ID: 1152552019

View in Genome Browser
Species Human (GRCh38)
Location 17:81034818-81034840
Sequence GCCCCCTCAGGCTGCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 304}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152552012_1152552019 -3 Left 1152552012 17:81034798-81034820 CCAGCCCGGCTGTTGCCCGGGCC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551996_1152552019 18 Left 1152551996 17:81034777-81034799 CCCGCCCCCGCCTCCCCGCCCCC 0: 1
1: 24
2: 114
3: 978
4: 6631
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552000_1152552019 12 Left 1152552000 17:81034783-81034805 CCCGCCTCCCCGCCCCCAGCCCG 0: 1
1: 8
2: 51
3: 323
4: 2381
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552013_1152552019 -7 Left 1152552013 17:81034802-81034824 CCCGGCTGTTGCCCGGGCCCCCT 0: 1
1: 0
2: 3
3: 16
4: 273
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552005_1152552019 4 Left 1152552005 17:81034791-81034813 CCCGCCCCCAGCCCGGCTGTTGC 0: 1
1: 0
2: 10
3: 123
4: 1326
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551993_1152552019 28 Left 1152551993 17:81034767-81034789 CCTGCGCCACCCCGCCCCCGCCT 0: 1
1: 1
2: 17
3: 189
4: 1474
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552004_1152552019 5 Left 1152552004 17:81034790-81034812 CCCCGCCCCCAGCCCGGCTGTTG 0: 1
1: 0
2: 6
3: 113
4: 1245
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552001_1152552019 11 Left 1152552001 17:81034784-81034806 CCGCCTCCCCGCCCCCAGCCCGG 0: 1
1: 11
2: 54
3: 436
4: 2887
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552007_1152552019 0 Left 1152552007 17:81034795-81034817 CCCCCAGCCCGGCTGTTGCCCGG 0: 1
1: 0
2: 1
3: 13
4: 280
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551995_1152552019 19 Left 1152551995 17:81034776-81034798 CCCCGCCCCCGCCTCCCCGCCCC 0: 1
1: 15
2: 117
3: 902
4: 5946
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552014_1152552019 -8 Left 1152552014 17:81034803-81034825 CCGGCTGTTGCCCGGGCCCCCTC 0: 1
1: 0
2: 3
3: 23
4: 263
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551998_1152552019 14 Left 1152551998 17:81034781-81034803 CCCCCGCCTCCCCGCCCCCAGCC No data
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551999_1152552019 13 Left 1152551999 17:81034782-81034804 CCCCGCCTCCCCGCCCCCAGCCC 0: 1
1: 6
2: 62
3: 564
4: 3934
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551994_1152552019 22 Left 1152551994 17:81034773-81034795 CCACCCCGCCCCCGCCTCCCCGC 0: 1
1: 9
2: 107
3: 867
4: 5595
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552003_1152552019 8 Left 1152552003 17:81034787-81034809 CCTCCCCGCCCCCAGCCCGGCTG 0: 1
1: 1
2: 29
3: 206
4: 1547
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552006_1152552019 3 Left 1152552006 17:81034792-81034814 CCGCCCCCAGCCCGGCTGTTGCC 0: 1
1: 2
2: 84
3: 901
4: 2638
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552009_1152552019 -1 Left 1152552009 17:81034796-81034818 CCCCAGCCCGGCTGTTGCCCGGG 0: 1
1: 0
2: 2
3: 16
4: 203
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152551997_1152552019 17 Left 1152551997 17:81034778-81034800 CCGCCCCCGCCTCCCCGCCCCCA 0: 1
1: 9
2: 83
3: 854
4: 5861
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304
1152552011_1152552019 -2 Left 1152552011 17:81034797-81034819 CCCAGCCCGGCTGTTGCCCGGGC 0: 1
1: 0
2: 0
3: 16
4: 162
Right 1152552019 17:81034818-81034840 GCCCCCTCAGGCTGCTCCCAGGG 0: 1
1: 0
2: 5
3: 40
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152552019 Original CRISPR GCCCCCTCAGGCTGCTCCCA GGG Intergenic