ID: 1152558182

View in Genome Browser
Species Human (GRCh38)
Location 17:81065023-81065045
Sequence TGCCCCGGAATCACGCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152558182_1152558187 15 Left 1152558182 17:81065023-81065045 CCGGCAGGCGTGATTCCGGGGCA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1152558187 17:81065061-81065083 AAGCCCCTGAGCCAGTGCCTGGG 0: 1
1: 0
2: 4
3: 27
4: 281
1152558182_1152558186 14 Left 1152558182 17:81065023-81065045 CCGGCAGGCGTGATTCCGGGGCA 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1152558186 17:81065060-81065082 AAAGCCCCTGAGCCAGTGCCTGG 0: 1
1: 0
2: 2
3: 43
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152558182 Original CRISPR TGCCCCGGAATCACGCCTGC CGG (reversed) Intronic
913991836 1:143620316-143620338 TGTCCCGGACTCACTGCTGCAGG + Intergenic
914802132 1:150969606-150969628 TTCCAGGGAATCACGTCTGCAGG - Intronic
1069588952 10:69630292-69630314 AGGCCCGGAGTCGCGCCTGCAGG + Exonic
1072253662 10:93601031-93601053 TGCCCAGGAATCCGCCCTGCGGG + Exonic
1077056506 11:596614-596636 TCCCCAGGAACCAGGCCTGCTGG - Intronic
1084315067 11:68341155-68341177 TCCCCAGGGATCACCCCTGCAGG - Intronic
1084423493 11:69072015-69072037 TGCCCAGCACTCACGCCTGAGGG - Exonic
1085289732 11:75389221-75389243 TGCCCCTGCATGACGCCTGATGG + Intergenic
1104444564 12:128823247-128823269 TGCCGAGGAATCCCGCCAGCAGG - Intronic
1107089081 13:36456985-36457007 TGGCCTGGAATCTTGCCTGCTGG - Intergenic
1107681879 13:42860409-42860431 TGCCCCGGAATTTGGGCTGCTGG + Intergenic
1112762134 13:102703321-102703343 TGCCCCGTAGCCAGGCCTGCAGG + Intergenic
1122088415 14:99322558-99322580 TCCCCAGGAATCTCCCCTGCAGG - Intergenic
1131066280 15:89436699-89436721 TGCCCCGGGAGCACTCCTGAAGG + Intergenic
1133023394 16:2976783-2976805 CGCCCCGGAATGACACCCGCCGG + Exonic
1134102917 16:11465118-11465140 TGCCCAGCAATCATGCCTGGTGG + Intronic
1136075906 16:27817152-27817174 GGCCCTGGAATCAGGCCGGCAGG - Intronic
1142595284 17:1026893-1026915 TCCCCCAGACTCACACCTGCAGG + Intronic
1142595299 17:1026948-1026970 TCCCCCAGACTCACACCTGCAGG + Intronic
1142595315 17:1027004-1027026 TCCCCCAGACTCACACCTGCAGG + Intronic
1152558182 17:81065023-81065045 TGCCCCGGAATCACGCCTGCCGG - Intronic
1154307591 18:13241806-13241828 TGCGCCGTAATTACTCCTGCTGG + Intronic
1160616810 18:80136797-80136819 TGCCCAGGGATAACCCCTGCAGG - Exonic
1165116169 19:33530202-33530224 TGCCCCGGCCTCACCACTGCAGG - Intergenic
925170285 2:1745837-1745859 TGGCCCCGCATCACACCTGCGGG + Intergenic
927241792 2:20925687-20925709 TGCCCCGAAATGATGCCTGGAGG + Intergenic
932575723 2:72961341-72961363 TGCCCCGGAACCACGCTTCCTGG - Intronic
941165348 2:162077978-162078000 TGCCTCACAATCACGCCTGAAGG + Intergenic
948596422 2:239082364-239082386 AGCCCCAGAATCGCGCCTGCCGG - Intronic
949061517 2:241961262-241961284 TGTCCTGGAATCCCACCTGCAGG - Intergenic
1175035108 20:55992898-55992920 TGCCTCAGAATCACCCATGCCGG - Intergenic
1175536466 20:59718147-59718169 TGCCCAGGACTCAGGCCTGGGGG - Intronic
1177081630 21:16646088-16646110 TTCCCCAGAATAAAGCCTGCTGG + Intergenic
1181272222 22:21665861-21665883 GGCCCCGAAAAGACGCCTGCGGG + Intronic
962009343 3:131379366-131379388 TGCCCAGGACTCAAGGCTGCAGG - Intergenic
968986912 4:3880570-3880592 TCCCCCGGCCACACGCCTGCAGG + Intergenic
986291980 5:6407392-6407414 GGCTCCGAATTCACGCCTGCTGG - Intergenic
989397845 5:40977603-40977625 TGCCCCTGGCTCACGCCTGTGGG - Intronic
1000875713 5:166635520-166635542 TGCCCCGGGACCACGGCTCCAGG - Intergenic
1001381570 5:171309615-171309637 GGCACCCGGATCACGCCTGCGGG - Exonic
1003577620 6:7312747-7312769 TGCCCTGGACCCTCGCCTGCAGG - Intronic
1005977177 6:30808609-30808631 TGCCTTGGCCTCACGCCTGCTGG + Intergenic
1016400847 6:143678201-143678223 CGCCCCGGACTCACCGCTGCCGG - Exonic
1018924356 6:168195917-168195939 TCCCCCAGGATCACGTCTGCCGG + Intergenic
1021894680 7:25222683-25222705 TCCCCCAGAATCAGCCCTGCTGG - Intergenic
1023681700 7:42694021-42694043 TCCCCGGGAATCACACCTGGAGG - Intergenic
1023879799 7:44311964-44311986 CACCACGGAGTCACGCCTGCTGG + Intronic
1024193316 7:47034522-47034544 TGCCCTGGAACCAGGCGTGCAGG - Intergenic
1033834996 7:145299845-145299867 TGCCTCAGAATCACGGCTGGAGG + Intergenic
1036789918 8:11710361-11710383 CGCCCCGCACTCCCGCCTGCGGG - Intronic
1049187756 8:141267227-141267249 TGCCCCGGTATCATTCCTGAAGG - Intronic
1049779820 8:144423795-144423817 TGCCCCGGGCTCAGGCATGCAGG + Exonic
1052196062 9:25716358-25716380 TTCCTAGGAGTCACGCCTGCAGG - Intergenic
1053307770 9:36996037-36996059 TGCCCCGGGCTCCCGGCTGCAGG + Intronic
1061625682 9:131839356-131839378 TGCCCCGGAAGCACCCCTTGCGG - Intergenic
1190059048 X:47199254-47199276 TGTCCTGGTATCAGGCCTGCGGG + Exonic