ID: 1152552150

View in Genome Browser
Species Human (GRCh38)
Location 17:81035218-81035240
Sequence GCTGCACCACAGACCGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152552150_1152552161 24 Left 1152552150 17:81035218-81035240 CCCGCTCCGGTCTGTGGTGCAGC 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1152552161 17:81035265-81035287 CTCGCTCAGAGGAGATGCACCGG 0: 1
1: 0
2: 1
3: 7
4: 121
1152552150_1152552160 13 Left 1152552150 17:81035218-81035240 CCCGCTCCGGTCTGTGGTGCAGC 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1152552160 17:81035254-81035276 CATGTCTCTGTCTCGCTCAGAGG 0: 1
1: 0
2: 2
3: 14
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152552150 Original CRISPR GCTGCACCACAGACCGGAGC GGG (reversed) Exonic
900614371 1:3558033-3558055 GCTGAACCACTGCACGGAGCGGG - Intronic
901255778 1:7825184-7825206 GCTGCACCACAGGGGCGAGCTGG + Intronic
901436687 1:9250947-9250969 GCTGCTGCACAGGCCGGAGGGGG + Intronic
903666182 1:25009033-25009055 GCTGCTCCACAGATGGGAGCTGG + Intergenic
904201100 1:28819581-28819603 GCTGCACCACAGCCCTGTGATGG + Intronic
904861470 1:33541155-33541177 GCTGCACCAAGGACCGGACATGG - Exonic
905008301 1:34729129-34729151 GCTGCAGCACACACCAGAGCTGG - Intronic
908934902 1:69363159-69363181 GCTGCACCACACTACGGATCAGG + Intergenic
915587330 1:156851396-156851418 GCTGCAGCACAGCCTGGGGCTGG - Exonic
920199871 1:204252956-204252978 GCCGCAGCACAGGCGGGAGCAGG - Intronic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
922719112 1:227891369-227891391 GCTGCACCCCAGACCAGCCCTGG + Intergenic
922922962 1:229323410-229323432 GCTGCAACACAAGCCTGAGCTGG + Exonic
1075258161 10:120941599-120941621 TCTGCACCACACACCTGAGAAGG + Intergenic
1075932873 10:126314134-126314156 GCATCACCACCGACCTGAGCAGG + Intronic
1076258645 10:129048699-129048721 TCGGCACCAGAGGCCGGAGCTGG + Intergenic
1076432845 10:130419026-130419048 GCTGCATCACAGACCACAGCAGG + Intergenic
1077147105 11:1051233-1051255 CCCGCACCACAGCCCGGAGGAGG - Intergenic
1078091471 11:8267198-8267220 CCTGCACCACAGCCCTGAGAAGG + Intronic
1079450399 11:20596402-20596424 GCTGCAACCCAGACAGGAGAGGG - Intergenic
1080584374 11:33667968-33667990 CCTGCACCCCAGCCTGGAGCAGG + Exonic
1084423840 11:69073603-69073625 ACGGCACCACAGACTGGGGCGGG + Intronic
1084671240 11:70607745-70607767 GCTTCAACACAGAGCAGAGCTGG - Intronic
1090158865 11:124470461-124470483 TCTGCACCAGAGAGCTGAGCTGG - Intergenic
1090799444 11:130161162-130161184 CCTGCACCACAGACAGGACCTGG + Intronic
1090799935 11:130164060-130164082 GCAGAACCACAGACCAGAGAAGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1099076646 12:78118049-78118071 GCTCCACCACAGACGAGACCTGG + Exonic
1100854163 12:98743576-98743598 GCAGCCCCATAGACCAGAGCAGG - Intronic
1113852073 13:113423523-113423545 GCTTGACCACAGACATGAGCTGG - Intronic
1114415205 14:22538217-22538239 CCTGCGCCACAGTCCTGAGCTGG - Intergenic
1119923729 14:78471879-78471901 GCTGCACCACAAAGAGAAGCTGG + Intronic
1121050514 14:90816519-90816541 GCCGCAGCACTGACCGGGGCCGG + Intergenic
1122884975 14:104706933-104706955 CCTGCAGCACCGACAGGAGCTGG - Exonic
1124582624 15:30973655-30973677 GCTGCAGCACAGACTGGAACGGG + Intronic
1124613592 15:31225572-31225594 GCTGCACCTCACACCGGAAGAGG - Intergenic
1126577138 15:50208297-50208319 TCTGAACCACTGACCTGAGCAGG - Intronic
1126849638 15:52789315-52789337 GATGCTGCCCAGACCGGAGCTGG + Exonic
1127617409 15:60700888-60700910 CCTGCACAACAGACCACAGCAGG - Intronic
1128612749 15:69087218-69087240 CCTGCACCCCTGGCCGGAGCTGG + Intergenic
1132939602 16:2500264-2500286 GCTGCACCTCAGGCTGCAGCTGG - Exonic
1133104746 16:3500198-3500220 GCTGCACAACAGGCCGGAAAGGG - Intergenic
1134133673 16:11666390-11666412 GCTGCCCCACAGGCCAAAGCCGG - Intergenic
1137938125 16:52655244-52655266 GCTGCAACACCGAGCGGAGGAGG + Intergenic
1138064130 16:53922981-53923003 GCTGATTCACAGACGGGAGCAGG - Intronic
1141168823 16:81678359-81678381 TCTGCACCCCAGCCCGGACCTGG + Exonic
1142160134 16:88553076-88553098 GCTGCACCTCTGACAGCAGCGGG + Intergenic
1142375976 16:89707354-89707376 GCTGCACCCCAGGCCCCAGCCGG + Exonic
1142616264 17:1137538-1137560 TGGGCACCACAGACCGGACCCGG - Intronic
1144519014 17:15942064-15942086 ACTGCAACACAGACGGGAACAGG + Intergenic
1145098622 17:20054307-20054329 GCTGCAGGAGAGACAGGAGCTGG - Intronic
1147000568 17:37359249-37359271 GCAGCGCCGCAGCCCGGAGCGGG - Intronic
1149742533 17:59060182-59060204 GCTGCAACACAGGGAGGAGCTGG - Intronic
1149965760 17:61162514-61162536 GCTGTACAACAGACTGTAGCAGG - Intronic
1151320673 17:73350521-73350543 GCTGCCCCACCCACCAGAGCAGG + Intronic
1151324312 17:73369441-73369463 GCTGCACCGCATACAGCAGCGGG + Intronic
1151347973 17:73514912-73514934 GGTGGACCACACACCTGAGCAGG + Intronic
1151730719 17:75909646-75909668 GCTGGACCACAGCCAGGAGAAGG - Exonic
1151776917 17:76210914-76210936 GCTGCTCCAGAGACTGAAGCAGG - Intronic
1152436466 17:80279263-80279285 GCTTCACCACAGAGAGCAGCAGG + Intronic
1152552150 17:81035218-81035240 GCTGCACCACAGACCGGAGCGGG - Exonic
1152604129 17:81280578-81280600 ACTCCACCACAGACCACAGCAGG + Intronic
1152632851 17:81418301-81418323 TCTCCACCACAGAGGGGAGCTGG + Intronic
1157662836 18:49460555-49460577 GCTGCAGGCCGGACCGGAGCCGG - Exonic
1160936535 19:1598818-1598840 GGAGAAACACAGACCGGAGCAGG + Intronic
1163662854 19:18589003-18589025 GCTGCACCAGCGTCCGGATCGGG - Exonic
1166283977 19:41812174-41812196 GCTCCACCACATACCTGGGCCGG + Intergenic
924958311 2:10800-10822 TCTTCACCACAGACCCGGGCGGG - Intergenic
925069659 2:956338-956360 TCTGCAGCTCAGTCCGGAGCAGG + Intronic
925921866 2:8644047-8644069 GCTGCACCCCAGACTGGGGTGGG - Intergenic
927344935 2:22027217-22027239 GAAGCACCACAGACTGCAGCAGG + Intergenic
932216687 2:69970648-69970670 GCTGCAACTCAGAGAGGAGCTGG - Intergenic
932435862 2:71702284-71702306 GCTGCACCCCAGCCCCGGGCAGG - Intergenic
935336099 2:102018352-102018374 GCTGCACAACAGATCAGAGAAGG - Intronic
937283253 2:120735020-120735042 GCCACACCACAGCCCGGAACTGG - Intergenic
937445263 2:121952235-121952257 GCATCACCACACACAGGAGCAGG + Intergenic
939623552 2:144449208-144449230 ACTGCACCTCAGAAGGGAGCAGG + Intronic
940534639 2:154924756-154924778 GCTGGGCCACAGACCAGTGCTGG - Intergenic
943721424 2:191206939-191206961 GCTGCAGCACAGACAGGAGGTGG - Intergenic
944660935 2:201920934-201920956 GCTGTACCACAGCCTGGAGTAGG + Intergenic
946423237 2:219576920-219576942 GCTGCACCGCTCACTGGAGCAGG - Intergenic
1169181787 20:3575383-3575405 GCAGCACCACAGAACTGAACAGG - Intronic
1174149920 20:48478594-48478616 ACTGCACCACAGGCCCCAGCAGG - Intergenic
1174368156 20:50068709-50068731 GCTGCACCCCAGCCCAGAGTGGG - Intergenic
1176430316 21:6571382-6571404 GCTGCACTCCACACAGGAGCTGG + Intergenic
1178977589 21:37232847-37232869 GCTCCACCACTGAGCTGAGCAGG - Intronic
1179457357 21:41508395-41508417 GCTGCGCCGCGGACCGGAGAGGG - Intronic
1179705710 21:43178844-43178866 GCTGCACTCCACACAGGAGCTGG + Intergenic
1179941197 21:44639612-44639634 GCTGCCCCAAAAACCGGGGCAGG - Intronic
1180224774 21:46385894-46385916 GCTGCAGCAGAGGCGGGAGCGGG + Exonic
1181403439 22:22665663-22665685 GCTGTACCACAGGCTAGAGCTGG - Intergenic
1181408443 22:22701647-22701669 GCTGTACCCCAGGCTGGAGCTGG - Intergenic
1184194056 22:42914745-42914767 GCTGCCTCTCAGTCCGGAGCAGG - Intronic
1184775581 22:46621199-46621221 GCTGCACCTCAGGCCAGACCCGG - Intronic
950654583 3:14428707-14428729 TCTGAACCACAGTCCAGAGCAGG + Intronic
952277676 3:31892952-31892974 ACTGCAGCAGAGACCAGAGCAGG + Intronic
954408421 3:50358490-50358512 GCTGCTCCAGAGCCCGGCGCTGG - Exonic
968468656 4:766046-766068 GCTGCACTACAGACCCAAGATGG + Exonic
968757862 4:2426151-2426173 CCATCACCACAGACCGAAGCTGG - Intronic
969642640 4:8408319-8408341 TCTGCGCCCCAGACCTGAGCTGG - Intronic
976092365 4:81471712-81471734 GGGGGACCACAGCCCGGAGCGGG - Intronic
976092478 4:81472192-81472214 ACTGCACAACAGCCCGGGGCAGG - Intronic
977767689 4:100819635-100819657 GATGCAGCACAGAACGGGGCGGG + Intronic
985067306 4:186135073-186135095 GCTGCACCAGAGACCGGGGTGGG + Intronic
985629121 5:1005626-1005648 GCTGCCCCACAGACGGGCCCAGG + Intergenic
990365762 5:55068927-55068949 GCTGCACCTCATACCAGAGGTGG - Intergenic
992312065 5:75511315-75511337 GCTCCCCCCCACACCGGAGCGGG - Exonic
998367359 5:141639973-141639995 GCTCCCCCACAGACAGGAGCTGG + Exonic
1002019991 5:176357604-176357626 ACTGGAACACAGACCTGAGCCGG + Intronic
1002586712 5:180253186-180253208 GCTGCACCGCAGTCTGGACCAGG + Intronic
1003958880 6:11191091-11191113 GCCGGACCTCAGACCGGAGGGGG - Exonic
1005098660 6:22146022-22146044 GCTGTACCACAGACACTAGCTGG - Intergenic
1007116262 6:39345381-39345403 GCCCCACCACAGAGCAGAGCAGG - Intronic
1018171387 6:161146039-161146061 ACTGGACCACAGACAGGAACAGG + Intronic
1018302684 6:162419988-162420010 GTTTCTCCACAGACTGGAGCAGG + Intronic
1018916105 6:168133430-168133452 GCAGCACCACCGTCCGGAGCTGG + Intergenic
1019625050 7:2011704-2011726 GCTGCTCCACAGACCCCAGAGGG + Intronic
1022528256 7:31052142-31052164 CCCGCAGCACAGACTGGAGCAGG - Intergenic
1025109025 7:56197203-56197225 GCTGACCCACAGCCTGGAGCAGG + Intergenic
1025262095 7:57426319-57426341 GCTGCAGCAGATCCCGGAGCCGG + Intergenic
1030610315 7:111681662-111681684 GCTGCATGACAGCCCAGAGCAGG + Intergenic
1032151592 7:129434308-129434330 GCTGCTCGACCGGCCGGAGCGGG - Intronic
1037577053 8:20216480-20216502 GCTGCACAACAGACAGGTACTGG + Exonic
1041852460 8:62407507-62407529 GCTACTCCACAGACTGAAGCAGG - Intronic
1044775749 8:95685761-95685783 GCTGCACCTCAGTCAGGAGTAGG - Intergenic
1047130304 8:122012161-122012183 ACAGCACCACAGATGGGAGCTGG - Intergenic
1048614702 8:136060031-136060053 GCTGCATCACAGAGCACAGCTGG + Intergenic
1049820875 8:144632528-144632550 GCTGCACCACAGGGCAGAGCCGG + Intergenic
1055744847 9:79431986-79432008 GCTGCACCAGAGACAGGTGAGGG - Intergenic
1057083649 9:92189930-92189952 GCGGCAGCAGAGACCAGAGCAGG + Intergenic
1060114478 9:120929229-120929251 GCTGCTCCCCAGACCGCCGCGGG + Intergenic
1060225251 9:121786439-121786461 GCAGAGCCACACACCGGAGCAGG + Intergenic
1061890458 9:133616584-133616606 GATGCTCCACAGGCCAGAGCTGG + Intergenic
1062384393 9:136303385-136303407 CCTGCTCCACAGACTGGAGGTGG + Intronic
1190631637 X:52392749-52392771 GCTTCACCACACACCCCAGCTGG + Intergenic
1190635277 X:52426819-52426841 GCTTCACCACAGACCCCAGCTGG - Intergenic
1190649541 X:52555672-52555694 GCTTCACCACACACCCCAGCTGG + Intergenic
1190654093 X:52596129-52596151 GCTTCACCACACACCCCAGCTGG + Intergenic
1190699883 X:52979727-52979749 GCTTCACCACACACCCCAGCTGG + Intronic
1190999622 X:55646333-55646355 GCTCCACCACACACCCCAGCTGG + Intergenic
1202138397 Y:21693151-21693173 GTTTCACAACAGACCTGAGCTGG + Intergenic