ID: 1152555332

View in Genome Browser
Species Human (GRCh38)
Location 17:81050136-81050158
Sequence AGGCCTCTCTGCTGGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 460}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152555325_1152555332 11 Left 1152555325 17:81050102-81050124 CCTACAGTGCGTGCCTGAGGCAG 0: 1
1: 0
2: 0
3: 16
4: 203
Right 1152555332 17:81050136-81050158 AGGCCTCTCTGCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 47
4: 460
1152555328_1152555332 -2 Left 1152555328 17:81050115-81050137 CCTGAGGCAGGGCTCCACAGAAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 1152555332 17:81050136-81050158 AGGCCTCTCTGCTGGCCCAGCGG 0: 1
1: 0
2: 2
3: 47
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152555332 Original CRISPR AGGCCTCTCTGCTGGCCCAG CGG Intronic