ID: 1152562427

View in Genome Browser
Species Human (GRCh38)
Location 17:81085251-81085273
Sequence CAGAGCACGTTGCTGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152562414_1152562427 21 Left 1152562414 17:81085207-81085229 CCCCTGGCCTCTCCGACTGTAGG 0: 1
1: 0
2: 1
3: 14
4: 122
Right 1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 128
1152562417_1152562427 19 Left 1152562417 17:81085209-81085231 CCTGGCCTCTCCGACTGTAGGCA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 128
1152562420_1152562427 9 Left 1152562420 17:81085219-81085241 CCGACTGTAGGCAGAGGCAGACC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 128
1152562416_1152562427 20 Left 1152562416 17:81085208-81085230 CCCTGGCCTCTCCGACTGTAGGC 0: 1
1: 0
2: 1
3: 8
4: 206
Right 1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 128
1152562419_1152562427 14 Left 1152562419 17:81085214-81085236 CCTCTCCGACTGTAGGCAGAGGC 0: 1
1: 0
2: 0
3: 6
4: 107
Right 1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152562427 Original CRISPR CAGAGCACGTTGCTGGCGGC TGG Intronic
902072031 1:13748807-13748829 CAGAGCAGGTTGGTGGCCCCGGG + Intronic
906137187 1:43507789-43507811 CAGAGCCCCTTGCTTGCTGCAGG + Intergenic
907272908 1:53301112-53301134 CAGAGCACGTGGCTCAGGGCAGG + Intronic
919483940 1:198122881-198122903 CAGAGCTCTTTGCTGGCAGAGGG + Intergenic
919887203 1:201943492-201943514 CACAGCACCGTGCTGGGGGCAGG - Intronic
921276295 1:213524138-213524160 CATAGCAGGTTGATGGCTGCCGG + Intergenic
1063931167 10:11029614-11029636 CAGGGAACTTTGCTGGAGGCAGG + Intronic
1068669677 10:59710109-59710131 CAGGGCACGTGGTGGGCGGCGGG - Intronic
1069568254 10:69478178-69478200 CAGAGCAGGTGGCTGTCTGCAGG + Intronic
1069781920 10:70962270-70962292 CAGAGCACATTCCTGGAGGAGGG - Intergenic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1076764878 10:132627560-132627582 CGCTGCACGTTGCTGGCAGCTGG - Intronic
1077227190 11:1443475-1443497 CAGAGCCCCCTGCGGGCGGCCGG - Exonic
1078454910 11:11467428-11467450 CAGAGGATGTTGCTGGAAGCTGG - Intronic
1079115088 11:17635532-17635554 CACAGCACGTTGCTGGGGGTGGG - Intronic
1082916910 11:58446913-58446935 CAGTGCAAGTAGCTGGGGGCTGG - Intergenic
1084151702 11:67290553-67290575 CAGACCTCCTTGCTGGTGGCAGG - Intronic
1084371811 11:68750290-68750312 AAGTGCACGTTGCAGGCGGGCGG + Exonic
1084768491 11:71327471-71327493 CAGAGCAAGGTGCTGGGAGCCGG - Intergenic
1084958651 11:72704506-72704528 CAGAGCCCAGTGCTGGTGGCAGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1091366127 11:135022180-135022202 CAGAGCAGGGTGGTGGTGGCAGG + Intergenic
1091390964 12:125818-125840 CAGGGCAGGCTGCTGCCGGCCGG - Exonic
1093025014 12:14237733-14237755 CAGAGCACTTTGCTGTCCCCTGG - Intergenic
1095092919 12:38123669-38123691 GAGAGCCCGTTGCAGGCTGCTGG + Intergenic
1096982182 12:55734679-55734701 GAGAGCTTCTTGCTGGCGGCAGG - Intergenic
1098148897 12:67526184-67526206 CAGAGAACATTGCAGGCTGCTGG - Intergenic
1099355855 12:81634413-81634435 CAGAGCACGTTTCTGGCCTTTGG + Intronic
1102816676 12:115871512-115871534 CAGATCAAGTTGCTGGTGTCCGG - Intergenic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1106553905 13:30793979-30794001 CAGACCACATTGCTGGAGCCTGG - Intergenic
1107439699 13:40414983-40415005 CAGAGCACGTTCATGGAGCCTGG + Intergenic
1113070737 13:106418546-106418568 CAGAGCAAGATGCTGGCACCAGG - Intergenic
1115285835 14:31712076-31712098 CGGAGCGGGTTGCTGGCTGCTGG + Intronic
1117776532 14:59189409-59189431 GAGAGCAGGGTGTTGGCGGCCGG + Intronic
1119420098 14:74503238-74503260 CAGAGCACACTGCTGGCTCCAGG + Exonic
1120654017 14:87168247-87168269 GAGAGCATGTTGCTGGCATCTGG - Intergenic
1121558658 14:94857883-94857905 CAGAGCACGTAGCTAGCAGGAGG + Intergenic
1121845696 14:97170202-97170224 CAGAGCCCATTGCTGACAGCAGG + Intergenic
1122128349 14:99591217-99591239 GAGAACAAGGTGCTGGCGGCTGG + Intronic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1124248846 15:28094745-28094767 GAGAGAACGGTGCTGGCAGCAGG - Intronic
1127099801 15:55552990-55553012 CAGAGCAAGTTCCTGGGGGAGGG + Intronic
1129823694 15:78620785-78620807 CAGAGCCCATGGCTGGTGGCCGG + Exonic
1132381332 15:101368696-101368718 GAGAGCCCGTTGCTGGCCTCAGG + Intronic
1132990155 16:2788126-2788148 CAGAGCAAGATGCTGGGGTCAGG + Intergenic
1133781132 16:8940369-8940391 CTGAGCACTGTGCTGGAGGCTGG - Intronic
1135424640 16:22326234-22326256 CAGGACACGGTGCTGGCCGCCGG + Exonic
1141651514 16:85395545-85395567 CAGAGCTGGGTGCTGGCTGCTGG - Intergenic
1141707346 16:85674233-85674255 CAGAACAGCTTGCTGGCAGCTGG + Exonic
1142200157 16:88757303-88757325 CAGGGGGCGTTGCTGGCGGGGGG + Intronic
1144800036 17:17919864-17919886 GAGAGAACCTTCCTGGCGGCTGG - Intronic
1146531828 17:33613966-33613988 CAGAGCAGGTTGCTAGCAGTGGG + Intronic
1147760688 17:42795769-42795791 CAGAGGACAGTGCTGGAGGCGGG + Exonic
1148152960 17:45407073-45407095 CAGAGCTCCCTGCTGGCTGCAGG + Intronic
1151546851 17:74798564-74798586 CAGAGCAGGGTGCTGGGGGGTGG + Intronic
1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG + Intronic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1156537258 18:37876160-37876182 CAGTGCATGGTGCTGGTGGCGGG - Intergenic
1158991627 18:62874550-62874572 CAGTTCAGGTTGCTGGTGGCTGG + Intronic
1160392266 18:78543130-78543152 CAGAGCAGGAGGCTGGAGGCAGG + Intergenic
1160395820 18:78571943-78571965 CAGAGCCCGTGAGTGGCGGCAGG + Intergenic
1161057252 19:2196835-2196857 CGGAGCACGGTGTTAGCGGCGGG + Intronic
1161979662 19:7623973-7623995 CAGAGCACTTGGCTGGGGGCTGG - Intronic
1162332156 19:10037005-10037027 CAAAGCTCCTTGCTGGCGGAGGG + Intergenic
1162907101 19:13830604-13830626 CAAAGCACGTCGTTGACGGCAGG - Exonic
1163678614 19:18668121-18668143 CAGAGCACGTGGCTGGCGCGCGG - Exonic
1164675104 19:30095500-30095522 CAGTGCATGTAGCTGGTGGCCGG - Intergenic
1168594465 19:57664322-57664344 CCCAGGACGCTGCTGGCGGCGGG + Intergenic
924971693 2:133888-133910 CAGAGCAGGTTGCTGGAGAGAGG + Intergenic
929882089 2:45845917-45845939 CAGAGCTCGTGGCTGAGGGCTGG + Intronic
934576102 2:95402572-95402594 CAGAGAACGCGGCTGGCGCCTGG + Intergenic
935537069 2:104307506-104307528 CAGAGCACGGTTGTGGTGGCTGG - Intergenic
938218569 2:129545381-129545403 CAGAGCCCATGGCTGCCGGCAGG - Intergenic
944022716 2:195125725-195125747 GAGAGCAGGTTGATGGTGGCAGG - Intergenic
944022843 2:195126240-195126262 GAGAGCAGGTTGATGGTGGCAGG + Intergenic
947184645 2:227444365-227444387 CTGAGCCAGTTGCTGGCAGCGGG + Intergenic
947232598 2:227903023-227903045 CAAAGCACATTGGTGGCGACTGG + Exonic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947909953 2:233794341-233794363 CAGAGCTGGTTTCTGGTGGCAGG + Exonic
948525090 2:238566504-238566526 CAGAGGACCTTGGTGGCGGGTGG + Intergenic
1169265851 20:4167007-4167029 CAGGGGACATTGCTGGGGGCGGG + Intronic
1169271743 20:4205337-4205359 CAGAGCACTTTGCTGCAGGCTGG - Intergenic
1171113028 20:22501603-22501625 CAGAGCACCTTGAGGGCTGCTGG - Intergenic
1172664697 20:36591072-36591094 GAGAGCACATTGGTGGGGGCTGG - Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175928899 20:62484401-62484423 CAGGGCACTTTGCAGGCAGCAGG + Intergenic
1179884323 21:44306985-44307007 CAGAGCACGGGCCTGGGGGCAGG + Intronic
1183064627 22:35354457-35354479 CAGAGCACGGTGCAGGGTGCTGG - Intergenic
1184041382 22:41946207-41946229 CAGAGCCCGTTTCTGGCAGAGGG - Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
954715570 3:52525132-52525154 CAGCGCCAGTTGCTGGGGGCGGG + Intronic
956075992 3:65506344-65506366 CAGAGTATGTTGTTGGGGGCGGG - Intronic
961734532 3:128993309-128993331 CAGAGCGCACTGCTGGCCGCCGG + Exonic
963253024 3:143119783-143119805 CCGAGCGCGTTGCGGGCGCCCGG + Exonic
965838104 3:172873471-172873493 CAGAGCATGGTGCTGGCATCTGG + Intergenic
966944149 3:184765882-184765904 CAGAGGAGGTGGCTGGTGGCAGG + Intergenic
968459997 4:720063-720085 CAGAGCCCGTTGGTGAAGGCAGG + Intronic
969998325 4:11338054-11338076 CTGAGCACATTACTGGCAGCGGG - Intergenic
981045030 4:140256907-140256929 CAGAGCAGGTGGCTAGAGGCAGG + Intergenic
986397031 5:7341355-7341377 CAGAGCTCATTGCTGCCAGCAGG - Intergenic
986710923 5:10487239-10487261 CTGAGCACGCTCCTGGCGGTAGG - Intergenic
993290539 5:86062566-86062588 CAGAGCCTGTTGCTGGCGTGGGG + Intergenic
994135661 5:96283448-96283470 CAGATCACTTTCCTGGCCGCAGG + Intergenic
997176784 5:131786798-131786820 GAGAGCATGGTGCTGGCAGCTGG - Intronic
997999264 5:138611054-138611076 CAGAGAATGTTGCTGGGTGCTGG - Intronic
1006224140 6:32522157-32522179 CACAGCACGTTTCTTGCAGCAGG - Exonic
1006518365 6:34556933-34556955 GAGAGCAAGTTGCTGCTGGCTGG - Intergenic
1008624101 6:53300899-53300921 AAGGGCACGTTGCTGGCAGGAGG - Intronic
1009397453 6:63215834-63215856 CAGAGCAAAGTGCTGGGGGCTGG - Intergenic
1010781196 6:79947520-79947542 CAGCGCACTGTGCTGGCGGCTGG - Exonic
1011452219 6:87505615-87505637 CAGAACACGGTGCTGGCATCTGG + Intronic
1018046321 6:159969293-159969315 CAGAGAGCGCTGCGGGCGGCGGG - Exonic
1018790307 6:167143230-167143252 GAGACAACGTGGCTGGCGGCGGG + Intergenic
1022634406 7:32118601-32118623 CAGAGCATGGTGCTGGCATCTGG + Intronic
1024458153 7:49632163-49632185 CAGAGAAAGTTGCTGGCAGCAGG + Intergenic
1026606946 7:71824502-71824524 CAGAGCTCGCTGCTGGCTGCCGG + Intronic
1034038371 7:147848988-147849010 CAGAGTACGTAGCTGGAGCCTGG - Intronic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1037772003 8:21807363-21807385 AAGAGCATGGTGCTGGCGTCTGG - Intronic
1038164592 8:25073163-25073185 TAGAGCACGCTGCTGGCTGTAGG - Intergenic
1040435174 8:47383173-47383195 CAGAGCACCTGGCAGGAGGCTGG - Intronic
1045888022 8:107122917-107122939 CACAGCAGGTTGATGACGGCAGG + Intergenic
1048546335 8:135390862-135390884 CAGAGCATGTGGCTGTCAGCCGG - Intergenic
1049188379 8:141271430-141271452 CAGGGCACATGGCTGGCGACTGG + Intronic
1049194949 8:141309879-141309901 CAGAGGACGTGTCTGGGGGCTGG + Intergenic
1049310781 8:141932746-141932768 CAGAGCACCTTGCTGGGCACAGG - Intergenic
1049752791 8:144293326-144293348 CAGTGCACCTTCCTGGAGGCTGG + Intronic
1049778379 8:144416516-144416538 CAGGGCCCTTTGCTGCCGGCTGG + Intronic
1052437119 9:28443787-28443809 AACAGCACGTTGATGGTGGCAGG + Intronic
1059308052 9:113370041-113370063 CAGAGCACTGTGCCGGAGGCTGG - Exonic
1061392962 9:130327881-130327903 CAGACCAGGTGTCTGGCGGCTGG + Intronic
1061640649 9:131952398-131952420 CAGACCTTGTTCCTGGCGGCAGG + Intronic
1194744347 X:97612040-97612062 CAGGGCACGTGGCAGGAGGCAGG + Intergenic
1197756943 X:130002253-130002275 AACAGCAAGTTGCTGGCAGCTGG + Intronic
1199861331 X:151802498-151802520 CAGAGGAAGGTGCTGGCTGCTGG - Intergenic