ID: 1152561944

View in Genome Browser
Species Human (GRCh38)
Location 17:81083034-81083056
Sequence CCGGGTCCTCTCGCCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152561944_1152561952 17 Left 1152561944 17:81083034-81083056 CCTGGAAGGGCGAGAGGACCCGG 0: 1
1: 0
2: 3
3: 13
4: 165
Right 1152561952 17:81083074-81083096 GACTCAGCTGTGCTTTGAGGAGG 0: 1
1: 0
2: 2
3: 16
4: 175
1152561944_1152561951 14 Left 1152561944 17:81083034-81083056 CCTGGAAGGGCGAGAGGACCCGG 0: 1
1: 0
2: 3
3: 13
4: 165
Right 1152561951 17:81083071-81083093 CCAGACTCAGCTGTGCTTTGAGG 0: 1
1: 0
2: 2
3: 16
4: 254
1152561944_1152561954 19 Left 1152561944 17:81083034-81083056 CCTGGAAGGGCGAGAGGACCCGG 0: 1
1: 0
2: 3
3: 13
4: 165
Right 1152561954 17:81083076-81083098 CTCAGCTGTGCTTTGAGGAGGGG 0: 1
1: 0
2: 0
3: 29
4: 285
1152561944_1152561953 18 Left 1152561944 17:81083034-81083056 CCTGGAAGGGCGAGAGGACCCGG 0: 1
1: 0
2: 3
3: 13
4: 165
Right 1152561953 17:81083075-81083097 ACTCAGCTGTGCTTTGAGGAGGG 0: 1
1: 0
2: 1
3: 23
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152561944 Original CRISPR CCGGGTCCTCTCGCCCTTCC AGG (reversed) Intronic
900351899 1:2238953-2238975 CCGGGTCCCCACCCCCCTCCAGG - Intronic
900469878 1:2848457-2848479 CCAGGTCCTCTCCCCATCCCTGG - Intergenic
900529154 1:3144277-3144299 CCGGCGCCTCTCTCCCTCCCAGG - Intronic
900600659 1:3501435-3501457 CCGGGTCCTCTCCCCTCCCCGGG - Intronic
901098441 1:6701458-6701480 CGGGGGCCTCTGGCCCTACCCGG + Intronic
901166161 1:7223055-7223077 CTTGTTCCTCTCGCCCTTGCGGG + Intronic
901738106 1:11325115-11325137 CGGGGTCCTCGCTCCCTCCCTGG - Intergenic
902304040 1:15524011-15524033 CCGGGTCCCCACGCCCCTCGAGG - Intronic
902622291 1:17657481-17657503 CAGGCTCCTCTGCCCCTTCCAGG - Intronic
902760048 1:18575242-18575264 CCAGGACCTCTCGTCCTACCAGG + Intergenic
902809539 1:18880323-18880345 CCGAGCCCGCTCGCCCTCCCAGG + Intronic
903970698 1:27117076-27117098 CAGGTTCCTCTCTCTCTTCCTGG + Intronic
904282042 1:29427468-29427490 CTGGGTCACCTCACCCTTCCAGG + Intergenic
904463183 1:30692580-30692602 CAGGGTCCCCTAGCCCATCCTGG + Intergenic
904675708 1:32198088-32198110 CCTGCTCCTCTTGCCCTTCCTGG + Exonic
905454140 1:38075956-38075978 CAGGGTCCCCTCTTCCTTCCTGG - Intergenic
905932750 1:41801176-41801198 CAGGGACCTCTCTTCCTTCCAGG - Intronic
905969109 1:42127454-42127476 CACGTTCCTCTCCCCCTTCCCGG - Intergenic
908356799 1:63330203-63330225 CTGGGTCCTCTCGGCCTCCCAGG - Intergenic
914376377 1:147077271-147077293 CCCGGTGCGCGCGCCCTTCCCGG - Intergenic
914376423 1:147077433-147077455 GAGGATCCTCTCGCCCCTCCTGG - Intergenic
914505865 1:148288325-148288347 GAGGATCCTCTCGCCCATCCTGG - Intergenic
914506696 1:148295843-148295865 GAGGATCCTCTCGCCCATCCTGG + Intergenic
914875692 1:151511507-151511529 CCGGGTCCACTCACCCTAGCCGG - Exonic
918832553 1:189416458-189416480 CCTGGACCTCTTGCACTTCCTGG + Intergenic
919705269 1:200669805-200669827 TCGGGCCGTCTCCCCCTTCCAGG + Exonic
920085145 1:203409915-203409937 CAGGGTCCTCTGGCCATTCCTGG + Intergenic
1069842311 10:71347509-71347531 CCTGGGCCACTCTCCCTTCCTGG + Intronic
1070195227 10:74150816-74150838 GCGGGTCCTCGCGGCCTTCTCGG - Exonic
1070381288 10:75882789-75882811 CCAATTCCTCTCCCCCTTCCAGG + Intronic
1075930255 10:126289258-126289280 CCGTGCCCTCTCCCACTTCCAGG + Intronic
1075942736 10:126405403-126405425 CCTGGCCATCTGGCCCTTCCAGG - Intergenic
1076622997 10:131804745-131804767 CCGCAGCCTCTCGCCCATCCTGG + Intergenic
1076659865 10:132048337-132048359 CCGGGTGCTCTCGGGCTCCCAGG + Intergenic
1076706293 10:132303543-132303565 CAGGTTCCTCTCGCCCTTCCTGG - Intronic
1077098325 11:809504-809526 CCGGGCCCACGCGCCGTTCCGGG + Intronic
1077106703 11:845386-845408 CCGGGTCCTCTCTACGGTCCTGG + Intronic
1077914727 11:6603820-6603842 GCGGGTCCTCTCGCACTCACCGG - Exonic
1083860215 11:65416442-65416464 CCGGCTCCTCTCGCCCCCACTGG + Intergenic
1083886058 11:65574065-65574087 ACGGGTCCTGGAGCCCTTCCAGG - Exonic
1083941605 11:65899362-65899384 CCGGGGCGTCCCTCCCTTCCTGG - Intronic
1084083862 11:66845800-66845822 CCACCTCCTCTGGCCCTTCCAGG - Intronic
1084265653 11:68003947-68003969 CCGGGGCCTCGGGCCCGTCCGGG + Exonic
1084897288 11:72282674-72282696 CAGGGTCCTTTTGCCCCTCCTGG + Intergenic
1089591011 11:119540680-119540702 CTGGGTCCTCTGGTCTTTCCTGG - Intergenic
1090396899 11:126425023-126425045 CCTCTTCCTCTCGCCCATCCAGG - Exonic
1097054207 12:56240174-56240196 CCGGGTCTGCTGGTCCTTCCTGG + Exonic
1103731247 12:123029104-123029126 CCTGGTCCTCTCCGCCTGCCAGG + Intronic
1103924182 12:124414597-124414619 TCGGGTTCTCCCTCCCTTCCTGG - Intronic
1106456794 13:29934938-29934960 GCTGGTCCTCTCTCCCTCCCTGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1115548935 14:34488006-34488028 CTGTCTCCTCTTGCCCTTCCAGG + Intergenic
1119569992 14:75661527-75661549 CGGGGTCGTCCCGTCCTTCCCGG + Intronic
1121244213 14:92450723-92450745 CTGGGTCCTCTGGGCCTTCATGG + Intronic
1124202033 15:27686881-27686903 CCAGGTCCTCGTGCTCTTCCAGG - Intergenic
1125743699 15:41984905-41984927 CTGGTTCCAGTCGCCCTTCCAGG - Intronic
1128992383 15:72272133-72272155 CCGTGTCCTCTCTCCCTGCGGGG - Intronic
1129749907 15:78055326-78055348 CTGGGTCCTCTCCCCCATCTTGG - Intronic
1132309905 15:100849807-100849829 CCGGGTCCTCCCGCCCTTCGCGG + Intergenic
1132591518 16:728271-728293 CCGGGTCCACCCGCCCTCACAGG + Intronic
1133795504 16:9043073-9043095 CCGCCTCCTCTCCCCCTGCCTGG + Intergenic
1134220839 16:12352735-12352757 CCTGGTCCTCTGTCCCTTGCTGG + Intronic
1136478203 16:30526244-30526266 CCGGGCCCTCGCTCCCTCCCTGG + Intronic
1138279249 16:55760619-55760641 CCCGGAACTGTCGCCCTTCCAGG + Intergenic
1138932471 16:61677467-61677489 CCAGGTCCTCTGGCCCTACTAGG + Intronic
1139442186 16:66973898-66973920 CCGGGTCCTCCCTCCCTTCCTGG + Exonic
1139636578 16:68261779-68261801 CTGGGTCACCTCGTCCTTCCAGG - Intergenic
1139918024 16:70439815-70439837 CCGGGGCATCTCCCCCTTGCAGG + Intergenic
1140904995 16:79402450-79402472 CAGGGGCCTCTCACACTTCCAGG + Intergenic
1140944437 16:79754727-79754749 TCTGGTCCTCTCCCACTTCCTGG - Intergenic
1142153615 16:88523457-88523479 CCGGGGCCACCCGCCCATCCTGG - Intronic
1142349950 16:89575407-89575429 CCAGATCCCCGCGCCCTTCCCGG - Intergenic
1142831105 17:2549669-2549691 TCTGCTCCTCTCGCCCTTCCAGG + Intergenic
1143504500 17:7356273-7356295 CCAGGTCCTCACGCCCATCTTGG + Exonic
1143713658 17:8752150-8752172 GAGGCTCCTCTCTCCCTTCCTGG + Intergenic
1147592017 17:41689558-41689580 CCCGGGCCTCCCGCCCTCCCTGG - Intronic
1148106154 17:45120114-45120136 CCGGCTCCCCACTCCCTTCCTGG + Intronic
1148106461 17:45121372-45121394 CCGGGTCCTCCCGCCCCGCCAGG - Exonic
1148458939 17:47826763-47826785 CCAGGTCCTGAAGCCCTTCCTGG - Exonic
1149430663 17:56593905-56593927 CCGGCTCCTCGCTGCCTTCCCGG - Exonic
1151155532 17:72121341-72121363 CCGCGGCTTCTCGCCTTTCCCGG + Exonic
1152097094 17:78278642-78278664 CCGGCTCTTCTTTCCCTTCCAGG - Intergenic
1152390956 17:80003348-80003370 CTGGGTCCTCTTGTCATTCCCGG - Intronic
1152455826 17:80415536-80415558 CCGGGTCTTCTCCCGCTTCAAGG - Intronic
1152561944 17:81083034-81083056 CCGGGTCCTCTCGCCCTTCCAGG - Intronic
1152660169 17:81538371-81538393 CCGGGCCCTGTCGCCCATCCTGG - Intergenic
1152690059 17:81713865-81713887 CTGGCTCCTCCCGCCCTCCCAGG - Intronic
1155150119 18:23116489-23116511 CCGGCACCTCTCTCCCTGCCAGG - Intergenic
1158229211 18:55234683-55234705 CTGGTTCCTCTCGCCCTTTCAGG - Exonic
1159952722 18:74496637-74496659 CCGGGGCCTCTCGCACCTCCGGG + Intronic
1160276491 18:77442504-77442526 CTGGGTTCCCTCGCCCTGCCAGG - Intergenic
1160369356 18:78358676-78358698 CAGGACCCTCTCGCCCTCCCTGG - Intergenic
1161478213 19:4497960-4497982 CCGGGTCCGCTCCACCTTCACGG - Exonic
1161664020 19:5564171-5564193 CCAGGCCCTCTCTCACTTCCGGG - Intergenic
1162299960 19:9838848-9838870 CTGGGTCCTCTGCCCCTACCTGG - Intronic
1162771817 19:12953734-12953756 CAGACTCCTCTCCCCCTTCCAGG - Exonic
1166327781 19:42061861-42061883 CCCTGTCCCCTCGCCCTGCCCGG + Intronic
1166737210 19:45093242-45093264 CCGGGTCCGCCCGCCGTCCCGGG - Exonic
1167035861 19:46994629-46994651 CCGGCTCCTCGAGGCCTTCCTGG - Intronic
1167269219 19:48498532-48498554 CCGGGTCCGCTCCCACTCCCGGG - Exonic
1167374760 19:49104706-49104728 CCGGGGCCTCCAGCCCTTCACGG - Exonic
1167648993 19:50719514-50719536 CCGGGCCCGCTCGCCCTCCGGGG - Intergenic
934566926 2:95346457-95346479 CCGGCTCCCTCCGCCCTTCCCGG + Intronic
934717495 2:96552112-96552134 CCTGGTCATCCCGGCCTTCCCGG + Exonic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
940772045 2:157849803-157849825 CCTGCTCCTCTCTCCATTCCTGG + Intronic
940775119 2:157876462-157876484 CCGCCTCCTCTCTCCCCTCCCGG - Intergenic
942854022 2:180524724-180524746 CCCTCTCCTCTCGCCCTTTCTGG + Intergenic
946702086 2:222424430-222424452 CCGGGTCCTAGCGCCCGCCCAGG - Intergenic
946841610 2:223825485-223825507 CGGGGTCATCCCACCCTTCCAGG + Intronic
948332448 2:237180385-237180407 CCGGGTCCTATTCCCTTTCCTGG + Intergenic
948368891 2:237475198-237475220 CCCGGCCCTCCAGCCCTTCCCGG - Intergenic
948752459 2:240140379-240140401 ATGGGTGGTCTCGCCCTTCCTGG - Exonic
1169318318 20:4611072-4611094 TCGGGCCCTCTCGTTCTTCCAGG + Intergenic
1170763349 20:19270965-19270987 CCGCTTCCTCTGGCCCTTGCTGG - Intronic
1172272666 20:33663414-33663436 CCGGGTCCTGTCGTCCACCCGGG - Intronic
1175344737 20:58264739-58264761 CCGGGTCCTGTCGCTGTGCCCGG - Intergenic
1175499356 20:59438910-59438932 CCAGGTCCTTTTTCCCTTCCAGG + Intergenic
1176025829 20:62985158-62985180 CCAGGGCCTCTCATCCTTCCAGG - Intergenic
1179862296 21:44196614-44196636 CCTGTTCCTCTGGCCCCTCCAGG + Intergenic
1181174978 22:21030190-21030212 CGGGCTCCTCACGGCCTTCCTGG - Exonic
1183975005 22:41506945-41506967 GCGGGTCCACTCTCCCTGCCAGG - Intronic
1184182660 22:42841202-42841224 CTGGCTCCTCTCGTCCTTCCTGG + Intronic
1184856905 22:47151258-47151280 CCGTGTACTCTCCACCTTCCCGG + Intronic
1184965080 22:47965658-47965680 CCCGGCCCTCTTCCCCTTCCCGG - Intergenic
1185296823 22:50058636-50058658 CCAGGCCTTCTCGCCCTCCCCGG + Intergenic
952216903 3:31287345-31287367 CCAGTTCCTCTCCTCCTTCCAGG + Intergenic
960120878 3:113947907-113947929 CCAGGTCCACGCGCGCTTCCGGG - Exonic
960937783 3:122913757-122913779 CCGGGGACTCTCGTCCTTTCCGG - Intronic
963912873 3:150829787-150829809 CAGGGTCCACTCGCCCTAACGGG + Intergenic
967119780 3:186372775-186372797 CAGGGTCTTCTCTCCCTTACAGG - Intergenic
968450131 4:671857-671879 CCTGGGCTTCTCGCCCCTCCTGG - Intergenic
969114042 4:4860309-4860331 CGGGGTCCTCTCGGGCTTCTCGG - Exonic
971757427 4:30721315-30721337 CCGAGTCCTCTCCCCTCTCCCGG - Exonic
978773345 4:112480499-112480521 CCGTGGCCTCTTGCACTTCCTGG + Intergenic
992484222 5:77180220-77180242 CTGGGTCCTAGCGCCCCTCCCGG - Intergenic
996121708 5:119680674-119680696 CCAGGTCCTGAAGCCCTTCCTGG + Intergenic
998018822 5:138753339-138753361 CCGGCCCCGCCCGCCCTTCCTGG - Intronic
999485004 5:151986073-151986095 CAGGGTCCTCTCGGGATTCCTGG + Intergenic
1001348865 5:170936223-170936245 CCTGGACCTCTTGCGCTTCCAGG + Intronic
1001953111 5:175829931-175829953 CCAGGTCCTCCCTCCCTCCCAGG + Intronic
1007081144 6:39105425-39105447 CTGGGTCCTATCTCCCTGCCAGG + Exonic
1007390281 6:41546624-41546646 CCGGCTCCGCTCTTCCTTCCCGG - Exonic
1010995629 6:82529023-82529045 CCTGTTCCTCTCCCCCTACCCGG - Intergenic
1013317444 6:108956163-108956185 TCTGGTCCTCAGGCCCTTCCTGG - Intronic
1014137667 6:117907637-117907659 CCGGGTCCTCTGCGCGTTCCCGG + Exonic
1015843459 6:137495787-137495809 CCTGGGGCTCTCTCCCTTCCCGG - Intergenic
1015925645 6:138307993-138308015 CCCTGTGCTCTCGCCCTCCCAGG + Intronic
1017819436 6:158038757-158038779 CCAGGTGCTGCCGCCCTTCCAGG + Intronic
1021979836 7:26043716-26043738 GTGGGTCCTCTCAGCCTTCCTGG + Intergenic
1022154029 7:27641044-27641066 CAGGCTCCTCTCTCCCTTCAAGG - Intronic
1022722995 7:32957462-32957484 CCGGGTCTCCTGGCCCTACCCGG - Exonic
1023605533 7:41927557-41927579 CCTTGTCCTCTCCCTCTTCCAGG + Intergenic
1023828229 7:44024134-44024156 CCTGCTCCTCTCGCTTTTCCAGG + Intergenic
1026139981 7:67697628-67697650 CCGAGTCCTCCCGCACTTCAGGG - Intergenic
1026867199 7:73831153-73831175 CCGGATCCCCTCAGCCTTCCAGG + Exonic
1027417794 7:77990948-77990970 GTGGGTCCTCTCGGCATTCCTGG + Intergenic
1029756531 7:102577580-102577602 CCTGCTCCTCTCGCTTTTCCAGG + Intronic
1032706232 7:134423101-134423123 CGTGGTCCTCTTGCCCCTCCTGG + Intergenic
1033807964 7:144976176-144976198 TCATGTCCTCTGGCCCTTCCTGG - Intergenic
1034859144 7:154581381-154581403 CAGGGTTCCCTGGCCCTTCCAGG - Intronic
1034954110 7:155322800-155322822 CAGGTTCCTCTCGCCCTTTCTGG - Intergenic
1036779474 8:11635538-11635560 CAGTGTCCTCTTGCCCTTCAAGG + Intergenic
1044666554 8:94639531-94639553 CGGGCTCCTCTCCCCCCTCCCGG + Intergenic
1047916729 8:129591853-129591875 CAGGGTCCTGACCCCCTTCCAGG + Intergenic
1048024267 8:130570155-130570177 CTGGGGCCTCTGTCCCTTCCTGG - Intergenic
1049404191 8:142444343-142444365 CTGGGTCCTCTCTGTCTTCCTGG + Intergenic
1049792469 8:144478286-144478308 CCTCCTCCTCCCGCCCTTCCCGG - Intronic
1052989980 9:34513429-34513451 CCGGGCCCTCCCTCCCTTCCTGG + Intronic
1055777507 9:79782199-79782221 CTGTGTCCTCTCTCCTTTCCTGG - Intergenic
1057643845 9:96854377-96854399 CCGCTTCCTCTCCCGCTTCCGGG + Exonic
1057878909 9:98778457-98778479 CCTGGTCTCCTTGCCCTTCCTGG - Intronic
1059383927 9:113949628-113949650 CCCGCTCCTCTCTCCCCTCCCGG + Intronic
1061088924 9:128415617-128415639 CCTGGTCCCCTCTCCCTTCCTGG - Intronic
1062237149 9:135515742-135515764 CCAGGGTCCCTCGCCCTTCCGGG - Intergenic
1062653450 9:137590167-137590189 CCGGCCCGTCTCGCCCGTCCAGG - Intronic
1186230137 X:7444890-7444912 CAGGCTTCTCTCGGCCTTCCTGG - Intergenic
1186466437 X:9786972-9786994 CCGGGTCCTCTGGCGCTCCCGGG + Intronic
1194643565 X:96430902-96430924 CCCTGTCCTCTGGCCCTTCATGG + Intergenic
1195221249 X:102746543-102746565 CCGGCTCCCCCCGGCCTTCCCGG - Intronic
1196170771 X:112586877-112586899 GTGGGTCCTCTCGGCTTTCCTGG - Intergenic
1196886472 X:120250967-120250989 CCGGGTCCTCACCTGCTTCCCGG - Exonic