ID: 1152560417

View in Genome Browser
Species Human (GRCh38)
Location 17:81075835-81075857
Sequence CCTCATATGGAGCCTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152560417_1152560424 6 Left 1152560417 17:81075835-81075857 CCAGCCACAGGCTCCATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1152560424 17:81075864-81075886 GGGCACTGCCATCTCTGTCCTGG 0: 1
1: 0
2: 3
3: 32
4: 237
1152560417_1152560427 14 Left 1152560417 17:81075835-81075857 CCAGCCACAGGCTCCATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1152560427 17:81075872-81075894 CCATCTCTGTCCTGGCACGGAGG 0: 1
1: 0
2: 4
3: 52
4: 473
1152560417_1152560425 11 Left 1152560417 17:81075835-81075857 CCAGCCACAGGCTCCATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1152560425 17:81075869-81075891 CTGCCATCTCTGTCCTGGCACGG 0: 1
1: 0
2: 1
3: 27
4: 311
1152560417_1152560430 25 Left 1152560417 17:81075835-81075857 CCAGCCACAGGCTCCATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1152560430 17:81075883-81075905 CTGGCACGGAGGTTCTGCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 112
1152560417_1152560429 24 Left 1152560417 17:81075835-81075857 CCAGCCACAGGCTCCATATGAGG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1152560429 17:81075882-81075904 CCTGGCACGGAGGTTCTGCCAGG 0: 1
1: 0
2: 1
3: 22
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152560417 Original CRISPR CCTCATATGGAGCCTGTGGC TGG (reversed) Intronic
900368889 1:2322805-2322827 GGTCAGATGGGGCCTGTGGCCGG - Intronic
900487407 1:2929924-2929946 CCTTCCATGGAGCCTGTGTCTGG + Intergenic
902747258 1:18482194-18482216 CCCCATGTGCAGCCGGTGGCCGG + Exonic
904378609 1:30096678-30096700 CCCCATATGGTAGCTGTGGCTGG - Intergenic
906332743 1:44901225-44901247 CCTCCTATGGAGGCTGAGGCAGG - Intronic
912828535 1:112929249-112929271 CCCCAGATGGAGGCTGGGGCTGG - Exonic
915783204 1:158577760-158577782 CCTGATATAGTGACTGTGGCGGG - Intergenic
916704133 1:167329388-167329410 TCGCATATGCAGCCTGTGGCGGG + Intronic
916877698 1:168987480-168987502 ACTCAAATGGAGGCTGTGACAGG - Intergenic
918199059 1:182249758-182249780 GCTACTATGGAGCCTGAGGCAGG + Intergenic
920403229 1:205690409-205690431 CTTCATTTGGAGTCTGGGGCTGG - Intergenic
920501551 1:206488478-206488500 CCTCACAAGGATGCTGTGGCAGG + Intronic
921313813 1:213871786-213871808 CCTGATATCGTGCCTGTGACGGG + Intergenic
922281319 1:224127133-224127155 CATCTTATGGACCCTGTGACAGG - Intronic
922915855 1:229257109-229257131 CCTCACAGGGATCCTGAGGCAGG + Intergenic
1062786254 10:267663-267685 CCACATTTGGACCCTGTGGTCGG + Intergenic
1065536650 10:26721719-26721741 CCTTATGTGGAGCCTTGGGCGGG + Intronic
1067158562 10:43803151-43803173 CCTCACATGGAGCAAGGGGCCGG + Intergenic
1067894235 10:50162246-50162268 GCTCATATGGCCCCAGTGGCAGG - Intergenic
1067954606 10:50778015-50778037 GCTCATATGGCCCCAGTGGCAGG + Intronic
1070823736 10:79379217-79379239 CCTCCTGTGCAGCCTGTGCCCGG - Intergenic
1075090959 10:119444018-119444040 CCTCACATCCAGCCTGTGGGGGG + Intronic
1077672260 11:4167319-4167341 CCACATTTGGAGGCTGTGGTAGG - Intergenic
1078706198 11:13746557-13746579 CCACAAATGGACCCTGTGTCAGG + Intergenic
1080509043 11:32948515-32948537 GCTAATGTGGAGCCTGAGGCAGG + Intronic
1081743565 11:45457597-45457619 ACTCAAATGGTCCCTGTGGCTGG - Intergenic
1083793877 11:65003337-65003359 CCTCATGTGGAGGCTGGTGCCGG + Intergenic
1088287856 11:108206467-108206489 CCTCACAGGGAGCCAGTGCCTGG - Intronic
1092514313 12:9192609-9192631 ATTCACCTGGAGCCTGTGGCTGG - Exonic
1097078475 12:56412448-56412470 CCTCACATGGAGCCGGTGCCTGG - Intergenic
1100306540 12:93355062-93355084 GCACATAGGGAGGCTGTGGCAGG + Intergenic
1102629819 12:114268216-114268238 CCTGTTATGGAGCCTGTTGAGGG + Intergenic
1103271768 12:119679631-119679653 CCTCTTATGGAGGGTGGGGCAGG - Intronic
1103335298 12:120184794-120184816 CCACATATGGGGCCTTTGGCTGG + Intronic
1103818090 12:123674987-123675009 GCTACTATGGAGGCTGTGGCAGG - Intronic
1104600934 12:130152838-130152860 CCTCCTCTGGACCCTGTGGTGGG - Intergenic
1104795640 12:131515199-131515221 TCTCATATGGAGCCAGTCACTGG - Intergenic
1105302096 13:19144558-19144580 GCTCCTAAGGAGCCTGAGGCGGG + Intergenic
1106712174 13:32349567-32349589 GCTCACATGGAGGCTGAGGCGGG + Intronic
1107577063 13:41736953-41736975 CCTCTTCTGGAGGCTGAGGCAGG - Intronic
1115002885 14:28442783-28442805 CCTCATTTGGCTCCTGTGGATGG - Intergenic
1116326169 14:43535634-43535656 CCGCAGGGGGAGCCTGTGGCAGG - Intergenic
1117222623 14:53621042-53621064 CCTCATGTGGAAAGTGTGGCTGG - Intergenic
1118680815 14:68239701-68239723 CCTCATATGGTTCTTTTGGCTGG - Intronic
1120942048 14:89958052-89958074 CCCTACATGGAGCCTGTGACTGG - Intronic
1127857316 15:62963127-62963149 CCTCACCTGGAGCCTGAGGATGG - Intergenic
1131470718 15:92694233-92694255 CCCCCTGTGGACCCTGTGGCTGG - Intronic
1132409052 15:101562798-101562820 CCTCCTATGGTGCCAGTGACAGG + Intergenic
1134173237 16:11985643-11985665 TCTAGTCTGGAGCCTGTGGCTGG + Intronic
1136424761 16:30162289-30162311 CCTCCTGGGGAGACTGTGGCAGG + Intergenic
1139975899 16:70810072-70810094 CCTGCTATGGAGCCTTGGGCAGG - Intronic
1140083363 16:71772240-71772262 CCTCACCTGGAGGCTGAGGCAGG - Intronic
1142833873 17:2569991-2570013 CCTACTATGGAGGCTGAGGCAGG + Intergenic
1143951794 17:10638420-10638442 CCTCAATTCGAGCCTGTGGAGGG + Exonic
1144140825 17:12346193-12346215 CCTCACATGGAACCTGTAGAAGG + Intergenic
1144520620 17:15950274-15950296 CCTCCTTTGGAACCTCTGGCAGG + Intronic
1145966500 17:28922198-28922220 GCTCATATGGAGGCTGAGGCAGG - Intronic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1147512269 17:41081281-41081303 TCTCATTTGGAGCCTGTGATGGG - Intergenic
1147514441 17:41102452-41102474 TCTCATTTGGAGCCTGTGATGGG - Intronic
1147769758 17:42859458-42859480 CCTCATCTGGGGCCTGGGGCAGG - Intergenic
1150176828 17:63066230-63066252 GCTAGTGTGGAGCCTGTGGCTGG + Intronic
1151842665 17:76628873-76628895 CCTCATAATGAGCTTGGGGCAGG + Intronic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152560417 17:81075835-81075857 CCTCATATGGAGCCTGTGGCTGG - Intronic
1152715051 17:81895431-81895453 CATCCTATGGAGTCTGTGACAGG - Intronic
1152763488 17:82122165-82122187 CCTCCTTCAGAGCCTGTGGCCGG + Intronic
1153569241 18:6451835-6451857 CTTCACATACAGCCTGTGGCAGG - Intergenic
1155037141 18:22034214-22034236 CCTCGTGTTGAGCCTGTGTCTGG - Intergenic
1156863403 18:41863889-41863911 ACTCATCTGCAGCATGTGGCAGG + Intergenic
1159458654 18:68694402-68694424 CCTCACATGGAGCAGGTGCCTGG + Intronic
1163350234 19:16772251-16772273 GCTAATATAGAGGCTGTGGCCGG + Intronic
1164447412 19:28329862-28329884 CCTCATATAGAACCTCTGCCAGG + Intergenic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164587123 19:29483078-29483100 CCTGAACTGGAGCCTGGGGCAGG - Intergenic
1165446636 19:35860386-35860408 CCTCACCTGTAGCCTGTGACAGG - Exonic
1165455713 19:35909429-35909451 CCCCAGCTGGAGCCTGGGGCTGG + Intergenic
1166929076 19:46290290-46290312 CCTCACCTGGGCCCTGTGGCTGG - Intergenic
1168704429 19:58461079-58461101 TCTCATTTGGAGCCTGTTTCTGG + Intergenic
925693951 2:6554323-6554345 CCTCCGATGGAGCCATTGGCTGG + Intergenic
925879094 2:8335934-8335956 CTTCACCTGGCGCCTGTGGCTGG - Intergenic
926421148 2:12700785-12700807 CCTCACATGGATCCTGAGGCAGG + Intergenic
926637027 2:15191875-15191897 CCTCAAAGGGACCCTGAGGCTGG - Intronic
930855038 2:56006546-56006568 CCTCACATGGAGCATTTGCCAGG - Intergenic
932746500 2:74337983-74338005 CCTGACATGGAGCCTCTGGAGGG + Intronic
934567462 2:95348434-95348456 CCCCATCTGGAGCCTGGGGTGGG + Intronic
940945311 2:159609825-159609847 ACTCACATGGAGCCTGTGCTTGG - Intronic
941508141 2:166373425-166373447 ATTGATATGGAGGCTGTGGCAGG + Intronic
942971726 2:181964815-181964837 GCTACTCTGGAGCCTGTGGCAGG - Intronic
1168935284 20:1659818-1659840 CCTCATAGTGAGGCTGGGGCAGG + Intergenic
1170871210 20:20208455-20208477 GCACATAGGAAGCCTGTGGCTGG + Intronic
1174328898 20:49802105-49802127 CCTCATCTGGAGGCTATGGGAGG + Intergenic
1176125704 20:63473560-63473582 CCCCAGAAGGGGCCTGTGGCAGG + Intergenic
1182558474 22:31141532-31141554 ACTCAGATGGAGCCTGGGGCAGG - Intergenic
1184296326 22:43527655-43527677 CCTCATTTGGACCCTGTGCAGGG + Intergenic
1184301594 22:43563956-43563978 CCTCAATTGGAGCCTGTGATTGG - Intronic
1185014579 22:48335510-48335532 CCTCAGCTGGGCCCTGTGGCAGG + Intergenic
952268634 3:31811139-31811161 GCTCAGATGTAGCCTGTGGATGG + Intronic
952964780 3:38614373-38614395 CCACATGTGGAGTCTGGGGCTGG + Intronic
954365137 3:50141654-50141676 CCTAATCTGGAGGCTGAGGCAGG - Intergenic
954453897 3:50586580-50586602 CCTCTTCTGGGGCATGTGGCTGG + Intergenic
960745091 3:120878741-120878763 GCTCTTAGGGAGCCTGAGGCAGG - Intergenic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
964980981 3:162678727-162678749 GCTTATATTGATCCTGTGGCTGG + Intergenic
969369775 4:6724232-6724254 CCTCATCTGGAGACTGTGATGGG + Intergenic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
975487645 4:74951599-74951621 CATCATTTGGGGCCTGTCGCGGG - Intronic
978790614 4:112659977-112659999 CCTCCTCAGGAGCCTGAGGCGGG + Intergenic
981824140 4:148920611-148920633 CCTCATATAGAGTCTGTTTCTGG - Intergenic
983133582 4:164052418-164052440 CCTACTATGGAGGCTGAGGCAGG + Intronic
985109485 4:186534273-186534295 CCTCATATGGCTCCTGACGCTGG - Exonic
985666106 5:1182258-1182280 CCTCTTAGGGAGGCTGAGGCAGG - Intergenic
986017287 5:3768408-3768430 CCTCAGATGGAGCATGTGTCTGG - Intergenic
988289487 5:29267210-29267232 CCTCATACTGTTCCTGTGGCAGG - Intergenic
988419943 5:30992985-30993007 CCTCCTAAGGAGACTGTGCCAGG - Intergenic
989053977 5:37348190-37348212 GCTACTAGGGAGCCTGTGGCAGG + Intronic
989160681 5:38387825-38387847 CCTCATAGACAGCCTGTGACAGG - Intronic
991484333 5:67119028-67119050 CCTCTGATGTAGCCTGTGTCTGG - Intronic
992381348 5:76240736-76240758 CCCCAAATGGAGCCTGAGACAGG - Intronic
992835875 5:80640935-80640957 CTTCAGTTGGTGCCTGTGGCAGG + Intronic
993420998 5:87700840-87700862 CCTGAGATGGAGCCCATGGCAGG - Intergenic
993463997 5:88222313-88222335 CCTCTTTTGGAGGCTGAGGCAGG - Intronic
994514198 5:100750029-100750051 CCTCATATGGAACTTGTCACTGG - Intergenic
997033183 5:130155616-130155638 CCCCACGAGGAGCCTGTGGCAGG - Intronic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
1002044331 5:176533513-176533535 CCTCCCATGAAGCCTGGGGCTGG - Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1006439979 6:34047897-34047919 CTTCAAAAGGAGCCTGTGGCTGG - Intronic
1008556249 6:52675493-52675515 CCACATCTCTAGCCTGTGGCTGG + Intronic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1013595933 6:111661174-111661196 GCTAATGTGGAGACTGTGGCCGG - Exonic
1015926187 6:138312438-138312460 CGTCATATGGGGCCTGGGGGAGG - Intronic
1017791776 6:157805971-157805993 CTTCATACCCAGCCTGTGGCCGG - Intronic
1018632122 6:165830454-165830476 CCTCATATGGAGGCAGAGGCTGG - Intronic
1026138370 7:67683356-67683378 CCTCAGCTGGAGCTTCTGGCTGG - Intergenic
1029269855 7:99370723-99370745 CCTCCTCTGGAGGCTGAGGCAGG - Intronic
1030335295 7:108318800-108318822 CCTCATCTGGAGGCTGTTCCAGG - Intronic
1031700175 7:124915201-124915223 TCTCATCTGAAGCCTGTGGTTGG - Intronic
1032111298 7:129078187-129078209 GCTCATCGGGAGCCTGAGGCAGG - Intergenic
1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG + Intergenic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1037510102 8:19574030-19574052 GCTTATCTGGAGGCTGTGGCGGG - Intronic
1040333672 8:46405204-46405226 GCTCAGATGGAGCTTGAGGCAGG + Intergenic
1044608696 8:94071036-94071058 GCTCACCTGCAGCCTGTGGCTGG + Intergenic
1044984011 8:97742218-97742240 GCTCCTCGGGAGCCTGTGGCAGG - Intergenic
1047760215 8:127949056-127949078 CTTCATGTGTAGCCTTTGGCTGG + Intergenic
1047900582 8:129417495-129417517 CCTCATATGGGGCCATTGGTAGG - Intergenic
1048210494 8:132450578-132450600 CCTGCTATGGAACCTGTGGCTGG - Intronic
1048332490 8:133480159-133480181 CCTCGTATTGAGCATGTGGCTGG - Intronic
1052790139 9:32867917-32867939 GCTCATATTGAGCCTGTAGTTGG - Intergenic
1056638729 9:88352156-88352178 ACTCATACGGAGGCTGAGGCAGG + Intergenic
1056687683 9:88779795-88779817 ACTCATACGGAGGCTGAGGCAGG - Intergenic
1060815908 9:126635043-126635065 CTTCATATGGCGCTTGTGCCTGG - Intronic
1062017435 9:134297831-134297853 CCTCATGGGGAGGCTGAGGCTGG + Intergenic
1203787876 EBV:137697-137719 CCGCCTATGGGGCCTGTGACTGG + Intergenic
1186249707 X:7652532-7652554 CCAGAGATGGTGCCTGTGGCTGG - Intergenic
1191870754 X:65742944-65742966 CCTCCTACGGAGGCTGAGGCAGG - Intergenic
1192594264 X:72389689-72389711 TTTCTTTTGGAGCCTGTGGCTGG - Intronic
1195118686 X:101727141-101727163 CATGATATAGAGCTTGTGGCAGG - Intergenic
1197613565 X:128666167-128666189 CTGAATATGGGGCCTGTGGCTGG + Intergenic
1197858337 X:130942992-130943014 GCTCATACTGAGTCTGTGGCAGG - Intergenic
1199851030 X:151725087-151725109 GCTCATAAGGAGCCCGTGGCTGG + Intergenic
1200081772 X:153580483-153580505 CCGGATGAGGAGCCTGTGGCAGG - Exonic
1201639294 Y:16161590-16161612 CCTCCCTTGGAGCCTGTGGAGGG + Intergenic
1201663519 Y:16423737-16423759 CCTCCCTTGGAGCCTGTGGAGGG - Intergenic