ID: 1152560733

View in Genome Browser
Species Human (GRCh38)
Location 17:81077664-81077686
Sequence ACCACCAGCCTCAGGACGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 142}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152560733_1152560744 19 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560744 17:81077706-81077728 GTGGGAGCGGGTGCCGTCTCAGG 0: 1
1: 0
2: 2
3: 18
4: 128
1152560733_1152560741 1 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560741 17:81077688-81077710 CTGAGTATGCGGGTGGCTGTGGG 0: 1
1: 0
2: 2
3: 18
4: 336
1152560733_1152560743 7 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560743 17:81077694-81077716 ATGCGGGTGGCTGTGGGAGCGGG 0: 1
1: 0
2: 1
3: 22
4: 347
1152560733_1152560742 6 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560742 17:81077693-81077715 TATGCGGGTGGCTGTGGGAGCGG 0: 1
1: 0
2: 1
3: 18
4: 510
1152560733_1152560737 -10 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560737 17:81077677-81077699 GGCTGGTGGTGCTGAGTATGCGG 0: 1
1: 1
2: 1
3: 35
4: 294
1152560733_1152560739 -6 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560739 17:81077681-81077703 GGTGGTGCTGAGTATGCGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 232
1152560733_1152560740 0 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560740 17:81077687-81077709 GCTGAGTATGCGGGTGGCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 325
1152560733_1152560738 -9 Left 1152560733 17:81077664-81077686 CCGCCCGTCCTGAGGCTGGTGGT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1152560738 17:81077678-81077700 GCTGGTGGTGCTGAGTATGCGGG 0: 1
1: 0
2: 0
3: 20
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152560733 Original CRISPR ACCACCAGCCTCAGGACGGG CGG (reversed) Intronic