTTCTTCCTGCGC 0: 1
1: 0
2: 0
3: 71
4: 690
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551993_1152552008 5 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551989_1152552008 27 Left 1152551989 17:81034745-81034767 CCCGCACCTTCTGCTCCTTCTTC 0: 1
1: 0
2: 17
3: 262
4: 2619
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551999_1152552008 -10 Left 1152551999 17:81034782-81034804 CCCCGCCTCCCCGCCCCCAGCCC 0: 1
1: 6
2: 62
3: 564
4: 3934
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551994_1152552008 -1 Left 1152551994 17:81034773-81034795 CCACCCCGCCCCCGCCTCCCCGC 0: 1
1: 9
2: 107
3: 867
4: 5595
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551998_1152552008 -9 Left 1152551998 17:81034781-81034803 CCCCCGCCTCCCCGCCCCCAGCC No data
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551992_1152552008 12 Left 1152551992 17:81034760-81034782 CCTTCTTCCTGCGCCACCCCGCC 0: 1
1: 0
2: 3
3: 32
4: 429
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551995_1152552008 -4 Left 1152551995 17:81034776-81034798 CCCCGCCCCCGCCTCCCCGCCCC 0: 1
1: 15
2: 117
3: 902
4: 5946
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551988_1152552008 28 Left 1152551988 17:81034744-81034766 CCCCGCACCTTCTGCTCCTTCTT 0: 1
1: 0
2: 1
3: 43
4: 481
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551990_1152552008 26 Left 1152551990 17:81034746-81034768 CCGCACCTTCTGCTCCTTCTTCC 0: 1
1: 0
2: 21
3: 196
4: 1583
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551996_1152552008 -5 Left 1152551996 17:81034777-81034799 CCCGCCCCCGCCTCCCCGCCCCC 0: 1
1: 24
2: 114
3: 978
4: 6631
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274
1152551997_1152552008 -6 Left 1152551997 17:81034778-81034800 CCGCCCCCGCCTCCCCGCCCCCA 0: 1
1: 9
2: 83
3: 854
4: 5861
Right 1152552008 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 4
3: 37
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152552008 Original CRISPR CCCCCAGCCCGGCTGTTGCC CGG Intergenic