ID: 1152565005

View in Genome Browser
Species Human (GRCh38)
Location 17:81096453-81096475
Sequence GGATGCTGGGGTGCGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 175}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152565005_1152565017 5 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565017 17:81096481-81096503 AGTTCCCTGCGGGAGGAGCGGGG 0: 1
1: 0
2: 0
3: 9
4: 134
1152565005_1152565011 -5 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565011 17:81096471-81096493 CATCCCTGGCAGTTCCCTGCGGG 0: 1
1: 0
2: 3
3: 21
4: 207
1152565005_1152565015 3 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565015 17:81096479-81096501 GCAGTTCCCTGCGGGAGGAGCGG 0: 1
1: 1
2: 2
3: 16
4: 246
1152565005_1152565021 19 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565021 17:81096495-81096517 GGAGCGGGGCAGGACCCTGCAGG 0: 1
1: 0
2: 7
3: 30
4: 411
1152565005_1152565023 28 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565023 17:81096504-81096526 CAGGACCCTGCAGGCGGCCTTGG 0: 1
1: 0
2: 2
3: 25
4: 284
1152565005_1152565019 9 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565019 17:81096485-81096507 CCCTGCGGGAGGAGCGGGGCAGG 0: 1
1: 1
2: 6
3: 72
4: 573
1152565005_1152565010 -6 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565010 17:81096470-81096492 GCATCCCTGGCAGTTCCCTGCGG 0: 1
1: 1
2: 2
3: 32
4: 250
1152565005_1152565016 4 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565016 17:81096480-81096502 CAGTTCCCTGCGGGAGGAGCGGG 0: 1
1: 0
2: 3
3: 19
4: 261
1152565005_1152565013 -2 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565013 17:81096474-81096496 CCCTGGCAGTTCCCTGCGGGAGG 0: 1
1: 0
2: 0
3: 18
4: 185
1152565005_1152565022 22 Left 1152565005 17:81096453-81096475 CCTGGAGGCGCACCCCAGCATCC 0: 1
1: 0
2: 0
3: 30
4: 175
Right 1152565022 17:81096498-81096520 GCGGGGCAGGACCCTGCAGGCGG 0: 1
1: 0
2: 3
3: 35
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152565005 Original CRISPR GGATGCTGGGGTGCGCCTCC AGG (reversed) Intronic
900970711 1:5991387-5991409 TGATGGTGGGCAGCGCCTCCCGG - Intronic
901332717 1:8423582-8423604 GGCTGCTGGGGTCGGCCGCCCGG - Intronic
902556037 1:17247357-17247379 AGATGCTGGGGAGCGGGTCCTGG + Intergenic
902603063 1:17553103-17553125 GGATGCTGGGGTTCTGGTCCCGG - Intronic
904398912 1:30242966-30242988 GGGTGCTGGGCTGGGACTCCTGG + Intergenic
905160276 1:36027147-36027169 GGATGCAGGGATGCCCATCCAGG + Exonic
905488928 1:38328505-38328527 GGATGCTGGGCTGATCCTCCTGG - Intergenic
907496932 1:54851529-54851551 GGTGGCTGGGGTGGGCCTGCAGG + Exonic
908488136 1:64615386-64615408 GGAAGCTGGGGTGGCCTTCCAGG + Intronic
909232179 1:73105085-73105107 GGATGTTGGGGTCCACCTCCAGG - Intergenic
914249089 1:145907129-145907151 GGATGCTGGTGGGCGCCCCCTGG - Exonic
915596661 1:156900157-156900179 GGATGCTGGGCTGCGCAGGCGGG + Intronic
915619696 1:157073487-157073509 GGATGTTGGGGTCCACCTCCAGG - Intergenic
916233422 1:162561971-162561993 GGAGGATGGGGTGCGACTGCGGG - Intronic
916811846 1:168312765-168312787 GGGTGCTGGCGTGCACCTCCGGG - Exonic
918232735 1:182550773-182550795 TGATGCTGGGGTGCACCCCAGGG + Intronic
919940166 1:202280953-202280975 GGATGCTGGGGTCTGGCCCCGGG + Intronic
922771626 1:228187469-228187491 GGATGATAGAGTGAGCCTCCAGG - Intergenic
922947813 1:229531672-229531694 GGGTGCAGGGGGGCGCCTCTGGG - Exonic
923372562 1:233327977-233327999 GGAAGCTGGGCTCAGCCTCCCGG - Exonic
1063504079 10:6580368-6580390 GGAGGCTGGCGAGCGCCCCCTGG - Intergenic
1063950985 10:11223327-11223349 GTATGCTGGGGTGCTCCACAAGG - Intronic
1068407017 10:56603315-56603337 GGATGATGGGCTGCCCCTTCTGG - Intergenic
1069724357 10:70567631-70567653 GGTTGCTGGGGTGGTCCTCATGG + Exonic
1075485782 10:122820975-122820997 GGAGGCTGGGCTACTCCTCCTGG + Intergenic
1075588654 10:123675930-123675952 TGAGGCAGGGGTGCCCCTCCTGG - Intronic
1075756807 10:124818729-124818751 GGATCCCGTGGTGCGCATCCAGG - Intronic
1077134949 11:993856-993878 GGATGGTGGGCTTCACCTCCGGG - Exonic
1077437335 11:2549264-2549286 GGATGCTGGGGTGGGGCTATGGG + Intronic
1079347618 11:19666996-19667018 GGAGGCTGGGGAGGGCCTTCTGG - Intronic
1080869861 11:36227767-36227789 GGATCCTGGCCTGCTCCTCCTGG + Intronic
1083324502 11:61866497-61866519 GGAGGGTGGGCTGAGCCTCCAGG - Exonic
1086499337 11:87436267-87436289 GGAAGCTGGGGTTGGCTTCCTGG + Intergenic
1089599341 11:119604052-119604074 GGATATTGGGGTCCACCTCCAGG + Intergenic
1090829146 11:130408830-130408852 GTATGCTGGGGTGTCCCCCCGGG - Exonic
1092280869 12:7096807-7096829 GGATGCTGTGCTGCAGCTCCAGG + Exonic
1092704273 12:11267287-11267309 GGCTGCTGGGGATTGCCTCCTGG + Exonic
1096627544 12:52904729-52904751 GGATGTTGGGGTCCACCTCCAGG + Exonic
1097615457 12:61879549-61879571 GGATGTTGGGGTCCACCTCCAGG - Intronic
1098264600 12:68705864-68705886 GGATGTTGGGGTCCACCTCCAGG - Intronic
1101568514 12:105932269-105932291 GGATTACGGGGTGAGCCTCCAGG - Intergenic
1104598656 12:130137676-130137698 GGATGCTGGGGTGCAGATCCGGG + Intergenic
1105635349 13:22210697-22210719 GGACGCTGAGGTGCCCTTCCAGG - Intergenic
1113593473 13:111516079-111516101 GGATGCTGTGAAGAGCCTCCCGG + Intergenic
1118349221 14:64961504-64961526 GGTTGCTGGAGTGACCCTCCAGG + Intronic
1118385976 14:65255966-65255988 GGAGGCTGGGGTGGGCTGCCAGG - Intergenic
1120834122 14:89025666-89025688 GGATGGTTGGGTGTGACTCCTGG + Intergenic
1121271029 14:92638424-92638446 GGATGCTGGGGTTCGAGTCTGGG + Intronic
1122291214 14:100681403-100681425 TGATTCTGGGGTGGGCCTCTGGG + Intergenic
1122996619 14:105268690-105268712 GGATCCTGGGGGGCCTCTCCTGG + Intronic
1123735821 15:23181207-23181229 GGGTGCCGGGGGGCGCCTCTGGG + Intergenic
1124286535 15:28404190-28404212 GGGTGCCGGGGGGCGCCTCTGGG + Intergenic
1124296168 15:28507446-28507468 GGGTGCCGGGGGGCGCCTCTGGG - Intergenic
1125754107 15:42050691-42050713 GGAGGCTGGGATGAGTCTCCAGG - Exonic
1125791332 15:42368381-42368403 GGAGGCTGTGGTGTGCCTCATGG + Intronic
1125841133 15:42802160-42802182 GGATGTTGGGGTCCACCTCCAGG + Intronic
1128842131 15:70858944-70858966 GGATGTTGGGGTCCACCTCCAGG - Intronic
1129176301 15:73841966-73841988 GGGTGCTGGGGTGCCACTGCTGG + Intergenic
1129598039 15:76980199-76980221 GGATGTTGGGGTCCACCTCCAGG + Intergenic
1132705050 16:1239913-1239935 GGGAGCTGGGCTGGGCCTCCTGG + Intergenic
1133315130 16:4878207-4878229 CGATTCTTGGGTACGCCTCCTGG + Intronic
1133344894 16:5063264-5063286 GGATGCTGAGGTAGTCCTCCAGG + Intronic
1135634239 16:24060508-24060530 GGATACTGTGGTGTGCCACCAGG + Intronic
1137561882 16:49507895-49507917 GGATACTGGGATGTGCTTCCTGG - Intronic
1138778561 16:59755046-59755068 CGAGGCTGGGGTGAGCCTGCCGG - Intergenic
1140753834 16:78049645-78049667 GGATGTTGGGGTCCACCTCCAGG + Intronic
1141602983 16:85137449-85137471 GGCTGCTGGGGGTCCCCTCCTGG + Intergenic
1142280498 16:89145376-89145398 TGATGCTGGGGTGGGCCAGCAGG - Exonic
1143026826 17:3945888-3945910 GGATGCTGGGCTGTGCTTGCTGG - Intronic
1143781371 17:9231293-9231315 GGAGGCTGGGGTCCCCCCCCGGG - Intronic
1145276839 17:21436703-21436725 GGGAGATGGGGTGCGCGTCCAGG + Intergenic
1147551616 17:41446644-41446666 TGATGCTGGGCTCCACCTCCAGG - Intergenic
1147890337 17:43712470-43712492 GGAAGCTGGGGTGTGCCCCCAGG - Intergenic
1149579620 17:57740414-57740436 GGATGCTGGGGTGAGCAGCAAGG - Intergenic
1152565005 17:81096453-81096475 GGATGCTGGGGTGCGCCTCCAGG - Intronic
1152888962 17:82869100-82869122 GGAGGCTTGGGTGCTCCCCCTGG + Intronic
1157063667 18:44321972-44321994 GGTTGTTGGGGTCCACCTCCAGG + Intergenic
1158202809 18:54959282-54959304 GGATGCGGGGGCGCGCCGCAGGG + Intronic
1160011523 18:75110075-75110097 GGAGGCTGGGGAGCGCCCCTGGG + Intergenic
1160765167 19:804447-804469 GGCTGCTGGGGTCCGCCGCGGGG - Intronic
1160870221 19:1274565-1274587 GGGTGCAGGGCAGCGCCTCCCGG + Intronic
1161593951 19:5141858-5141880 GGATGGGGGGAGGCGCCTCCAGG + Intronic
1162349038 19:10137781-10137803 GGCTGCTGGGCTGGGCCTCGAGG + Intronic
1166748415 19:45152945-45152967 GGATGCTGGGGTCCACGACCAGG + Exonic
1166761695 19:45228185-45228207 GGCTGCTGGGCTGGTCCTCCAGG + Exonic
1167252168 19:48405151-48405173 GCAGGCAGGGGGGCGCCTCCTGG - Exonic
1167537762 19:50065840-50065862 GGAGGCTGGGGTGAGGGTCCAGG + Intergenic
1168079057 19:53995947-53995969 GGATGCTGGGCTGCGCGTGGTGG - Intronic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168105761 19:54164859-54164881 GGATGCTGGGCGGAGCCTCAGGG - Intronic
925545320 2:5009524-5009546 GGATGCGGGAGTACGGCTCCAGG - Intergenic
926059536 2:9796518-9796540 GGATGCTCGGGGGGTCCTCCAGG - Intergenic
926060420 2:9801447-9801469 GGCTGCTGTGGTGGGCTTCCTGG + Intergenic
927458649 2:23278708-23278730 GGATGGATGGGTGCTCCTCCAGG + Intergenic
927477145 2:23422855-23422877 GGATGCCGCTGTGCTCCTCCAGG + Intronic
928497690 2:31850848-31850870 GCATGGTGGCGTGCGCCTGCAGG + Intergenic
928694217 2:33832772-33832794 GGTTTCTGGGGTGTGCCTCTTGG + Intergenic
931670441 2:64642654-64642676 AGAGGCTGGGGTGAGCCTGCAGG - Intronic
934477632 2:94603870-94603892 AGATGCTGGGGGGCGGGTCCCGG - Exonic
934751194 2:96795255-96795277 GGACCCTGGGGTCCGCCCCCAGG - Intronic
937289525 2:120773832-120773854 GCTTGCTGGGTTGTGCCTCCTGG + Intronic
941638513 2:167961991-167962013 GGCCGCAGGGGTGCGCCTCCAGG - Intronic
944763551 2:202841518-202841540 GGATGTTGGGTTCCACCTCCAGG + Intronic
948736844 2:240014448-240014470 GGAGGCTGGTGAGGGCCTCCTGG - Intronic
948903008 2:240965604-240965626 GGATGTTGGGGTGCGCCCGTGGG - Intronic
949000426 2:241610109-241610131 GGACCCTGGGGGGCGCCGCCAGG - Intronic
1169266072 20:4168050-4168072 GGAAGCTGGGGAGCTGCTCCAGG - Intronic
1172250436 20:33475737-33475759 GGATGCTGGGGTGGACCGTCTGG - Intergenic
1173676456 20:44839883-44839905 GCATCCTGGTGTGCCCCTCCTGG + Intergenic
1173900849 20:46587996-46588018 GGATTCTGGGCTGGGCCACCTGG - Intronic
1175457745 20:59127985-59128007 GGATGCTGGGCTGCCTATCCTGG + Intergenic
1175487617 20:59356655-59356677 GGTTGCTGGGGTGCCCCACAGGG + Intergenic
1179921787 21:44511567-44511589 GGATGCATGGGTGTGCCTGCAGG - Intronic
1180848151 22:18995533-18995555 GGAGACTGGGGTGCTGCTCCTGG + Intergenic
1180868827 22:19134699-19134721 GGGGGCTGGGGTGCACCCCCAGG + Intronic
1181433080 22:22894664-22894686 GGCTGCTGGGGTGGGCCTGGGGG + Intronic
1181516110 22:23414759-23414781 GGAGGCCGGGGTGCCCCTCCAGG - Intergenic
1181625762 22:24121153-24121175 GGATGCTGGGGGGAGCCAGCAGG - Intronic
1183061842 22:35340903-35340925 GGACGCTGGGGTGGGCCATCTGG + Intronic
1183960679 22:41410225-41410247 GGAAGCTGGGGTCCACCTCCAGG + Intergenic
1184032631 22:41903969-41903991 GGAGGCAGGGGTGCCGCTCCAGG - Intronic
1184420867 22:44382151-44382173 GGATGTAGGGGAGCGGCTCCTGG + Intergenic
1185197780 22:49483144-49483166 GGAGGAAGGGGTGGGCCTCCAGG - Intronic
1185241464 22:49749682-49749704 GGAGGCAGGGGTCAGCCTCCAGG + Intergenic
1185315680 22:50178254-50178276 GGATGTAGGGGTGCACGTCCAGG - Exonic
951321254 3:21248692-21248714 ACATGCTGGGGTTTGCCTCCTGG + Intergenic
952611653 3:35216897-35216919 GGATGTTGGGGTCCATCTCCAGG + Intergenic
954302483 3:49707232-49707254 AGATGGTGGAGTGTGCCTCCGGG - Intronic
954602081 3:51877891-51877913 GCATGGTGGAGTGAGCCTCCTGG + Intergenic
955839592 3:63097549-63097571 GGATATTGGGGTCCACCTCCAGG + Intergenic
956678223 3:71754471-71754493 CCATGCTGGTGTGCGCCGCCTGG + Exonic
956791815 3:72685888-72685910 GGATGCTGGAGCGTGCTTCCTGG - Intergenic
957966073 3:87323498-87323520 GGATGTTGGGGTCCACCTGCAGG - Intergenic
958026829 3:88059013-88059035 GGTTGCTGGGGACCGCCTACGGG - Intronic
961677869 3:128578511-128578533 GTTTGCTGGGGTGGGCCTCATGG - Intergenic
961820638 3:129573991-129574013 GGATGCTGAGGTCAGCTTCCAGG + Intronic
962152140 3:132904215-132904237 GGATTCTTGGGTGATCCTCCTGG - Intergenic
962712917 3:138102665-138102687 GAATGTTGGGGTCCACCTCCAGG + Intronic
964802131 3:160568089-160568111 GGATGTTGGAGTCCACCTCCAGG - Intergenic
965757617 3:172040872-172040894 GGAGACTGGGCTGCGCCGCCCGG + Intronic
968566724 4:1317136-1317158 GGGGGCTGGGGTGGGCCTGCGGG - Intronic
968566737 4:1317173-1317195 GGGGGCTGGGGTGGGCCTGCAGG - Intronic
968566749 4:1317210-1317232 GGGGGCTGGGGTGAGCCTGCGGG - Intronic
968566760 4:1317247-1317269 GGGGGCTGGGGTGGGCCTGCGGG - Intronic
968829338 4:2924429-2924451 GGATGCTGGCGGGAGCCTCCTGG - Intronic
969716763 4:8871664-8871686 GGATGGTGGCGCGCGGCTCCCGG + Exonic
970824368 4:20254030-20254052 GGAGGCAGGGGTGCGCGGCCCGG - Intronic
977928782 4:102729919-102729941 GGATGTTGGGGTCCACCTCCAGG + Intronic
981924104 4:150118758-150118780 GGAGGCTAAGGTGGGCCTCCTGG + Intronic
985545363 5:506344-506366 GGGTGCTGGGGTGCGCGGCAGGG + Intronic
986630116 5:9763724-9763746 GGATGCTGGGTTGCGGCACTTGG - Intergenic
994092022 5:95818084-95818106 GGAGGCTGGGGGGCAGCTCCAGG - Intronic
994320910 5:98393274-98393296 GGATGTTGGGGTCCACCTCCAGG + Intergenic
995236698 5:109837122-109837144 ACATGCTGGTGTGTGCCTCCTGG + Intronic
996433023 5:123402091-123402113 GGATGTCGGGGTCCACCTCCAGG + Intronic
996633526 5:125665009-125665031 GGATACTGGGGTGAGCCTACTGG - Intergenic
998224733 5:140318046-140318068 GAATGCTGGGCTGGGCATCCGGG + Intergenic
998887281 5:146707360-146707382 GGATGTTGGGGTTCACCTTCAGG + Intronic
1003457998 6:6301682-6301704 GGATGCTGTGGTGGGCTGCCTGG + Intronic
1005882623 6:30072482-30072504 AGATGCTGGGGTCCCCTTCCAGG + Intronic
1006239118 6:32661991-32662013 GGAGGCTGGGGTGCTCCACGTGG + Exonic
1006248258 6:32758874-32758896 GGAGGCTGGGGTGCTCCACTTGG + Exonic
1006849105 6:37084645-37084667 GAATGCTGGGACGAGCCTCCAGG - Intergenic
1008018848 6:46552907-46552929 GCATGGTGGTGTGCGCCTGCAGG + Intronic
1008960308 6:57259655-57259677 GGATGCTGAGGTGCACTTCCTGG + Intergenic
1009395332 6:63193388-63193410 GGATGTTTGGGTCCACCTCCAGG + Intergenic
1018317152 6:162568535-162568557 GGATGTTGGGGTCCACCTCCAGG - Intronic
1019388951 7:774509-774531 GGATCCTGGGATTCGACTCCTGG - Intronic
1020138313 7:5598752-5598774 TGCTGCTGGGGTGGGCCTGCAGG + Intronic
1022955845 7:35379477-35379499 TGATGCTGTGGTGTGCCACCTGG + Intergenic
1023101269 7:36721062-36721084 GGATCCTGGGGTGTACCTGCTGG - Intronic
1023289550 7:38655435-38655457 GGATGTTGGGGTCCACCTCCAGG - Intergenic
1026437779 7:70414801-70414823 GGCTGCTGGGGTGAATCTCCAGG + Intronic
1027252503 7:76408158-76408180 GGATGGTGGGGAGCTCCTTCTGG - Intronic
1029098295 7:98106776-98106798 GGATGATGGGCGGGGCCTCCTGG + Intergenic
1032083675 7:128872763-128872785 GGATGCTGGGGTGGGGGTCTCGG - Intronic
1032222802 7:130007219-130007241 GCATGGGGGGGTGCTCCTCCAGG - Intergenic
1032953033 7:136938477-136938499 GGATGTTGGGGTTCACCTCTAGG + Intronic
1033657062 7:143381539-143381561 GGCTGCTGGGGTGGGTCGCCGGG - Exonic
1034343623 7:150372660-150372682 GGATGCGCCGGTGCGCCGCCAGG - Exonic
1034558081 7:151862720-151862742 GGATGCCGTGGTGTGGCTCCCGG + Intronic
1036642008 8:10590556-10590578 GGATGCTGGGGAGAAACTCCAGG + Intergenic
1037611957 8:20483320-20483342 GGGTCCTGGGGTGCTCCTCCTGG + Intergenic
1037689702 8:21171775-21171797 GGACCCTGGGGTGAGACTCCAGG + Intergenic
1040107632 8:43549481-43549503 GGAGGCTGGGGTTGTCCTCCAGG - Intergenic
1040668589 8:49659209-49659231 GGAGGGTGGGGGGCCCCTCCTGG - Intergenic
1041781034 8:61578450-61578472 GGATGTTGGGGTCCACCTCCAGG - Intronic
1043395469 8:79831616-79831638 AGATGCTCGGGTTCGCCTGCTGG + Intergenic
1044973053 8:97638501-97638523 GGATGCTGCAGTGCATCTCCTGG - Intergenic
1047167806 8:122459900-122459922 GGATGCTGATATGAGCCTCCAGG + Intergenic
1048004985 8:130411891-130411913 GGACACTGGGGTGCTGCTCCTGG - Intronic
1048176185 8:132154622-132154644 GGATGATGGGGTGGGGCTGCAGG + Intronic
1049247928 8:141572590-141572612 GGAAGGTGGGCTGTGCCTCCGGG - Intergenic
1057943531 9:99305390-99305412 GGATGTTGGGGTCCACCTCCAGG - Intergenic
1185452568 X:290671-290693 GGATGCCGGGGTGCGGTACCTGG + Exonic
1186465940 X:9785204-9785226 CGATGCTGGAGTACGCATCCAGG - Intronic
1187392379 X:18894576-18894598 GGAGGCTGGAGTATGCCTCCAGG + Intronic
1189893895 X:45633481-45633503 GGATGTTGGGGTCCACCTCCAGG + Intergenic
1190773789 X:53536615-53536637 GGATGCTGGTGGGCTCCTGCGGG - Exonic
1191220660 X:57984916-57984938 GGATGTTGAGGTCCACCTCCAGG - Intergenic
1196692706 X:118577329-118577351 GGATGCTTTGGTGGGCCACCTGG + Intronic
1196817599 X:119677553-119677575 TGATGCTGGGCTGGGCCTCCTGG - Intronic
1199927148 X:152479807-152479829 GGATGTTGGGGTCCACCTCCAGG - Intergenic
1200003646 X:153074202-153074224 GGAGGCTGAGGAGCTCCTCCAGG + Exonic
1200004077 X:153075807-153075829 GGAGGCTGAGGAGCTCCTCCAGG - Intergenic
1200054014 X:153449300-153449322 GAATCCTGGGGTGTGCCTCGGGG + Intronic