ID: 1152557686

View in Genome Browser
Species Human (GRCh38)
Location 17:81062544-81062566
Sequence GAGCCTCCCTGCTCCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152557686 Original CRISPR GAGCCTCCCTGCTCCCTCGT GGG Intronic
901826182 1:11863065-11863087 GAGCCTGCCTCCTGCCTCCTGGG - Intergenic
902702631 1:18183025-18183047 AAGCCACCCTGCCCCCTCCTGGG + Intronic
905838578 1:41152610-41152632 GACCTTCCCTGCTCCATCATGGG - Exonic
908088367 1:60660879-60660901 AGGCCTCCCTGCTCACTAGTTGG - Intergenic
913243755 1:116853070-116853092 CAGCCTCCCTCCTCCCTGCTGGG - Intergenic
914871005 1:151473613-151473635 GAGCCTCGCCGCTCCCTCCCGGG - Intergenic
920078230 1:203352521-203352543 GAGCCTCCCTGCTTCCACCCTGG - Intergenic
920453046 1:206074852-206074874 GACCCTCCCAGCCCCCTCATAGG + Intronic
920496678 1:206459924-206459946 AATCCTCCCAGCTCCCTCCTTGG + Intronic
920938638 1:210459578-210459600 CAGCCACCCTGCTTCCTCTTGGG - Intronic
920959864 1:210654756-210654778 GAGCCTCCCACCTCCTTCCTAGG - Intronic
922173469 1:223176894-223176916 CAGCCTCCCTGCTTCCTCCATGG + Intergenic
922348463 1:224716680-224716702 GTGCCTCCCAGTTCCCTCCTGGG - Intronic
922796012 1:228340253-228340275 CAGCCTCCCTGCACCCCCCTTGG + Intronic
923278310 1:232417568-232417590 GAGCATCCTTGCTCCCTACTGGG + Intronic
1065752144 10:28896908-28896930 GAGCCTCCCCGCCCCTCCGTGGG - Intergenic
1065895917 10:30163084-30163106 GAGCCTCCCCGCCCCTCCGTGGG + Intergenic
1066235430 10:33480556-33480578 GAGCCTCCCCCCTCCCCCATGGG - Intergenic
1067525074 10:47033655-47033677 GTGCATCCCTGATGCCTCGTGGG + Intergenic
1069598306 10:69686930-69686952 GAGCCTCCCTGCTCCCCCCAGGG - Intronic
1069753694 10:70760823-70760845 CAGCCTCCCTGCTGCCTCCCCGG + Exonic
1069917979 10:71798833-71798855 TGGCCTTCCTGCTCCCTCGGTGG - Intronic
1070564062 10:77590369-77590391 GAGCCTCCCTGCCCCTCCGTGGG - Intronic
1071248545 10:83791416-83791438 CAGTCTCCCTGCTCCCTCCCTGG + Intergenic
1071492255 10:86143923-86143945 CAGCCTCACTGCACCCTCTTTGG + Intronic
1072141577 10:92593269-92593291 GAGTCTCCCTGGTCCCTCTCGGG - Exonic
1073260888 10:102189144-102189166 GAGCCTCCCTGTGCTCTTGTTGG - Intergenic
1074301920 10:112240799-112240821 GAGCATCCCTGCGCTCTTGTGGG - Intergenic
1076315103 10:129534281-129534303 CAGCCTCCCTGCTGCCTCAAGGG - Intronic
1076948771 10:133667660-133667682 GGGTCACCCTGCTCCCTCGTGGG + Exonic
1076949755 10:133670959-133670981 GGGTCACCCTGCTCCCTCGTGGG + Intronic
1076950739 10:133674258-133674280 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076951729 10:133677568-133677590 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076952718 10:133680878-133680900 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076953702 10:133684177-133684199 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076955675 10:133743839-133743861 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076956665 10:133747149-133747171 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076957652 10:133750458-133750480 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076958637 10:133753757-133753779 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076959626 10:133757067-133757089 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076960610 10:133760366-133760388 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1077032260 11:473828-473850 CAGCCTCCCACCTCCCTCCTGGG + Intronic
1077182372 11:1222579-1222601 GAGCCTCCCGGCCTCCCCGTGGG + Intergenic
1078448654 11:11424164-11424186 GAGCCTCCCTGGTCCTTTCTTGG - Intronic
1079396478 11:20067917-20067939 GAGCCACCCTGCTCCCCAGGCGG - Intronic
1080646759 11:34193320-34193342 GAGCCTCCCTGCACCCTTCCAGG - Intronic
1081126902 11:39333157-39333179 GAGCCTCCCTGCCCCTCCGTGGG - Intergenic
1084270788 11:68028068-68028090 GCGCCTGCCTCCTCCCTCCTGGG + Exonic
1087131742 11:94674618-94674640 CAGCCTCCCTGCTCACCAGTGGG + Intergenic
1090479854 11:127058623-127058645 CAGAGTCCCTGCTCCCTCTTTGG + Intergenic
1091650005 12:2302859-2302881 GAGCCTCTCGGCTCCATCCTGGG + Intronic
1094117932 12:26938057-26938079 AAGCCTCCCTTCCCCCTCGTAGG + Exonic
1096180684 12:49548924-49548946 GAGACTCCCTACTACCTGGTGGG + Exonic
1102895021 12:116592060-116592082 GAGAGTCACTGTTCCCTCGTTGG + Intergenic
1103393546 12:120591057-120591079 GAGCCTCCCTTCTCCCAAGAAGG - Intergenic
1104511390 12:129382608-129382630 GGGCCTCCCTCTTCCCTCTTTGG - Intronic
1109446576 13:62447987-62448009 GAGCCTCCCAGCCCCTCCGTGGG - Intergenic
1113697447 13:112356050-112356072 GGGCCCCACTGCTCCCTCCTGGG - Intergenic
1113746590 13:112749659-112749681 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746647 13:112749939-112749961 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746667 13:112750033-112750055 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746686 13:112750126-112750148 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746705 13:112750219-112750241 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746724 13:112750312-112750334 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746742 13:112750405-112750427 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746760 13:112750499-112750521 GAGTCTCCATCCTCCCACGTGGG + Intronic
1113746778 13:112750592-112750614 GAGTCTCCATCCTCCCACGTGGG + Intronic
1119175169 14:72563375-72563397 GACCCTCCCAGCTCCCACCTGGG - Intronic
1119739132 14:77002755-77002777 TTGCCTCCCTCCTCCCTCCTAGG + Intergenic
1120745380 14:88147004-88147026 GAGCCTCCCTGTGCTCTTGTGGG + Intergenic
1121315885 14:92960801-92960823 GAGCCTTCCTGCTCCCTCCCTGG + Intronic
1122302675 14:100739831-100739853 GAGCCTTCCCCCTCCCTCGAAGG - Intergenic
1123058972 14:105585901-105585923 GGGCCTCACTGCCCCCTTGTGGG + Intergenic
1202848448 14_GL000225v1_random:1104-1126 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202854724 14_GL000225v1_random:43311-43333 TTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202856170 14_GL000225v1_random:53334-53356 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202857131 14_GL000225v1_random:58602-58624 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202858235 14_GL000225v1_random:64411-64433 GTGTCACCCTGCTCCCTCATGGG - Intergenic
1202859540 14_GL000225v1_random:72698-72720 GTGTCACCCTCCTCCCTCGTGGG - Intergenic
1202860717 14_GL000225v1_random:79529-79551 GTGTCACCCTGCTCCCTCGTGGG - Intergenic
1202862215 14_GL000225v1_random:89987-90009 GTGTCTCCCTTTTCCCTCGTGGG - Intergenic
1202864294 14_GL000225v1_random:105044-105066 GTGTCACCCTGCTCCCTCGTGGG - Intergenic
1202921936 14_KI270723v1_random:35177-35199 GGTTCACCCTGCTCCCTCGTGGG + Intergenic
1202922981 14_KI270724v1_random:2404-2426 GGTTCACCCTGCTCCCTCGTGGG - Intergenic
1124721020 15:32110835-32110857 GAGCCACCCTGGTCCCAGGTTGG + Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1125631620 15:41151911-41151933 GAGCCTCCCTGCCACTCCGTGGG + Intergenic
1129659568 15:77545505-77545527 CCTCCTCCCTGCTCCCTCTTGGG + Intergenic
1130841810 15:87707618-87707640 TAGTCTCCCTGCTCCCTCCAAGG - Intergenic
1131177235 15:90217696-90217718 GAGCCTCCCTCCTCTCCCATAGG - Intronic
1131510419 15:93046809-93046831 GAGCCTCCCTGCTCCAGCCCCGG - Intronic
1131892153 15:96984263-96984285 GAGCCTCCCCGCGCCGCCGTGGG - Intergenic
1135420161 16:22300445-22300467 CAGCCTCCCTGATCCCTGGCAGG + Intronic
1137733945 16:50710627-50710649 GAGCGTCTCTGCTCCATCATAGG - Exonic
1140379038 16:74469885-74469907 CAGCCCTCCTGCTGCCTCGTGGG - Intronic
1142292270 16:89198621-89198643 GAATCTCCCTCCTCCCTGGTAGG + Intronic
1144760622 17:17705026-17705048 GAGCCTCCCTGCTACCCCAGTGG + Intronic
1145188225 17:20814689-20814711 GAGCCTTCCTGCTGGCTCCTGGG - Intergenic
1146553790 17:33805465-33805487 GAGCCTCACTTCTTCCTCATAGG + Intronic
1147431141 17:40371522-40371544 GAGTCTCCCTGCTCCCTCCTGGG - Intergenic
1151206018 17:72507541-72507563 GAGCCTCCCTCCTCCTTGATAGG - Intergenic
1151287344 17:73122446-73122468 GACCGTCCCTTCTCCCTCTTCGG + Intergenic
1152557686 17:81062544-81062566 GAGCCTCCCTGCTCCCTCGTGGG + Intronic
1154991269 18:21600441-21600463 GAGCCTCCCACCTCCCTCCCAGG + Intronic
1155397117 18:25398145-25398167 CAGCCTCCCTGCTTTCTGGTGGG + Intergenic
1157491985 18:48129930-48129952 CTGCCTCCCTGCTCCCTAGCAGG + Intronic
1159208772 18:65287825-65287847 GATCCTCCCTGCTCTCACCTGGG - Intergenic
1160511963 18:79457850-79457872 CATCCTCCATGTTCCCTCGTTGG + Intronic
1160820369 19:1054982-1055004 GAGGCTCCCAGCTCCCAGGTGGG - Intronic
1160881639 19:1323455-1323477 GAGGCTCCCTGCCCCCACCTGGG - Intergenic
1161846518 19:6714286-6714308 GAGCCCCCCTGCTCCCTCTCCGG + Intronic
1162855054 19:13461732-13461754 GAGCCTTTCTGCTCCCTGATTGG + Intronic
1163789435 19:19297819-19297841 GAGGCTGCCTGCCCCCACGTGGG - Intronic
1164944964 19:32285759-32285781 GAGCATCCCTGCTTCGTTGTGGG - Intergenic
1165739480 19:38196766-38196788 CAGCCTCCTTGCTCCCCCCTCGG - Intronic
1166129511 19:40737594-40737616 GAGCCTGCCTGCTCCTTTGGGGG + Intronic
1167292245 19:48630660-48630682 GAGCCTCCCCCCTCCCTTGCGGG - Exonic
926246317 2:11124249-11124271 GAGCCTCCCAGCTCCCACTCTGG - Intergenic
926679533 2:15653204-15653226 AAGCCTCCCTGCTGCCCTGTGGG + Intergenic
927026356 2:19072834-19072856 GGTCCTTCCGGCTCCCTCGTGGG - Intergenic
927881393 2:26692558-26692580 CAGCCCCCCTCCTCCCTCCTCGG + Intergenic
928143701 2:28752316-28752338 GAGCCTCCTCGCCCCCTCCTCGG - Intronic
931521869 2:63106569-63106591 CAGCCTCCCCTCTCCCTCCTTGG + Intergenic
933219385 2:79670296-79670318 GAGCCTCCCTGTGCTCTTGTAGG - Intronic
934085151 2:88503368-88503390 GAGCCTCCCCTCTCCGCCGTGGG + Intergenic
937201198 2:120205526-120205548 GAGCCTCCCTGCTGCCTCTCAGG - Intergenic
938243957 2:129763332-129763354 CAGCCTGGCTGCTCCCTAGTGGG - Intergenic
942063111 2:172246508-172246530 GATCCTCCCTTTTCCCTCCTAGG + Intergenic
942149047 2:173056739-173056761 AAGCCTCCCTGCTCCTTGCTTGG - Intergenic
947411253 2:229843006-229843028 GATCCTTCCTGATCCCTTGTAGG + Intronic
947826431 2:233108727-233108749 GCCCCTCCCTGCTCCCTCCCAGG + Intronic
948293673 2:236845637-236845659 GAGCCTCCCTGTGCTCTTGTGGG - Intergenic
948712110 2:239831617-239831639 AGGCCTCCCTGCTCCCTCAAGGG + Intergenic
1169142230 20:3233172-3233194 GAGGGTCCCTGCTCCTTCCTGGG - Intronic
1169303643 20:4469480-4469502 GAGCCTCCCTGCTCCTCCCCAGG + Intergenic
1170763587 20:19272721-19272743 GTGCCTCCCTCCTCCCTTGGTGG + Intronic
1173809210 20:45946145-45946167 CACCCTCCCTGTTCCCTCCTGGG - Intronic
1175283106 20:57818666-57818688 CAACCTCCCTTCTCCCTCATCGG - Intergenic
1175689425 20:61054824-61054846 CAGCCCCACTGCTCCCTCTTCGG + Intergenic
1178373895 21:32050562-32050584 GAGCCTGACTTCTCCCTCCTGGG + Intergenic
1179499715 21:41800316-41800338 GAGCCTCCCTGCTGCCCCCAGGG - Intronic
1180336176 22:11578599-11578621 GAGACTCCCAGCTCCCTCCATGG + Intergenic
1180731104 22:17983270-17983292 GACCCTCCCTGCACCCCCCTAGG + Intronic
1182099944 22:27650749-27650771 GAGGCTGCCTGGTCCCCCGTGGG - Intergenic
1182702704 22:32253405-32253427 GAGCCTCCCGGCTCTCTCCATGG - Intronic
1183722893 22:39572576-39572598 GAGCCTCCCTGCTCCTTCTGGGG + Intronic
1185229086 22:49670289-49670311 GAGCCTCCCTGCGCCACCCTGGG - Intergenic
1185334024 22:50263539-50263561 CACCCTCCCTGCTCCCTGGAGGG - Intergenic
952395393 3:32916477-32916499 CAGACTCCCTCCTCCCTCCTGGG - Intergenic
953244012 3:41174720-41174742 GAGGCCCCCTGCTCCCTAGAAGG + Intergenic
954363205 3:50133281-50133303 GACTCTCCCTGCTCCTGCGTGGG - Intergenic
954688361 3:52382782-52382804 TGGCTTCCCTGCTCCCTCTTGGG + Intronic
956780259 3:72597842-72597864 GAGCCAACCTGCTGCCCCGTGGG - Intergenic
957084818 3:75669440-75669462 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
961269424 3:125677887-125677909 GTGTCACCCTCCTCCCTCGTCGG + Intergenic
961465020 3:127076372-127076394 GAGCCTCCCTGCCCCGCCGTGGG - Intergenic
962745368 3:138394137-138394159 CAGTCTTCCTGCTCCCTCCTGGG + Intronic
963533300 3:146497571-146497593 GAGCCTCCCCGCTCTGCCGTGGG + Intergenic
968561253 4:1283950-1283972 TGGCCTCCCTGCTCCCAGGTGGG - Intergenic
968785722 4:2621026-2621048 GAGCCTCTCTGCTACCCAGTGGG - Intronic
969687172 4:8682177-8682199 GAGCCCCCATGGTCCCTGGTCGG + Intergenic
970673131 4:18418425-18418447 GAGCCTCCCACCTCCATCGTGGG - Intergenic
976846097 4:89490287-89490309 GAGCCTCCCCGCTCCTCCGTGGG + Intergenic
978144987 4:105362204-105362226 GTGTTTCCCTGCTCCCTCTTGGG + Intergenic
979688626 4:123538190-123538212 GAGCCTCCCACCTCCTCCGTGGG + Intergenic
979755893 4:124339283-124339305 GAGCCTCCCCACCCCCTCGGTGG + Intergenic
984601835 4:181736735-181736757 GAGCCTCCCTGATTCCCTGTGGG + Intergenic
985446148 4:190022134-190022156 GGGTCACCCTGCTCCCTCGTGGG - Intergenic
985452225 4:190068444-190068466 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
985453209 4:190071741-190071763 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985454199 4:190075034-190075056 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985455187 4:190078327-190078349 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985456175 4:190081627-190081649 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985457159 4:190084921-190084943 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
985458146 4:190088214-190088236 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985459135 4:190091514-190091536 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985463388 4:190174283-190174305 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985628683 5:1003934-1003956 GAGTCGCCATCCTCCCTCGTGGG + Intergenic
987347410 5:16991068-16991090 GAGCCTCCCTTCTCCTCCGTGGG - Intergenic
988796468 5:34656895-34656917 GCGCCTCGCTGCCCCCGCGTCGG + Intronic
994928842 5:106154537-106154559 GAGCCTCACCGCTCCTCCGTGGG + Intergenic
994935312 5:106246484-106246506 GAGCCTCCCCGCCCCACCGTGGG + Intergenic
997470664 5:134115245-134115267 GAGCGTCCCTGCCCCGGCGTCGG + Intronic
1001559243 5:172658720-172658742 GAGCCGCCCTCCTCCCTGGGAGG + Intronic
1003292892 6:4795492-4795514 GAGCCTCTCTGCTGCCTTTTAGG + Intronic
1004545756 6:16596961-16596983 CAGCCTTCCTGCTCCCTGATTGG + Intronic
1006904759 6:37525802-37525824 GCCTCTCCCTGCTCCCTCCTTGG - Intergenic
1007374839 6:41449529-41449551 CAGCCACCCTGCTCCCGTGTGGG - Intergenic
1009407074 6:63326537-63326559 GAGCCTCCCACCTCCTCCGTGGG - Intergenic
1011699619 6:89943239-89943261 CAGCCTCCCCTCTGCCTCGTTGG - Intronic
1015556667 6:134469306-134469328 GAGTGTCCCTGCTCCCTCTGTGG - Intergenic
1018696165 6:166393438-166393460 GAGCCTCCCCCCGCCCCCGTAGG - Intergenic
1019314726 7:379195-379217 GAGCCTCCCTGGTCCCGGGCCGG - Intergenic
1019356779 7:584285-584307 GAGCCTGCCTCCTCTCTCGTGGG - Intronic
1021261973 7:18469692-18469714 GATCCTCCCTGCTACTTAGTAGG - Intronic
1021567414 7:22028914-22028936 GAGCCTCCCCGCTGCTCCGTGGG + Intergenic
1021567860 7:22032453-22032475 GAGCCTCCCCGCTGCTCCGTGGG - Intergenic
1022089301 7:27097082-27097104 GAGCCTCCGCGCTCCCGCGTGGG + Intergenic
1022537960 7:31109691-31109713 CTGCCTCCCTGCTCCCTGGCTGG - Exonic
1028233205 7:88330140-88330162 GAGCCTCCCTGTGCTCTTGTGGG + Intergenic
1034414225 7:150956357-150956379 GAGCTGCCCTGCTACCTCGGCGG - Intronic
1036566746 8:9944541-9944563 GAGCCACCCTTCTCCCTCGGGGG - Intergenic
1037757668 8:21721802-21721824 GGTCCTCCCTGCTTCCTGGTGGG - Intronic
1039473759 8:37828823-37828845 GAGCCGCCCTGCTCCCCGGGAGG - Intronic
1041256092 8:55980674-55980696 GAGCCTCCCTCCTGTCTCTTTGG + Intronic
1044159323 8:88893542-88893564 GAGTTTCCCTGCTCCCACGTTGG - Intergenic
1044169175 8:89027435-89027457 TGGCTTCCCTGCTCCCTTGTTGG - Intergenic
1044648989 8:94474894-94474916 TTCCCTCCCTCCTCCCTCGTTGG + Intronic
1047311542 8:123696641-123696663 GAGCCTCACTGCTCCTGGGTGGG + Intronic
1048752771 8:137698402-137698424 GAGCCTCCCTGCTTTCTTCTTGG - Intergenic
1049260314 8:141635476-141635498 CAGCCTCTGTGCTCCCTGGTCGG + Intergenic
1049403208 8:142440084-142440106 GGGCATCCCTGCACCCTCTTCGG - Intergenic
1049486412 8:142866059-142866081 TGGCCTCCCTGCTCCCTCCCTGG + Intronic
1051929022 9:22363564-22363586 GAGCCTCCCCGCTCCCCGGGTGG - Intergenic
1052915921 9:33924284-33924306 AAGCCTCCCTGGTCTCTCCTAGG - Exonic
1052938651 9:34114490-34114512 GAGCCACCCTGCTTCTTCATGGG + Intronic
1055854532 9:80669982-80670004 CTGCCTCCCTTCTCCCTCTTTGG + Intergenic
1058771306 9:108235126-108235148 GAACCTCCCTGCTCCATGGTAGG - Intergenic
1059208141 9:112486214-112486236 AAGCATCCCCGCTCCCTCGATGG + Intronic
1060220128 9:121760151-121760173 GAGCCTACCTGCTGCCTCGGTGG + Exonic
1060683317 9:125585170-125585192 GATCCTCCCAGCTCCCTGGGAGG - Intronic
1061947216 9:133915003-133915025 GTGCTTCCCTGCTCCCTCCCAGG - Intronic
1062216850 9:135393932-135393954 CACCGTCCCTGCTCCCTCGGAGG + Intergenic
1203740029 Un_GL000216v2:170972-170994 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1185517974 X:715286-715308 GATCCTCCCTCCTCCCTGGATGG + Intergenic
1185518017 X:715443-715465 GATCCTCCCTCCTCCCTGGATGG + Intergenic
1185518031 X:715495-715517 GATCCTCCCTCCTCCCTGGATGG + Intergenic
1185518045 X:715547-715569 GATCCTCCCTCCTCCCTGGATGG + Intergenic
1185518072 X:715651-715673 GATCCTCCCTCCTCCCTGGGAGG + Intergenic
1187468125 X:19543880-19543902 CTGCCTCCCAGCTCCCTTGTTGG - Intronic
1197176092 X:123487070-123487092 GAGGCTTTCTGCTCCCTAGTGGG - Intronic
1199693981 X:150330475-150330497 GAGCCTCCATGCTAGCTCCTGGG - Intergenic
1199699568 X:150365314-150365336 GAGGCTCCGTGCGCCTTCGTGGG - Intronic
1200987872 Y:9323739-9323761 CATCCTCCCTACTCCCTCGCTGG + Intergenic
1201175707 Y:11307426-11307448 GTATCACCCTGCTCCCTCGTGGG + Intergenic
1201176971 Y:11315430-11315452 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1201178100 Y:11322067-11322089 GTGTCACCCTGCTCCTTCGTGGG + Intergenic
1201178431 Y:11323340-11323362 GAGCCTCCCAGCTCCCACCATGG + Intergenic
1201179673 Y:11332840-11332862 GTGTCACCCTGCTCCCTCGTGGG + Intergenic
1202109125 Y:21403663-21403685 CATCCTCCCTACTCCCTCGCTGG + Intergenic
1202120149 Y:21512456-21512478 CATCCTCCCTACTCCCTCGCTGG - Intronic
1202122600 Y:21535997-21536019 CATCCTCCCTACTCCCTCGCTGG - Intronic
1202156405 Y:21893386-21893408 CATCCTCCCTACTCCCTCGCTGG + Intronic
1202158853 Y:21916927-21916949 CATCCTCCCTACTCCCTCGCTGG + Intronic
1202185304 Y:22181842-22181864 CATCCTCCCTACTCCCTCGCTGG + Intronic
1202206056 Y:22404553-22404575 CATCCTCCCTACTCCCTCGCTGG - Intronic