ID: 1152555328

View in Genome Browser
Species Human (GRCh38)
Location 17:81050115-81050137
Sequence CTTCTGTGGAGCCCTGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152555328_1152555338 21 Left 1152555328 17:81050115-81050137 CCTGAGGCAGGGCTCCACAGAAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1152555338 17:81050159-81050181 CTGGATGCAGATGCAGAAGGAGG 0: 1
1: 0
2: 3
3: 42
4: 358
1152555328_1152555330 -10 Left 1152555328 17:81050115-81050137 CCTGAGGCAGGGCTCCACAGAAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1152555330 17:81050128-81050150 TCCACAGAAGGCCTCTCTGCTGG 0: 1
1: 0
2: 0
3: 26
4: 250
1152555328_1152555332 -2 Left 1152555328 17:81050115-81050137 CCTGAGGCAGGGCTCCACAGAAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1152555332 17:81050136-81050158 AGGCCTCTCTGCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 47
4: 460
1152555328_1152555337 18 Left 1152555328 17:81050115-81050137 CCTGAGGCAGGGCTCCACAGAAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1152555337 17:81050156-81050178 CGGCTGGATGCAGATGCAGAAGG 0: 1
1: 0
2: 1
3: 10
4: 179
1152555328_1152555334 2 Left 1152555328 17:81050115-81050137 CCTGAGGCAGGGCTCCACAGAAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1152555334 17:81050140-81050162 CTCTCTGCTGGCCCAGCGGCTGG 0: 1
1: 1
2: 0
3: 26
4: 271
1152555328_1152555339 27 Left 1152555328 17:81050115-81050137 CCTGAGGCAGGGCTCCACAGAAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1152555339 17:81050165-81050187 GCAGATGCAGAAGGAGGAACTGG 0: 1
1: 0
2: 6
3: 143
4: 4683

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152555328 Original CRISPR CTTCTGTGGAGCCCTGCCTC AGG (reversed) Intronic