ID: 1152563316

View in Genome Browser
Species Human (GRCh38)
Location 17:81089394-81089416
Sequence GTGGACCACAGCACTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 227}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152563316_1152563325 2 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563325 17:81089419-81089441 TCTGGGCAAGGGGCCGCTGCTGG 0: 1
1: 0
2: 0
3: 20
4: 250
1152563316_1152563321 -10 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563321 17:81089407-81089429 TGTGGTCCACGGTCTGGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 145
1152563316_1152563326 3 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563326 17:81089420-81089442 CTGGGCAAGGGGCCGCTGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 269
1152563316_1152563327 12 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563327 17:81089429-81089451 GGGCCGCTGCTGGGTGCCCCAGG 0: 1
1: 0
2: 2
3: 42
4: 387
1152563316_1152563322 -9 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563322 17:81089408-81089430 GTGGTCCACGGTCTGGGCAAGGG 0: 1
1: 0
2: 0
3: 7
4: 116
1152563316_1152563329 14 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563329 17:81089431-81089453 GCCGCTGCTGGGTGCCCCAGGGG 0: 1
1: 0
2: 2
3: 15
4: 269
1152563316_1152563328 13 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563328 17:81089430-81089452 GGCCGCTGCTGGGTGCCCCAGGG 0: 1
1: 0
2: 0
3: 31
4: 297
1152563316_1152563323 -8 Left 1152563316 17:81089394-81089416 CCTGCCTCAGTGCTGTGGTCCAC 0: 1
1: 0
2: 0
3: 44
4: 227
Right 1152563323 17:81089409-81089431 TGGTCCACGGTCTGGGCAAGGGG 0: 1
1: 0
2: 1
3: 12
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152563316 Original CRISPR GTGGACCACAGCACTGAGGC AGG (reversed) Intronic
900407448 1:2498816-2498838 GTGGACGACAACGGTGAGGCTGG + Exonic
900793451 1:4693905-4693927 CTGTGCCACAGCACTGAGGTGGG - Intronic
901050627 1:6424340-6424362 GAGGACAACGGCCCTGAGGCAGG - Intronic
902481488 1:16714352-16714374 GGGGACCACAGCCCGGAGGAGGG + Intergenic
902548213 1:17203686-17203708 GAGGACCACATTACTGAGGATGG + Intergenic
902727480 1:18346832-18346854 GCAGCCCACAGGACTGAGGCGGG + Intronic
903549231 1:24146170-24146192 CTGCACCACAGCACTCAGCCTGG + Intergenic
903745930 1:25586638-25586660 CTGGAGCACAGCACTGCAGCAGG + Intergenic
904765808 1:32845722-32845744 TTGTACCACTGCACTCAGGCTGG - Intronic
904853338 1:33476078-33476100 GTGGAACACAGCACTGTGCCTGG + Intronic
904893926 1:33800056-33800078 CTGGAGCACAGCATTGTGGCAGG - Intronic
904995583 1:34628907-34628929 GTGGCCCACAGGACTGCTGCAGG - Intergenic
906945358 1:50290086-50290108 GTGGCACCCAGCTCTGAGGCAGG - Intergenic
907617496 1:55939200-55939222 GTGGAACGCAGCACTGAAACAGG - Intergenic
909898945 1:81109185-81109207 GTGGAGCAAAGCACCCAGGCTGG + Intergenic
915047317 1:153029254-153029276 CTGAACCTCAGCTCTGAGGCTGG - Intergenic
917721794 1:177792752-177792774 CTAGCCCACAGCTCTGAGGCTGG + Intergenic
918235289 1:182574454-182574476 GTGGACCACCCCACAGAGGAGGG - Exonic
919885351 1:201929912-201929934 GTGGAGCACACAACTTAGGCTGG + Intronic
921126658 1:212183972-212183994 GTGAACCACAGCACCCAGCCAGG + Intergenic
923508983 1:234633101-234633123 GTGGTCCCCAGCAGAGAGGCAGG - Intergenic
923525562 1:234770065-234770087 GTGGACCCGAGCACCGAGCCTGG + Intergenic
923858680 1:237871368-237871390 GAGTACCCCAGCTCTGAGGCTGG - Intergenic
1063615621 10:7597484-7597506 GGGGACAACAGATCTGAGGCTGG - Intronic
1064059152 10:12122799-12122821 GAGGCCCCCAGCACTGAGTCAGG - Exonic
1066228059 10:33403828-33403850 CTGGAGCACAGCAGTGAGGTGGG + Intergenic
1067048500 10:42999189-42999211 GTGTCCCACAGCACAGATGCAGG - Intergenic
1067656093 10:48192705-48192727 GTGGACGGCAGCAAGGAGGCTGG - Exonic
1067947529 10:50699418-50699440 GGGGAGCACAGCGCTCAGGCTGG - Intergenic
1070882846 10:79864405-79864427 GGGGAGCACAGCGCTCAGGCTGG - Intergenic
1071603484 10:86970232-86970254 GTGGACCAGGCCACAGAGGCGGG + Exonic
1071649410 10:87380707-87380729 GGGGAGCACAGCGCTCAGGCTGG - Intergenic
1072609874 10:97010995-97011017 GTAGCCCTCAGCACAGAGGCAGG + Exonic
1075287117 10:121196449-121196471 GTGAACCACAGCACTCAGCCAGG - Intergenic
1075589312 10:123679926-123679948 GTGGACTGCAGCCCTGGGGCAGG + Intronic
1077284768 11:1760756-1760778 GTGGGCCAGAGCCCCGAGGCTGG + Intronic
1077518209 11:3015234-3015256 GTGGGCCACAGCTCTGGGGCAGG + Intronic
1079355257 11:19725315-19725337 GTGGGCGGCAGCACTGAGGGAGG - Intronic
1081849692 11:46266373-46266395 GTGGGCCTCAGCACTGAGCCTGG + Intergenic
1081935728 11:46902788-46902810 GGGGACCACAGCGATGAGGATGG - Exonic
1082004770 11:47413476-47413498 CCGGACCACGGCACCGAGGCCGG - Exonic
1082817681 11:57520386-57520408 ATGGACAAGAGCACTGAGACAGG + Intergenic
1083220077 11:61246513-61246535 TGGGATTACAGCACTGAGGCGGG + Intronic
1084468544 11:69341751-69341773 TTTAACCACAGCACTGAGACTGG + Intronic
1085046180 11:73355058-73355080 CTGGAGCACAGCCCTGAGGCGGG + Intronic
1087136828 11:94729606-94729628 GAGGACCACAGCTCTGTGTCAGG - Intronic
1089173605 11:116533212-116533234 GCGGACCACATCATTGAGGGAGG - Intergenic
1091455913 12:607782-607804 GTGGCCCACAGGACTGGGGGTGG + Intronic
1092003761 12:5051851-5051873 CTGGACCACTTCACTGAGGGAGG + Intergenic
1092330608 12:7583664-7583686 GTGGAGCAAAGCACTCAGGCTGG - Intergenic
1096048655 12:48586692-48586714 GTGGAACAATGCATTGAGGCTGG - Intergenic
1096370933 12:51068406-51068428 GTGGACCCCAGCACTTTGGGAGG - Intronic
1096809448 12:54160333-54160355 CAGGACCACAGCCCTGTGGCTGG + Intergenic
1097651546 12:62304475-62304497 GTGGCCCACATGACTGATGCAGG + Intronic
1099056001 12:77841611-77841633 TTGGAACACAGCCCTGATGCTGG + Intronic
1100245222 12:92750893-92750915 TTGGACCACTGCACTTAGCCTGG + Intronic
1100843931 12:98640804-98640826 TTGCACCACAGCACTCAGCCTGG - Intronic
1101062720 12:100988588-100988610 GTGAGCCACAGCACTCAGCCTGG - Intronic
1101292125 12:103381556-103381578 GTGAACCAAAGCACAGACGCTGG + Intronic
1103161880 12:118736069-118736091 GTGAGCCACAGCACTCAGCCTGG - Intergenic
1103690177 12:122766149-122766171 GTGTACCACAGAACAGAAGCGGG - Intronic
1104547041 12:129722028-129722050 GCTGGCCACAGCAGTGAGGCAGG - Intronic
1104943748 12:132406531-132406553 ATGGCCCACAGCAATGAGCCGGG + Intergenic
1104949119 12:132431015-132431037 GTCGACCTCAGCACTGAGGTGGG + Intergenic
1106014629 13:25857070-25857092 GTGGACCACAGCAAAGAGCTTGG - Intronic
1108741506 13:53343448-53343470 CTGGCCCACAGCCCAGAGGCTGG - Intergenic
1109232191 13:59770988-59771010 TTGGACCACAGCACAAAGGCTGG + Intronic
1111919606 13:94396452-94396474 GGTGACCACAGAAGTGAGGCTGG + Intronic
1112193385 13:97200127-97200149 GTGGCCCACAGCATGGAGGCTGG - Intergenic
1112590426 13:100759102-100759124 ATGGACCACAGCAGTGTGTCAGG - Intergenic
1113583928 13:111449730-111449752 GAGGCTGACAGCACTGAGGCTGG - Intergenic
1113960046 13:114121185-114121207 GTGCATCCCAGCACTGCGGCCGG + Intronic
1115642374 14:35342732-35342754 GTGGACCAGAACTCTCAGGCTGG - Intergenic
1118046793 14:61978768-61978790 GTGGACTAAAGCAGTGAGGGAGG - Intergenic
1121231713 14:92363356-92363378 GTGGACCATGGCACACAGGCTGG - Intronic
1121862585 14:97332235-97332257 GTGGATCATAGCTCTGAGCCTGG - Intergenic
1124244300 15:28056676-28056698 GTGGAGCTCAGCAGTGATGCAGG - Intronic
1125513856 15:40307259-40307281 GTGCACCCCAGAGCTGAGGCAGG - Intronic
1125728552 15:41880442-41880464 GTGGGGCCCAGCAGTGAGGCAGG - Intronic
1126805449 15:52344062-52344084 GTGGATCCCAGCACTGACTCTGG + Intronic
1131570471 15:93529999-93530021 TTGGATCACAGAAATGAGGCAGG - Intergenic
1132853449 16:2034762-2034784 GTGGAGCACAGCCCCCAGGCTGG - Intronic
1132941424 16:2510307-2510329 GTGGAGCCCACCACAGAGGCAGG + Intronic
1132974853 16:2706140-2706162 GTGGTCCAGGGCACTGAGCCTGG + Intronic
1134797429 16:17054191-17054213 GTGGAGCAAAGCACTCAGGCTGG + Intergenic
1135290855 16:21236691-21236713 GTGAGCCACAGCACTCAGCCTGG + Intronic
1136019091 16:27428560-27428582 GTGGACCACTGCCCTCTGGCTGG + Intronic
1137066640 16:35853115-35853137 GTAGCCATCAGCACTGAGGCAGG - Intergenic
1137502227 16:49020198-49020220 GTGGACCTCAGCACTGCAGCTGG - Intergenic
1137574035 16:49586651-49586673 GTGGATCACAGCTCAGAGCCAGG + Intronic
1137727555 16:50667320-50667342 CAGGAGCACAGCCCTGAGGCAGG - Intronic
1137754564 16:50891254-50891276 ATGGACCAGACCACAGAGGCTGG + Intergenic
1138455653 16:57119261-57119283 CTGGTCCACAGGACTGAGGTGGG + Exonic
1139172263 16:64646394-64646416 GTGGCCCAAACCACTGAAGCTGG + Intergenic
1139923360 16:70473039-70473061 GTGGAGCACAGGAAAGAGGCGGG - Exonic
1141294202 16:82751510-82751532 ATGGACCAGAGCTCTGGGGCAGG + Intronic
1141463892 16:84194619-84194641 GGGGACAAGAGGACTGAGGCTGG + Intronic
1142143394 16:88482644-88482666 GGGGACCAGAGCACTGGGGCTGG - Intronic
1142407308 16:89897708-89897730 GTGGCTAACAGCACTCAGGCTGG - Intronic
1142438571 16:90078426-90078448 GTGGAGCAATGCACTCAGGCTGG + Intronic
1142888945 17:2930398-2930420 GGGCACCTGAGCACTGAGGCTGG - Intronic
1143204084 17:5131059-5131081 CTGGACAACAGCCCTGAGACTGG - Intronic
1143204191 17:5131477-5131499 CTGGACAACAGCCCTGAGGCTGG - Intronic
1144038091 17:11385304-11385326 GTGGGGCGCAGCAATGAGGCTGG + Intronic
1144764577 17:17725502-17725524 GGGGACCGCAGTTCTGAGGCGGG + Intronic
1144875263 17:18394168-18394190 CTGGACAGCAGCCCTGAGGCTGG - Intergenic
1145156961 17:20550253-20550275 CTGGACAGCAGCCCTGAGGCTGG + Intergenic
1145759925 17:27420226-27420248 CTGGACAACAGCCCCGAGGCTGG - Intergenic
1145799126 17:27672125-27672147 CTGGACAACAGCCCCGAGGCTGG + Intergenic
1145991405 17:29081341-29081363 GTGAACCACGGCAGTGGGGCGGG + Intronic
1146159887 17:30554150-30554172 CTGGACAACATCCCTGAGGCTGG - Intergenic
1146844483 17:36174340-36174362 CTGGACAACAGCCCTGAGGCTGG + Intronic
1146856787 17:36262275-36262297 CTGGACAACAGCCCTGAGGCTGG + Intronic
1146863830 17:36326100-36326122 CTGGACAACAGCCCTGAGGCTGG - Intronic
1146872698 17:36386185-36386207 CTGGACAACAGCCCTGAGGCTGG + Intronic
1146880056 17:36437271-36437293 CTGGACAACAGCCCTGAGGCTGG + Intronic
1146913342 17:36662190-36662212 GAGGGCCACAGCACTGATCCAGG + Intergenic
1147066690 17:37926688-37926710 CTGCACAACAGCCCTGAGGCTGG - Intronic
1147075582 17:37986810-37986832 CTGGACAACAGCCCTGAGGCTGG + Intronic
1147078221 17:38006249-38006271 CTGGACAACAGCCCTGAGGCTGG - Intronic
1147087107 17:38066356-38066378 CTGGACAACAGCCCTGAGGCTGG + Intronic
1147094159 17:38130184-38130206 CTGGACAACAGCCCTGAGGCTGG - Intergenic
1147103051 17:38190319-38190341 CTGCACAACAGCCCTGAGGCTGG + Intergenic
1149847627 17:60016785-60016807 CTGGACAACAGCCCTGAGGCCGG + Intergenic
1150085984 17:62273402-62273424 CTGGACAACAGCCCTGAGGCTGG + Intronic
1150317191 17:64178884-64178906 GTGCACCACAGCACTGACCCAGG - Intronic
1150644234 17:66968279-66968301 GTGGAGCCCAGCTCTGAGGTTGG + Intronic
1151434535 17:74086768-74086790 CTGGACCACAGCATGCAGGCAGG + Intergenic
1151598769 17:75093806-75093828 GTGGAGCACAGCCGTGAGGATGG - Exonic
1152342611 17:79733632-79733654 CTGGATCACAGCCCAGAGGCAGG + Exonic
1152563316 17:81089394-81089416 GTGGACCACAGCACTGAGGCAGG - Intronic
1152569479 17:81115420-81115442 GCGGACATCACCACTGAGGCTGG - Intronic
1152990977 18:363175-363197 CTGGACCACAGCACTTGGGAGGG - Intronic
1154146852 18:11873897-11873919 CTGGACCACAGCCATGAGGAGGG - Intronic
1156242536 18:35267577-35267599 GAGGACCGCAGCTCTGTGGCAGG + Exonic
1157481139 18:48054510-48054532 GTAGACAACAGCAGGGAGGCAGG - Intronic
1157637100 18:49169429-49169451 GCAGAGCACAGCAATGAGGCTGG + Intronic
1157718946 18:49908687-49908709 GAGGACCACATCACGGAGACTGG - Intronic
1160462821 18:79052301-79052323 GAGCACCACAGCACTCAGGCAGG + Intergenic
1163599464 19:18239991-18240013 CTGGGCAACAGCACTCAGGCTGG + Intronic
1164607854 19:29612963-29612985 TTAGACCACAGCAAGGAGGCAGG - Intronic
1165303936 19:34991563-34991585 GTGGGCCATAGCACAGAGCCTGG + Intergenic
1165715704 19:38044479-38044501 ATGGACCCCTGCAGTGAGGCAGG + Intronic
1166643961 19:44517367-44517389 GTGGTCCACAACACTGGGGGTGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1202715528 1_KI270714v1_random:40263-40285 GGGGACCACAGCCCGGAGGAGGG + Intergenic
925541432 2:4971921-4971943 GTGGACCATAGCACAGAGGGCGG + Intergenic
926092106 2:10057909-10057931 GGAAACCACAGCAGTGAGGCAGG - Exonic
929444715 2:41992758-41992780 GTGGAGCACAGCTCTCAGCCTGG - Intergenic
930320820 2:49852900-49852922 GTGAACCACTGCACTTAGCCAGG - Intergenic
934560296 2:95309810-95309832 GTGGAACCGACCACTGAGGCTGG - Intronic
934664868 2:96163289-96163311 ATTGACCACACCACTCAGGCCGG + Intergenic
935583672 2:104782200-104782222 GTGGACAAAAGAACTTAGGCAGG + Intergenic
936113123 2:109681618-109681640 GAGTCCCACAGCACCGAGGCTGG + Intergenic
938975055 2:136469023-136469045 GTGGAACCCACCACTGAGCCAGG - Intergenic
943723318 2:191228010-191228032 GAGGACCACAGCACTGGGTGCGG + Intergenic
945368652 2:208988973-208988995 CTGCAACATAGCACTGAGGCAGG + Intergenic
945545489 2:211145143-211145165 CTGGGCCACAGCTCTGGGGCTGG - Intergenic
946039644 2:216772879-216772901 GTGGAGCACAGCCCAGAAGCAGG - Intergenic
947444492 2:230153555-230153577 GTTGACCCCAGCAATGAAGCTGG - Intergenic
947825062 2:233100241-233100263 GTGGCCTACAGCAGTCAGGCGGG - Intronic
948595004 2:239074073-239074095 GGGGGCCACAGGACTGAGGGGGG + Intronic
1169292665 20:4365952-4365974 GTTGGCCACAGGCCTGAGGCTGG - Intergenic
1170776030 20:19375291-19375313 ATGCACCACAGCATTGAGACAGG - Intronic
1171182263 20:23099376-23099398 GTGGCCCACAGAACTGTGGCTGG - Intergenic
1172067983 20:32234928-32234950 GTGGACCAGAAGACGGAGGCTGG - Exonic
1172119344 20:32588606-32588628 TTGCACCACAGCACTCAGCCTGG - Intronic
1175750403 20:61493191-61493213 GTGGGCTACAGCACTGACACAGG - Intronic
1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG + Intronic
1176377486 21:6093764-6093786 GAGGACCACAGACCCGAGGCCGG + Intergenic
1178104314 21:29300504-29300526 GTGGCCAATAGCACTGAGGCGGG + Intronic
1179745989 21:43444480-43444502 GAGGACCACAGACCCGAGGCCGG - Intergenic
1181094823 22:20497735-20497757 TGAGACCACAGCACTGTGGCTGG - Intronic
1181631222 22:24152529-24152551 GTGTCCCACAGCAGGGAGGCAGG + Intronic
1181891157 22:26064857-26064879 CTGGACCCCAGCACAGAGGCTGG + Intergenic
1183118778 22:35713470-35713492 GGGGAGAAGAGCACTGAGGCTGG - Intergenic
1183148263 22:36015834-36015856 GTGGACCACTGAACTGAAGAAGG + Intronic
1183308639 22:37097611-37097633 GTGGCTCACTGCACGGAGGCTGG - Intronic
1183504084 22:38199437-38199459 GTGGACCAAGGCACAGAGGCAGG + Intronic
1184026137 22:41858163-41858185 ATGGACCACACCAGTGAGGGAGG - Intronic
1184037417 22:41925410-41925432 GTGGAGCCCAGCTCTGTGGCTGG + Exonic
1184138063 22:42561190-42561212 CTGGACCACTGCTCTGAAGCAGG - Intronic
1184592725 22:45495927-45495949 GTGGACCACAGCTCCCATGCTGG + Intergenic
1184836075 22:47021815-47021837 CTGAACCCCAGCACTGGGGCGGG - Intronic
1185185508 22:49397013-49397035 TTTGACCACAGCACCCAGGCAGG - Intergenic
949881359 3:8663547-8663569 GGGGGCCACAGCAGTGGGGCGGG + Intronic
950967653 3:17157000-17157022 CTGGACCACAGTGCTGGGGCTGG + Intergenic
953551428 3:43906676-43906698 GTGGAACATACCACTGAGGAAGG - Intergenic
953947856 3:47164329-47164351 CTGGCCCACATCACTGGGGCCGG - Intergenic
954289881 3:49644032-49644054 GTGGGCCACAGGACTGAGGGAGG - Intronic
954291414 3:49651999-49652021 GTGGAGGACAGCAGTGAGGGTGG + Exonic
954292324 3:49656190-49656212 ATGGGCCGCAGGACTGAGGCAGG - Exonic
954307528 3:49737191-49737213 GTGAGCCACAGCACTCAGCCTGG + Intronic
954467583 3:50665462-50665484 ATGAACCAAAGCACAGAGGCAGG - Intergenic
956304577 3:67809753-67809775 GGTGTCCACAGCACTGAAGCGGG + Intergenic
956450614 3:69371215-69371237 GTGGGCTACAACTCTGAGGCTGG + Intronic
956995877 3:74825610-74825632 TCGGACCACATCACTCAGGCTGG - Intergenic
957338173 3:78859074-78859096 GTGGACTACAGCAGGGAGACTGG + Intronic
957375692 3:79354503-79354525 GTGGACTATAGCACTGACACAGG - Intronic
958435063 3:94086198-94086220 GTGGCTCACAGCACTTAGGGAGG - Intronic
960340612 3:116470444-116470466 GTGAACCACTGCACTTAGCCTGG + Intronic
967986783 3:195101086-195101108 GTGGATTACAGCAGTGAGGCTGG - Intronic
968920100 4:3518033-3518055 CAGGGCTACAGCACTGAGGCTGG - Exonic
969029181 4:4197580-4197602 GTGGCCCTCAGCACAGAGGATGG + Exonic
969132689 4:5003428-5003450 GTGGCCCACAGGTCTGAAGCTGG + Intergenic
970111195 4:12639809-12639831 TTGGACCACAGAACTGAATCAGG - Intergenic
972187271 4:36545270-36545292 GTGAGCCACAGCACCCAGGCAGG + Intergenic
977897983 4:102385404-102385426 GTGGACCACAGTACTGGATCTGG - Intronic
978287377 4:107094945-107094967 GTGGAGCAAAGCACTGAGACTGG + Intronic
979284730 4:118909545-118909567 GTGGGACACAGCACTGTGGAAGG + Intronic
980168995 4:129264200-129264222 CTGGACCACAGCAAAGAGTCTGG - Intergenic
980468740 4:133221426-133221448 GTGGATCCCAGCACTTAGGGAGG - Intergenic
980863066 4:138522094-138522116 GTGCAGCACTGCACTCAGGCTGG - Intergenic
981314790 4:143331493-143331515 GTGGACCACAGAATTTAAGCTGG + Intergenic
982931056 4:161407822-161407844 GTGGAGCAAAGCACTCAGGCTGG - Intronic
985063304 4:186098888-186098910 GAGGACCAGACCACGGAGGCAGG - Intergenic
986784871 5:11105026-11105048 GTGGGGCACAGCACAGTGGCCGG - Intronic
987124043 5:14794340-14794362 GGGGACCACAGAAAGGAGGCAGG + Intronic
993705626 5:91166616-91166638 ATGGACCAAATGACTGAGGCTGG + Intergenic
994082566 5:95723757-95723779 GCAGAACACAGCACTGGGGCTGG - Intronic
999305039 5:150514028-150514050 GTGGCCCACAGCCCTCAGCCAGG - Intronic
999341151 5:150774301-150774323 CTGAACCACAGCACTGAATCAGG - Intergenic
1001030588 5:168259689-168259711 TGGGGCCACTGCACTGAGGCTGG - Intronic
1002093555 5:176818075-176818097 CTGGGCTACAGCACGGAGGCGGG - Intronic
1002576053 5:180174708-180174730 GTGGACCACAGCCCAGAGAGGGG - Intronic
1003128800 6:3377705-3377727 GTGGAGAACAGCACTGGGCCAGG + Intronic
1004509118 6:16270295-16270317 CTTGTCCAGAGCACTGAGGCAGG - Intronic
1005496905 6:26395812-26395834 GTGAAGAACAGCAATGAGGCTGG + Intergenic
1006068024 6:31476583-31476605 GTGAACCACAGCTCTGTGGAGGG - Intergenic
1007635970 6:43299915-43299937 GTGGAGCACCGCACCGTGGCTGG + Exonic
1008870547 6:56267945-56267967 GTGGAGCAAAGCACAAAGGCTGG - Intronic
1013883544 6:114933994-114934016 GTGGAGCAAAGCACCCAGGCTGG + Intergenic
1018784271 6:167095950-167095972 GTGGACCACATCCCAGAGGATGG - Intergenic
1022016171 7:26350319-26350341 GAGGACCCCACCACTGAGGGAGG + Intronic
1022124765 7:27345152-27345174 CTGGAGCCCAGCACTGAGGCTGG - Intergenic
1026989366 7:74574804-74574826 GTGAACCACTGCACTCAGCCGGG - Intronic
1032464618 7:132136211-132136233 GAGGAGCCCAGCACTGGGGCCGG - Intronic
1032905010 7:136354284-136354306 TTGGACAACAGCTCTGCGGCAGG - Intergenic
1033016944 7:137681009-137681031 CTGGACCACAGAAGTGAGGCAGG + Intronic
1033981479 7:147170760-147170782 GTGGAACACAGCACCCAGGCTGG + Intronic
1034859679 7:154584379-154584401 GGGGACCACAGCACTGCTGACGG + Intronic
1035322757 7:158044305-158044327 GGCGGCCACAGCCCTGAGGCAGG + Intronic
1037728506 8:21504218-21504240 TTGGAACCCAGCTCTGAGGCTGG + Intergenic
1038411668 8:27363834-27363856 GTGGCCCACAGGACTGGGGGTGG - Intronic
1044488925 8:92788966-92788988 GTGAGCCACAGCACTCAGCCTGG + Intergenic
1049380994 8:142315678-142315700 GTGAGCCAGAGCAATGAGGCGGG - Intronic
1049750365 8:144280261-144280283 GTGGACCACAGAGCTGGGGATGG - Intronic
1049850900 8:144829577-144829599 GAGAACCACAGCAGTGTGGCTGG + Exonic
1050129405 9:2396004-2396026 TTGGACCACAGAACTGAGAAAGG + Intergenic
1056383012 9:86072464-86072486 GAGGTCCTCAGCACTGAGACAGG - Intronic
1056969419 9:91190160-91190182 CAGAACCACATCACTGAGGCAGG + Intergenic
1057205735 9:93171293-93171315 GGGGACCACAGCACGGGTGCTGG - Intergenic
1061031503 9:128086818-128086840 GAGGACCACAGCTCAAAGGCTGG - Intronic
1061053423 9:128209180-128209202 GTGGAGCACACCCCTGGGGCTGG + Intronic
1061817720 9:133206615-133206637 GTGGACCAGAGCTCTGGGGTGGG + Intronic
1062694749 9:137867717-137867739 GTGGAGCACAGCGCTGTGGCTGG - Intronic
1186643598 X:11482853-11482875 GGGGAACACAGCACTGAGTGGGG + Intronic
1187683068 X:21787532-21787554 ATGTACCACCACACTGAGGCTGG + Intergenic
1189287287 X:39860764-39860786 GTGTCCCACAGCTCTGTGGCTGG - Intergenic
1189678378 X:43487365-43487387 GTGAACACCTGCACTGAGGCTGG + Intergenic
1189961312 X:46327423-46327445 GTGGAGCACAGCTCTGTGGGAGG - Intergenic
1190341890 X:49303618-49303640 GTGGACATGCGCACTGAGGCGGG - Intergenic
1190379952 X:49829660-49829682 GTGAACACGAGCACTGAGGCAGG - Intronic
1190648293 X:52543830-52543852 GTGAACCTGTGCACTGAGGCGGG - Intergenic
1191048228 X:56162355-56162377 GTAGACTACAGCACCGGGGCAGG - Intergenic
1192234743 X:69288719-69288741 CTGGACCACAGCTCTGAGACTGG + Intergenic
1193671290 X:84389599-84389621 GTGGAGCAATGCACTGAGGCTGG + Intronic
1193689408 X:84622455-84622477 GTGGAGTAAAGCACTGAGGCTGG + Intergenic
1194245013 X:91500202-91500224 GTGAAGCACAGCACCCAGGCTGG - Intergenic
1198371880 X:135997336-135997358 GTGGGCCACAGCACCCAGCCAGG + Intronic
1200563988 Y:4741512-4741534 GTGAAGCACAGCACCCAGGCTGG - Intergenic
1200968170 Y:9120404-9120426 GTGGCCCCCAGTACTGAGGAGGG + Intergenic