ID: 1152559472

View in Genome Browser
Species Human (GRCh38)
Location 17:81070763-81070785
Sequence CCGGGAGCCCCCGTCTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152559463_1152559472 -1 Left 1152559463 17:81070741-81070763 CCCCGGGTGGATGGCCGCTGACC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559464_1152559472 -2 Left 1152559464 17:81070742-81070764 CCCGGGTGGATGGCCGCTGACCC 0: 1
1: 0
2: 0
3: 14
4: 101
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559462_1152559472 2 Left 1152559462 17:81070738-81070760 CCACCCCGGGTGGATGGCCGCTG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559461_1152559472 6 Left 1152559461 17:81070734-81070756 CCAGCCACCCCGGGTGGATGGCC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559459_1152559472 11 Left 1152559459 17:81070729-81070751 CCACTCCAGCCACCCCGGGTGGA 0: 1
1: 0
2: 1
3: 17
4: 228
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559457_1152559472 14 Left 1152559457 17:81070726-81070748 CCTCCACTCCAGCCACCCCGGGT 0: 1
1: 0
2: 4
3: 37
4: 422
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559465_1152559472 -3 Left 1152559465 17:81070743-81070765 CCGGGTGGATGGCCGCTGACCCG 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559454_1152559472 23 Left 1152559454 17:81070717-81070739 CCTCTGCAGCCTCCACTCCAGCC 0: 1
1: 1
2: 16
3: 248
4: 1408
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169
1152559453_1152559472 24 Left 1152559453 17:81070716-81070738 CCCTCTGCAGCCTCCACTCCAGC 0: 1
1: 1
2: 15
3: 85
4: 715
Right 1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152559472 Original CRISPR CCGGGAGCCCCCGTCTGCCT GGG Intronic
900340818 1:2188262-2188284 CCGTCAGCCACCGTCTGCCTGGG - Intronic
900531410 1:3155236-3155258 CCGGGTCCCACCGCCTGCCTTGG - Intronic
900677837 1:3899897-3899919 CTGGGAGCCCCCTTCTCCCGGGG + Intronic
900932312 1:5745101-5745123 CACGGAGCCCCCTTCAGCCTGGG - Intergenic
900955292 1:5883000-5883022 CCGGGAGCCCTGTTCTTCCTGGG - Intronic
903330661 1:22595401-22595423 CCGGTGGTCCCCGTGTGCCTGGG + Intronic
905920353 1:41715089-41715111 CTGGCAGCCCCCCACTGCCTGGG + Intronic
906925911 1:50116456-50116478 CTGGGAGCCCCGGTGTGCCGTGG + Intronic
907158685 1:52356154-52356176 CCTGGAGCCCCTGTTTCCCTAGG + Intronic
907278017 1:53327675-53327697 CCGGGAGCCCCCGATAGCCCCGG + Intronic
908128736 1:61053978-61054000 CCGGGCGCCGCCCTCTGGCTCGG - Intronic
914357448 1:146898983-146899005 CAGGGAGCCCCCGACAGCCAAGG - Intergenic
914373386 1:147050783-147050805 CCGGGAGCCCGCGCCTCCCCCGG - Intergenic
915479471 1:156175178-156175200 CCGGGACCCCCACTGTGCCTGGG + Exonic
915601411 1:156925025-156925047 CTGGGAGGCCCCCTGTGCCTGGG + Intronic
1066126595 10:32347659-32347681 CCGCGCGCCGCCGTCTGCCGCGG + Intronic
1066411838 10:35178492-35178514 CCGGGAGCTCTCTTCTGCGTTGG + Intronic
1067697666 10:48547554-48547576 CCTGGAGCACCTGTCTGCTTTGG - Intronic
1069809655 10:71148873-71148895 TTGGGAGCCCCCAGCTGCCTGGG - Intergenic
1070642655 10:78180658-78180680 CCGGGCTCCCCCTTCTCCCTGGG + Intergenic
1074777425 10:116776254-116776276 CTGGACGCCCCCCTCTGCCTCGG + Intergenic
1076693003 10:132233265-132233287 ACGGGAGCCCGGTTCTGCCTGGG - Intronic
1076770211 10:132658845-132658867 CCGGGAGCAGCCGGCGGCCTTGG - Intronic
1077061732 11:620507-620529 CCGGGCGTCCCTGCCTGCCTAGG + Intronic
1077081892 11:728055-728077 TTGGGAGCCTCCGTCAGCCTGGG - Intergenic
1077219738 11:1410693-1410715 TCAGGAGCCCCCGCCTGCCTAGG + Intronic
1077302543 11:1853973-1853995 CCGGCAGCTCCCCTCTGCCAGGG - Intronic
1077435099 11:2535151-2535173 CCGAGAGCCTCTGTCTCCCTGGG - Intronic
1077474694 11:2780769-2780791 CAGGGAGCCCTCTTCTTCCTTGG + Intronic
1078748565 11:14138618-14138640 CCTACAGCCCCCGCCTGCCTTGG - Intronic
1083709521 11:64539418-64539440 CAGGAAGCCCCCATCTGCCCCGG + Intergenic
1084699277 11:70776022-70776044 CTGGGAGCCCCCTTCTAGCTGGG - Intronic
1085270859 11:75269109-75269131 CTCGGAGCCTCGGTCTGCCTGGG + Intronic
1085396799 11:76210506-76210528 CCGGGTGCCCCGGCCTGCCCAGG + Intronic
1085408391 11:76277497-76277519 CCCGCGGCCCCCGCCTGCCTGGG + Intergenic
1096492230 12:52019131-52019153 CCAGGAGTCCCCATCAGCCTGGG - Intergenic
1100349298 12:93763777-93763799 CCTGGAGTCCCCTTCTGCCAGGG - Intronic
1100609892 12:96182889-96182911 CTGGGATCCCCCGTCTTCCCAGG + Intergenic
1102996893 12:117358363-117358385 CCAGGAGCCTCCATCTTCCTTGG - Intronic
1103798885 12:123524070-123524092 GCAGGGGGCCCCGTCTGCCTCGG - Intronic
1103914507 12:124369496-124369518 CCGGGAGGCCCTGGCTGCCAGGG + Intronic
1104050845 12:125192677-125192699 TCGGGAGCCCCGGCCTGCTTCGG + Intronic
1105408640 13:20151578-20151600 CCTGGAGCCCCGGTCTGCTCTGG - Intronic
1105512211 13:21060864-21060886 CCGGGCGCCCCTGACAGCCTCGG - Intronic
1107992322 13:45829659-45829681 GCGGGAGCGCAGGTCTGCCTAGG - Intronic
1110436397 13:75481866-75481888 CCGGGCTCCCGCGCCTGCCTGGG + Exonic
1118472978 14:66092856-66092878 CCTGGATCCCACGTCTGCCAAGG + Intergenic
1121803886 14:96797569-96797591 GCGGGAGTCGCCGTCAGCCTCGG + Intronic
1122064066 14:99159548-99159570 CCAGGAGGCCCCAGCTGCCTGGG + Intergenic
1122829704 14:104389761-104389783 CAGGAAGCCCCCACCTGCCTTGG + Intergenic
1128144837 15:65327235-65327257 TCGGGAGCCTCCCTCTCCCTTGG - Exonic
1131514829 15:93070395-93070417 CTGGGGGCCCCTGTGTGCCTTGG - Intronic
1131515338 15:93073117-93073139 CCGGGAGGCTCCGTCCACCTCGG + Intronic
1132500991 16:284633-284655 CAGGGAGTCCCCCTCAGCCTCGG - Intronic
1132522221 16:397120-397142 CCGGGAGCCCCCCGCCGCCCCGG - Intronic
1132577564 16:671007-671029 CCGGGTGCCCGCCTGTGCCTGGG + Intronic
1132939533 16:2499986-2500008 CCAGGAGCACCCGCCTGCCCTGG + Intronic
1133102230 16:3486429-3486451 CCCTGAGGCCCCGTCTGCCCAGG - Exonic
1133213202 16:4274116-4274138 CAGGAAGCCCACGCCTGCCTTGG + Intergenic
1135424025 16:22323465-22323487 CTGGGAGCCACAGTCTTCCTAGG + Intronic
1136289032 16:29260566-29260588 CCAGTAGCCCCCTGCTGCCTGGG - Intergenic
1136540143 16:30924164-30924186 CAAGGAGCCCCCGTTGGCCTGGG + Intronic
1136775842 16:32871425-32871447 ACGGTAGCCCCAGCCTGCCTGGG + Intergenic
1136894774 16:33990087-33990109 ACGGTAGCCCCAGCCTGCCTGGG - Intergenic
1138105942 16:54287135-54287157 CCGGGAGCTCCCCTGTGCCCGGG + Intergenic
1138542130 16:57694913-57694935 CTGGTGGCCCCCTTCTGCCTGGG + Intronic
1139976737 16:70818311-70818333 CAGGGAGCCCCCGACAGCCAAGG + Intronic
1141702266 16:85647985-85648007 CGGGGAGCCCCCATGTGCTTGGG - Intronic
1142094764 16:88233493-88233515 CCAGTAGCCCCCTGCTGCCTGGG - Intergenic
1203078258 16_KI270728v1_random:1133534-1133556 ACGGTAGCCCCAGCCTGCCTGGG + Intergenic
1142479290 17:208330-208352 ACGGGAGCCTGCGGCTGCCTTGG - Intergenic
1142683095 17:1561934-1561956 CCGGGAGGCCCTGCCTGCCCCGG + Intronic
1142809400 17:2388168-2388190 CCAGCAGCCCCCGTCAGGCTGGG - Intronic
1143544796 17:7589616-7589638 CCTGGAGCCTCCGGCTGCCACGG - Exonic
1146849772 17:36212077-36212099 CCAGGAACCCCCTTCTGTCTCGG - Intronic
1146935162 17:36808578-36808600 CCCCGCGCCCCCGGCTGCCTCGG - Intergenic
1147139656 17:38453954-38453976 CCGGGAGCCCCCGCCGGCCGCGG + Intronic
1147754816 17:42761287-42761309 CCGGCGGCCCGCGTCTCCCTAGG + Exonic
1147820970 17:43241641-43241663 CCCGGGGCCGCCTTCTGCCTGGG + Intergenic
1148242327 17:46008742-46008764 CCTGGAGGCCCCATCAGCCTGGG - Intronic
1148328353 17:46797338-46797360 CCTGGAGCTGCCGTCTTCCTGGG - Intronic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1149659671 17:58327711-58327733 CCTGGAGCTCCCGTCTCCTTTGG + Exonic
1150004633 17:61462355-61462377 GGGGGAGCCCCCATCTGTCTGGG + Intronic
1151455354 17:74222503-74222525 CTGGTGGCCGCCGTCTGCCTGGG + Exonic
1151983732 17:77528951-77528973 CCGCGTGCCCCTCTCTGCCTCGG + Intergenic
1152559472 17:81070763-81070785 CCGGGAGCCCCCGTCTGCCTGGG + Intronic
1158104707 18:53872458-53872480 CCGGGAGTCCCTGTCTCCGTGGG + Intergenic
1160014126 18:75127722-75127744 CCAGGAGCCCCAGCCTCCCTGGG + Intergenic
1160906994 19:1456195-1456217 CGAGGAGCCCCGTTCTGCCTGGG - Intronic
1161420090 19:4171779-4171801 CTGGAAGCCCCAGTCTGCCCCGG - Exonic
1161482776 19:4519148-4519170 CCGAGACCCCGCTTCTGCCTGGG - Intergenic
1161487399 19:4543577-4543599 CCGGGGGCCCCCCGATGCCTTGG - Exonic
1161993579 19:7698927-7698949 CCCAGAGCCCCCGACAGCCTGGG + Intronic
1162344955 19:10113550-10113572 CCAAGAGCCCACGTCTGCCATGG - Intronic
1162363042 19:10231020-10231042 CCGGGCGGCCCCCACTGCCTCGG - Intronic
1162589155 19:11579188-11579210 CCAGGAGCCTCCATCTGCCTGGG + Intronic
1163267095 19:16227950-16227972 CCGGTAGCTCCCGGCTACCTCGG + Intronic
1165406286 19:35633143-35633165 TCGTGGGCCCCCCTCTGCCTGGG + Exonic
1165475188 19:36026390-36026412 CTCGGAGCCCCCCTCTCCCTTGG + Intronic
1166121630 19:40690491-40690513 CCGGGCGCCCCCGCCTCCCGCGG + Exonic
1168353428 19:55688783-55688805 ACAGAAGCCCCCGTCTGTCTAGG + Intronic
926892446 2:17649975-17649997 CCGGGAGCCCCTGACAGCCTCGG - Intronic
937452430 2:122012532-122012554 CCGGGCTCCCCAGCCTGCCTTGG - Intergenic
938117692 2:128613016-128613038 CATGAAGCCCCCTTCTGCCTGGG - Intergenic
938729362 2:134134369-134134391 CCAGGAGCCCCCTGCAGCCTGGG + Intronic
940398540 2:153221648-153221670 CCTGGATCCCCCGCCTGCCAAGG + Intergenic
941928473 2:170918168-170918190 GGGGGCTCCCCCGTCTGCCTAGG + Intergenic
947247581 2:228066595-228066617 CCCTGAGCCCCCGGCTGCGTGGG + Intronic
947750157 2:232527815-232527837 CATGGAGATCCCGTCTGCCTTGG + Intronic
947915346 2:233828828-233828850 CCGGGTGCCCTGGTCAGCCTGGG + Intronic
1172502743 20:35438558-35438580 CCAGGAGCCCCCGTGAGCCATGG - Intronic
1172600567 20:36179908-36179930 CCAGGAGCCCCAGCCTGGCTGGG + Intronic
1173528321 20:43749826-43749848 CCGGTGGCCCACGTCGGCCTAGG - Intergenic
1174483237 20:50845546-50845568 CTCCGAGCCCCCGGCTGCCTGGG - Intronic
1176104991 20:63381712-63381734 CCCGGAGCCGCCGTCTTCCCTGG - Intergenic
1176217381 20:63954685-63954707 CCAGGGGCCCCGGTCTGCCCTGG - Intronic
1176427988 21:6560500-6560522 CCGGGAGCCCCAGGGTGCCCAGG + Intergenic
1178710410 21:34911739-34911761 CTGGGAGCACCTGTCTCCCTCGG + Intronic
1179476249 21:41648114-41648136 ACGGGAACCCCCATCTGCCTGGG - Intergenic
1179703479 21:43168817-43168839 CCGGGAGCCCCAGGGTGCCCAGG + Intergenic
1182102139 22:27664924-27664946 CCAGGAGCTCCTGTCTGCCCAGG + Intergenic
1182421553 22:30250989-30251011 CCGGGCACCCCCGGCTGCCCAGG + Intergenic
1182903952 22:33920732-33920754 CCGGGAGCGCTCGCCGGCCTTGG + Intronic
1184276522 22:43412083-43412105 CCGGGAGCCCCTGCCTCCCTCGG + Intronic
1184982306 22:48103211-48103233 ACGGGAGGCTCCGTCTGCATTGG + Intergenic
951986933 3:28631493-28631515 CTGGAAGCACCCGTCTGCCCAGG + Intergenic
953983640 3:47425655-47425677 CCGGGAGCCCCAGTGGGCCGGGG - Intronic
955687987 3:61563787-61563809 GCGGGAGCCCTCGTCGCCCTTGG + Intronic
961832690 3:129632318-129632340 CCAGGAGGCCCAGGCTGCCTGGG + Intergenic
966613051 3:181887349-181887371 CCGGGAGCCACCCTGGGCCTTGG + Intergenic
966877678 3:184332618-184332640 CCGAGAGCACCCGTCTTCCCAGG - Intronic
968064003 3:195748079-195748101 CCCGGAGCCCAGGTCTGCGTGGG + Intronic
968092939 3:195909487-195909509 CCGGGGGCCCCCGACCGGCTCGG + Intronic
969394288 4:6910318-6910340 CCCGGAGCCCCCTTCCACCTCGG + Intronic
969425412 4:7121253-7121275 CCGGGAGGCCCTGCCCGCCTTGG + Intergenic
972279722 4:37590402-37590424 CCAGGAGCCCCTGTCATCCTGGG - Exonic
979455439 4:120922175-120922197 GCGGGAGCCTCCCTCTTCCTCGG - Intronic
981615638 4:146640402-146640424 CGCGGAGCCCACATCTGCCTGGG - Exonic
984958287 4:185068163-185068185 CCATGTGCCCCCCTCTGCCTAGG + Intergenic
985699025 5:1359202-1359224 CCGGGTGCCCCGCTGTGCCTGGG + Intergenic
991435842 5:66596572-66596594 CCAGGAGCCCGCGTCTTCCCCGG + Exonic
992042378 5:72848557-72848579 ACGGGAGCCCCCGGCCGCCGGGG - Intronic
999294353 5:150449372-150449394 GCGGGAGCCCACGTCTGTCCCGG + Intronic
1001948029 5:175796741-175796763 CCGGGCGCCCTCGTCGGCCGCGG + Exonic
1003175606 6:3750960-3750982 CCGGGCGCCCCCGCCCTCCTCGG + Intronic
1003901581 6:10659985-10660007 CCGGGCGACCCCGCCGGCCTTGG + Intergenic
1004378810 6:15114747-15114769 CCAGGAGCCACTGCCTGCCTGGG - Intergenic
1005297740 6:24443224-24443246 CCGGGAGCTCTCTTCTTCCTCGG - Intronic
1006081851 6:31572413-31572435 CCTGGATCCCCGGCCTGCCTGGG + Intronic
1007210827 6:40192203-40192225 CAGGGAGCCCCAGTCTGATTTGG + Intergenic
1007256982 6:40536304-40536326 CAGGGAGCCCCAGTCTGAATGGG + Intronic
1017507445 6:155081591-155081613 CAGGGAGCCTCTGCCTGCCTGGG - Intronic
1018134661 6:160767526-160767548 CCGGGCGCCCTCGCCTCCCTGGG - Intergenic
1019386565 7:760055-760077 CCGCGCGGCCCCGTCTCCCTCGG - Intronic
1019756509 7:2774573-2774595 CCTGGACCCCCCCTTTGCCTCGG - Intronic
1021486084 7:21169856-21169878 CCCGGAGCCCCGGCCTGGCTCGG + Intergenic
1025976713 7:66376500-66376522 CCGGGAGGCGCCGTCAGGCTGGG + Intronic
1027159429 7:75791513-75791535 CCAGGAGCCCCCATCTGCTGTGG + Intergenic
1032457150 7:132081856-132081878 CCTGGAGCCCCATTCTGCCCCGG + Intergenic
1035315154 7:157992981-157993003 CCTGGAGCCCCCGTCTTACTGGG + Intronic
1035371322 7:158380781-158380803 CCTGGAGCCAACTTCTGCCTGGG + Intronic
1036498827 8:9295094-9295116 CTAGGAGCCCCCATCTGCCCAGG + Intergenic
1038734501 8:30156655-30156677 CCGGGAGACCCCCTCTGCGCAGG - Intronic
1047687131 8:127315918-127315940 CAGGGAGCAGCCGCCTGCCTTGG + Intergenic
1048484000 8:134831477-134831499 CCGGGAGCACCCGTCTGGATGGG - Intergenic
1050457706 9:5849435-5849457 CCAGGACCCCCTGTCTGCTTTGG - Intergenic
1053409019 9:37903841-37903863 CCGGGCTCCCCCGCCTGCCGCGG - Exonic
1054810217 9:69428420-69428442 CAGGGAGCCACCATCAGCCTTGG - Exonic
1060216683 9:121742687-121742709 ACGGTTGCCCCCATCTGCCTTGG + Intronic
1061727816 9:132590775-132590797 CCGGGAGGCCCGGGCCGCCTTGG - Intergenic
1062169547 9:135127314-135127336 CCCGGTGCCCCCGCCAGCCTGGG - Intergenic
1062547254 9:137069387-137069409 GCAGCAGCCCCCGCCTGCCTAGG + Intronic
1062560582 9:137139877-137139899 CCGGGAGGCCTCGTCTCACTAGG + Intronic
1185615679 X:1420423-1420445 CAGGAAGCCCCCGGCTCCCTGGG + Intronic
1190246810 X:48696374-48696396 CTGGGAGCCCCGGCCTGCTTGGG + Intronic
1195884422 X:109624661-109624683 CTGGGAGCCCGCGGCAGCCTCGG + Exonic
1197766662 X:130063725-130063747 CTGGGAGCCCCTGTGTGTCTTGG + Intergenic
1200078054 X:153561629-153561651 CAGGGAGCACCCGTATGCCCTGG - Intronic