ID: 1152552280

View in Genome Browser
Species Human (GRCh38)
Location 17:81035612-81035634
Sequence CCGCGCGCTCGCCTTGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152552260_1152552280 29 Left 1152552260 17:81035560-81035582 CCCAGCCCCAGGCCCGGGGAGCA 0: 1
1: 0
2: 5
3: 58
4: 427
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552265_1152552280 17 Left 1152552265 17:81035572-81035594 CCCGGGGAGCACTCCCCGCTCCG 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552259_1152552280 30 Left 1152552259 17:81035559-81035581 CCCCAGCCCCAGGCCCGGGGAGC 0: 1
1: 2
2: 12
3: 101
4: 753
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552271_1152552280 2 Left 1152552271 17:81035587-81035609 CCGCTCCGACGGCCCTGCTCGGC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552266_1152552280 16 Left 1152552266 17:81035573-81035595 CCGGGGAGCACTCCCCGCTCCGA 0: 1
1: 0
2: 17
3: 10
4: 96
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552263_1152552280 23 Left 1152552263 17:81035566-81035588 CCCAGGCCCGGGGAGCACTCCCC 0: 1
1: 0
2: 0
3: 24
4: 358
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552264_1152552280 22 Left 1152552264 17:81035567-81035589 CCAGGCCCGGGGAGCACTCCCCG 0: 1
1: 0
2: 7
3: 17
4: 212
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552273_1152552280 -10 Left 1152552273 17:81035599-81035621 CCCTGCTCGGCCCCCGCGCGCTC 0: 1
1: 1
2: 0
3: 27
4: 207
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552262_1152552280 24 Left 1152552262 17:81035565-81035587 CCCCAGGCCCGGGGAGCACTCCC 0: 1
1: 0
2: 0
3: 21
4: 272
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552261_1152552280 28 Left 1152552261 17:81035561-81035583 CCAGCCCCAGGCCCGGGGAGCAC 0: 1
1: 1
2: 1
3: 46
4: 480
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552268_1152552280 4 Left 1152552268 17:81035585-81035607 CCCCGCTCCGACGGCCCTGCTCG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552272_1152552280 -3 Left 1152552272 17:81035592-81035614 CCGACGGCCCTGCTCGGCCCCCG 0: 1
1: 0
2: 0
3: 24
4: 247
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1152552269_1152552280 3 Left 1152552269 17:81035586-81035608 CCCGCTCCGACGGCCCTGCTCGG 0: 1
1: 0
2: 0
3: 17
4: 127
Right 1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152552280 Original CRISPR CCGCGCGCTCGCCTTGGCGT CGG Intronic
903777153 1:25800388-25800410 CCGCGCGGCCGCCTGGGCCTCGG - Exonic
908581965 1:65525727-65525749 GCGCGCGCTCGGCTGGCCGTGGG - Intronic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1074722220 10:116272951-116272973 CGGCGCGCTCGCCCTGGGCTGGG - Intronic
1077044300 11:537674-537696 CCGCGCCCACGCCTCGGCGCAGG - Intronic
1077360359 11:2138017-2138039 CCCCGCGCTCACCCTGGCGGCGG - Intronic
1078514253 11:12009061-12009083 CAGCCCCCTCCCCTTGGCGTCGG + Exonic
1096489796 12:52007223-52007245 CCGCGCGCTCGCCGTGTCCGGGG + Exonic
1113656918 13:112073114-112073136 CCGCGCGCGGGCCTCGGCGGGGG - Intergenic
1123036916 14:105475286-105475308 CCGCGCGCTCCCGTGGGCCTGGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1132589788 16:721602-721624 CCGCGCGCTCGCGCCGACGTAGG - Exonic
1137787140 16:51149508-51149530 CCGCGTGCTCGCTTTCGCTTGGG + Intronic
1143496348 17:7314999-7315021 CAGCGCCCTGGCCATGGCGTTGG + Exonic
1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG + Intronic
1161312848 19:3604357-3604379 CCGGGCGCTGGGCTGGGCGTGGG + Intronic
1161724933 19:5923257-5923279 CCGCGCTGTTGCCTTGGTGTAGG + Exonic
1162588692 19:11577150-11577172 CCGAGCGATCTCCTTGGCATTGG + Exonic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1167551402 19:50163236-50163258 CCGCGCCCTCGCCTGGGAGGCGG - Intergenic
929787819 2:45004774-45004796 CCGCGCGTACTCCTTGGCGGTGG - Intergenic
932316856 2:70790408-70790430 CCGCTCACGCTCCTTGGCGTTGG + Exonic
945879612 2:215312210-215312232 CCACGCTCCCGCCTTGGCGGCGG + Intronic
1173582942 20:44160148-44160170 CCGCGCGGCCGCCTCGGCATTGG + Exonic
1180064610 21:45405973-45405995 CCCCGCGCCCGCCGTGGTGTCGG + Intronic
1183981608 22:41543952-41543974 TCGCGGGCAGGCCTTGGCGTGGG - Intronic
1185055144 22:48575492-48575514 CCGCCCGCTCGGCTCGGCGCCGG - Intronic
950045605 3:9947087-9947109 ATGGGCGCTCGCCCTGGCGTTGG - Exonic
963741582 3:149086701-149086723 CCGCGCGCCCGCCTTGGGGGCGG - Intergenic
968372806 4:11218-11240 CCGCGCCCCCGCCCCGGCGTGGG - Intergenic
968405507 4:336792-336814 CCGCGCGGTCGCTTTGAGGTCGG - Intergenic
984698225 4:182800129-182800151 GCGCGCGCTCGCCCGGGCCTGGG + Exonic
985462590 4:190121349-190121371 CCGCGCCCCCGCCCCGGCGTGGG + Intergenic
998406221 5:141876221-141876243 CCGCGCCCTAGCCTTGCCTTGGG - Intronic
1001159430 5:169300643-169300665 CCTGGCGCTGGCCTTGGCGCTGG - Exonic
1004044848 6:12013029-12013051 GCTCGGGCTCGCCTTGGGGTCGG + Intronic
1022367985 7:29743984-29744006 CCGCCCTCTGGCCTTGGCCTTGG + Intergenic
1023918387 7:44607377-44607399 CCGCGCCCTCGCCCTGACCTGGG + Intronic
1028796329 7:94907874-94907896 CCGCCCGCCCGCAATGGCGTTGG + Intronic
1030227526 7:107169366-107169388 CCGCGAGCTCACCTGGGCTTCGG + Intronic
1033595473 7:142855375-142855397 CCGCGGGCTCACCTTCCCGTTGG - Exonic
1062517094 9:136942233-136942255 CCGCAAGCCCTCCTTGGCGTGGG + Exonic