ID: 1152555325

View in Genome Browser
Species Human (GRCh38)
Location 17:81050102-81050124
Sequence CTGCCTCAGGCACGCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152555325_1152555330 3 Left 1152555325 17:81050102-81050124 CCTACAGTGCGTGCCTGAGGCAG 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1152555330 17:81050128-81050150 TCCACAGAAGGCCTCTCTGCTGG 0: 1
1: 0
2: 0
3: 26
4: 250
1152555325_1152555332 11 Left 1152555325 17:81050102-81050124 CCTACAGTGCGTGCCTGAGGCAG 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1152555332 17:81050136-81050158 AGGCCTCTCTGCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 47
4: 460
1152555325_1152555334 15 Left 1152555325 17:81050102-81050124 CCTACAGTGCGTGCCTGAGGCAG 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1152555334 17:81050140-81050162 CTCTCTGCTGGCCCAGCGGCTGG 0: 1
1: 1
2: 0
3: 26
4: 271
1152555325_1152555329 -9 Left 1152555325 17:81050102-81050124 CCTACAGTGCGTGCCTGAGGCAG 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1152555329 17:81050116-81050138 CTGAGGCAGGGCTCCACAGAAGG 0: 1
1: 0
2: 1
3: 28
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152555325 Original CRISPR CTGCCTCAGGCACGCACTGT AGG (reversed) Intronic