ID: 1152565514

View in Genome Browser
Species Human (GRCh38)
Location 17:81098619-81098641
Sequence CTGGATCTGGAAGCTCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 158}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152565511_1152565514 0 Left 1152565511 17:81098596-81098618 CCTGGTGTGTTCAGAATCGGTAG 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 158
1152565504_1152565514 29 Left 1152565504 17:81098567-81098589 CCCAAACTAAAGCTCTTAGTACC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 158
1152565509_1152565514 4 Left 1152565509 17:81098592-81098614 CCGTCCTGGTGTGTTCAGAATCG 0: 1
1: 0
2: 1
3: 11
4: 95
Right 1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 158
1152565508_1152565514 7 Left 1152565508 17:81098589-81098611 CCTCCGTCCTGGTGTGTTCAGAA 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 158
1152565505_1152565514 28 Left 1152565505 17:81098568-81098590 CCAAACTAAAGCTCTTAGTACCC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 158
1152565507_1152565514 8 Left 1152565507 17:81098588-81098610 CCCTCCGTCCTGGTGTGTTCAGA 0: 1
1: 0
2: 0
3: 4
4: 118
Right 1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152565514 Original CRISPR CTGGATCTGGAAGCTCTGTC AGG Intronic
900272745 1:1800990-1801012 CTGGACATGGAAGATCTCTCTGG + Intronic
900291050 1:1923744-1923766 CTGGCTCTGCAAGCTCAGCCCGG - Intronic
902277466 1:15350049-15350071 CTGTTTCTGGAAGTTCTGTGGGG - Intronic
902480128 1:16707405-16707427 CAGGATCTGGCAGCACTGTGGGG + Intergenic
903529408 1:24018668-24018690 CGGGTACTGGAATCTCTGTCTGG + Intergenic
904410842 1:30323947-30323969 CTGAGCCTGGAAGGTCTGTCTGG - Intergenic
909023487 1:70458132-70458154 CTGGATCAGGAAGCTGTTTCTGG + Intergenic
909323811 1:74324106-74324128 CTTTATCTTGAAGCCCTGTCAGG - Intronic
915399534 1:155612174-155612196 CAGGATCTGGAAGCCCTGGACGG - Exonic
915416647 1:155747754-155747776 CAGGATCTGGAAGCCCTGGGCGG - Intergenic
917584227 1:176409553-176409575 CTGCAACTGGAAACTCTCTCAGG + Intergenic
919023561 1:192139546-192139568 CTGGATCCTGCAGCTCTTTCAGG + Intergenic
920249714 1:204615490-204615512 CAGGATCCAGAAGCTCTGTAGGG - Intergenic
920303010 1:205000972-205000994 CTGCAGCTTGGAGCTCTGTCAGG + Intronic
921317880 1:213909138-213909160 CTGGAAATGGAAGCTCTGAGAGG + Intergenic
923969744 1:239186684-239186706 CTGGATCTGGCAGTTATCTCTGG - Intergenic
1065127205 10:22585016-22585038 CTGGGTCTGGAGGGGCTGTCGGG - Intronic
1065506012 10:26430799-26430821 CTGTATCTTGAAGCTATTTCTGG + Intergenic
1066688407 10:38003005-38003027 CTGGATCTGGAACTCCTCTCTGG - Intergenic
1067286231 10:44909373-44909395 ATGGGTCGGGAAGCTCTGGCTGG - Intergenic
1072267704 10:93746288-93746310 CTGGCTCTGGAGGCTCTCTGGGG - Intergenic
1072616714 10:97054652-97054674 TTGGATCTAGGAGCTCGGTCAGG - Intronic
1073273026 10:102282922-102282944 CTGACTCTGAATGCTCTGTCCGG + Intronic
1073641717 10:105259329-105259351 TTGGATCTGGAAACTCAGTATGG - Intronic
1073776795 10:106795429-106795451 CTGGATCTAGAATTTCTGTAAGG + Intronic
1077285074 11:1761981-1762003 CTGGCACTGGCAGCTCTGCCTGG + Intronic
1078741017 11:14066469-14066491 CCGGTTGTGGAAGCTCTGACAGG - Intronic
1079313206 11:19384941-19384963 CTGGATGTGAAACCTTTGTCAGG - Intronic
1080612438 11:33916129-33916151 CTGGCTCAGGAAGCTCTGGAAGG + Intergenic
1081744177 11:45461548-45461570 CTAGCTCTGTAAGCTCTGGCAGG + Intergenic
1082817255 11:57517298-57517320 CTTGATCTGGAAGTTCTGGGAGG - Intergenic
1082851166 11:57766070-57766092 CTGGCTCTGCAAGCCCAGTCTGG - Intronic
1083259564 11:61515859-61515881 CTAGCTCTGGAGGCTCTGTGGGG + Intronic
1084889378 11:72229145-72229167 CTGGACCTGGAAGCTGTGAGGGG + Exonic
1086119850 11:83294453-83294475 CTGGAGCTGTAGGCTCTGCCAGG - Intergenic
1089643154 11:119860820-119860842 CAGGGTCTAGAAGCTCTGCCAGG - Intergenic
1090444636 11:126753316-126753338 CTGGTTCTGGAAGGCCTGGCTGG - Intronic
1090975323 11:131675084-131675106 GGGGATCTGGAAGCTCAGGCAGG - Intronic
1090978272 11:131694415-131694437 CTGGGTCTAGAAGCTGAGTCTGG + Intronic
1096885720 12:54717248-54717270 TTTGATCTGGAAGCTGTGCCTGG + Intergenic
1099298546 12:80861837-80861859 CTGGAGCAGGCAGCTCTGTGAGG + Intronic
1102980214 12:117235298-117235320 CTGGATCTGGAAGCAGTATTGGG + Intronic
1103860286 12:124006948-124006970 CAGGATCTGTGAGCTCTGTGGGG + Intronic
1105896767 13:24723254-24723276 CTTCATCTGCAAGCTCTGGCGGG + Intergenic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1125717042 15:41825287-41825309 CAGGAGCTGGAAGCTGTGGCTGG + Exonic
1131371950 15:91889509-91889531 ACTGATCTGGAAGCTCTGTAAGG + Intronic
1132273716 15:100548110-100548132 CTGGAACTGGGAGCCCTGTGGGG - Intergenic
1132618105 16:852249-852271 CTGGGGCTAGAGGCTCTGTCTGG + Intergenic
1133002072 16:2856795-2856817 GTGGAGCTGGCAGCTCTGACGGG - Intronic
1136777077 16:32877707-32877729 CTGGATGTGGGAGCCGTGTCCGG + Intergenic
1136893542 16:33983806-33983828 CTGGATGTGGGAGCCGTGTCCGG - Intergenic
1137246424 16:46709597-46709619 TTGGATCTTGAAGCTTTGGCAGG + Exonic
1138111358 16:54326698-54326720 CAGGATCTGGAAGCTTTGTGTGG - Intergenic
1203079492 16_KI270728v1_random:1139816-1139838 CTGGATGTGGGAGCCGTGTCCGG + Intergenic
1143949906 17:10624194-10624216 TTGGAGCAGGAAGCTCTGGCTGG + Intergenic
1145062820 17:19743478-19743500 CTGGCCCTGGAAGCTCACTCCGG - Intronic
1145784394 17:27584707-27584729 CTGGTTCTGGTAGCTCTGCAGGG - Intronic
1146929920 17:36769550-36769572 CTGGGTCTGGAATCTTTGTTCGG - Intergenic
1148235198 17:45964113-45964135 CTGAATCTGGCAGCACTGGCTGG - Intronic
1148474352 17:47917084-47917106 CTGGATCTGAAAGTTCTGGGAGG - Exonic
1148510263 17:48162892-48162914 CTGGATCAGGAAAGTCTGGCGGG - Intronic
1149217756 17:54377723-54377745 CTGGAATTGGAAGCTCTGGAAGG - Intergenic
1150206363 17:63411651-63411673 CTGGATCTGGCAGCTTTCTATGG + Exonic
1150423415 17:65057556-65057578 CTGGGCCTGGTGGCTCTGTCTGG - Intergenic
1151724491 17:75876412-75876434 CTGGGTCTGGAAGCCCTGCAGGG + Exonic
1152299086 17:79485019-79485041 CTGGCTCTGGGAGCCCTGTCTGG - Intronic
1152321453 17:79610580-79610602 TGGGGTCTGGACGCTCTGTCCGG - Intergenic
1152565514 17:81098619-81098641 CTGGATCTGGAAGCTCTGTCAGG + Intronic
1152759798 17:82101852-82101874 GAGGAGCTGGGAGCTCTGTCAGG + Exonic
1158417248 18:57259445-57259467 TTGAATCTGGTAGGTCTGTCTGG - Intergenic
1159454294 18:68641445-68641467 CTGAATCAGTCAGCTCTGTCTGG - Intergenic
1159655493 18:71027172-71027194 CTGGATCTGGAACCGCTTTCCGG - Intergenic
1161069002 19:2251217-2251239 CTGGATCCGGACGCGCTGGCCGG + Exonic
1162828609 19:13270013-13270035 CTGGATCTCGCAGCCCTGCCAGG + Intronic
1163489629 19:17609597-17609619 CTGGGGCTGGAGACTCTGTCTGG - Intronic
1163680668 19:18680345-18680367 CTGGATCCAGAAGCTCAGGCTGG + Intergenic
1165073306 19:33267887-33267909 CTGGGTCTGGAGGCTCCTTCAGG - Intergenic
1165388516 19:35525520-35525542 CTGGATCTGCAAGATGTGACTGG - Intronic
1168373003 19:55851775-55851797 CTGGATATTGAGGCTATGTCAGG + Intronic
1202714165 1_KI270714v1_random:33311-33333 CAGGATCTGGCAGCACTGTGGGG + Intergenic
927179657 2:20435737-20435759 CTGCAGCTGGAAGCTCAGGCAGG + Intergenic
927604840 2:24477531-24477553 CTGGATCTGGGAGCTGAGGCAGG - Intergenic
927792052 2:26018030-26018052 AGGGATCTGGAATCTGTGTCTGG - Intergenic
930610804 2:53540912-53540934 CTGGAGCTTTTAGCTCTGTCTGG - Intronic
930750246 2:54927560-54927582 CTGAATATGGAAGCTTTTTCTGG + Intronic
936157387 2:110057297-110057319 CTGGACCTGGGATCTTTGTCAGG + Intergenic
936187305 2:110314147-110314169 CTGGACCTGGGATCTTTGTCAGG - Intergenic
938781709 2:134590499-134590521 CTGGATCTGGACCCCCTTTCTGG - Intronic
939152596 2:138490788-138490810 TTGGATCTGTAAACTCTGCCAGG - Intergenic
941675143 2:168336150-168336172 TTGGATCTGGAATCTCGGACTGG + Intergenic
943521557 2:188957591-188957613 ATGGACCTGGAAGCCCTGTGTGG - Intergenic
948047492 2:234954919-234954941 CTGGAACTGGGAGGTCTGCCTGG - Intronic
1170810932 20:19673917-19673939 CAGGATCTGGCAGCTCTGGGAGG + Intronic
1170947451 20:20904067-20904089 CTGAGTCAGGGAGCTCTGTCTGG + Intergenic
1171192749 20:23170801-23170823 CTGGATGTGTAAGCTTTGACTGG + Intergenic
1172039252 20:32031993-32032015 CAGGATCTGGAGCCTCTATCTGG + Exonic
1172155635 20:32821878-32821900 CTGGATCAGGAAGCCTTGTAAGG + Intronic
1175844136 20:62049740-62049762 CGGGCTCTGGAACCTCTGCCCGG - Intronic
1175948279 20:62568832-62568854 CTTGCTCTGGAGGCTCTGACTGG - Intronic
1176095458 20:63341957-63341979 GTGTATTTGGAAGCTCTGTTAGG - Intergenic
1180049421 21:45324505-45324527 CTGGGTCAGGAAGCTGGGTCTGG + Intergenic
1182422927 22:30257352-30257374 CCGGATCTGGAAGGTTTGCCAGG + Intergenic
1183779447 22:39989326-39989348 CTGAGTCTGGAAGGTCTGTGGGG + Intergenic
1185020277 22:48370482-48370504 CTGGATTTGGAGGCTCTTCCAGG - Intergenic
1185147541 22:49147395-49147417 CAGGACCTGGAAGGTCTGTGCGG - Intergenic
1185373689 22:50472335-50472357 CTGGATCTGGACATCCTGTCTGG - Intronic
953476867 3:43212590-43212612 TTGGATTTGGAAGGTCAGTCTGG + Intergenic
954099494 3:48358293-48358315 GTGGAGCTGGAAGCCCTGTAGGG + Intergenic
954622159 3:52002491-52002513 CTGGATGTGGCAGGTGTGTCTGG - Intergenic
959633787 3:108538243-108538265 CTTAAACTGGAAGCTCAGTCTGG - Intergenic
962475761 3:135753682-135753704 CTGGGTCTGTAAGCTATCTCTGG + Intergenic
967588550 3:191244988-191245010 GTGTTTCTGGAAGGTCTGTCAGG + Intronic
970602707 4:17652933-17652955 TTGGATCTGGAGGCTGTGGCTGG + Exonic
972212205 4:36852335-36852357 CTGCGTGTGGAAACTCTGTCAGG + Intergenic
973189767 4:47373534-47373556 CTGGATCTTGAACCCCAGTCTGG - Intronic
978302536 4:107287692-107287714 CTAGATCCGTAAGCTCTCTCTGG - Intergenic
978512702 4:109538489-109538511 CTAGCTCTGGAAGATGTGTCTGG - Exonic
979487170 4:121283196-121283218 CTGGATCTGGAGGGCCTGCCTGG - Intergenic
980047598 4:128005943-128005965 TTGGATATGAAAGCTCTGTGGGG - Intronic
981723293 4:147823011-147823033 CTGGATTTGGAAGCTTGTTCTGG + Intronic
986579792 5:9253479-9253501 CTGGTTTTGGAAGCTATCTCTGG + Intronic
987005057 5:13702491-13702513 CTGGAACAGGAATCCCTGTCAGG - Intronic
988299472 5:29403910-29403932 GTGGATCCAGAAGCGCTGTCTGG - Intergenic
990642806 5:57806797-57806819 CTGGATCTTGAAGGTCTCTGTGG + Intergenic
992723007 5:79578946-79578968 TTTAATCTGGAATCTCTGTCTGG + Intergenic
993766880 5:91870736-91870758 CTAAAACTGGAAGCTCTTTCTGG - Intergenic
993954570 5:94216311-94216333 CTGAATCTGAAAATTCTGTCTGG + Intronic
995836909 5:116408422-116408444 CTGGATCTGGAAGGTGTTCCTGG + Intronic
995881795 5:116851560-116851582 CTTAAGCTGGAAGCTCTGCCGGG + Intergenic
997697104 5:135870323-135870345 CTGGGTCTGGAAGTTCTGTCTGG + Intronic
998780060 5:145646879-145646901 CTTCCTCTGGAAGCTTTGTCCGG + Intronic
1002463253 5:179387415-179387437 CTGGATCTAGAAGGTCTGTGAGG + Intergenic
1005329255 6:24733216-24733238 CTGTATCTGGCAGCTGTGTCTGG - Intergenic
1006566441 6:34962069-34962091 ATGGATCTGGAAAATCTGTGAGG - Intronic
1006678669 6:35781371-35781393 CTGGTCCTGGAAGCTGTGCCAGG + Intronic
1007354382 6:41301559-41301581 CTGGATATTGAATCTTTGTCAGG - Intergenic
1008451581 6:51657259-51657281 CTGGCTCTGGAGACTGTGTCGGG + Intronic
1009390784 6:63140746-63140768 GTGGGTCTGGAAGTGCTGTCTGG - Intergenic
1010554938 6:77267377-77267399 TTGGATCTGAAAGCTTTGTATGG - Intergenic
1010653235 6:78479621-78479643 CTGGGTCTTGAAGCTCTCTAGGG + Intergenic
1021465038 7:20932857-20932879 CTTGGTCTGGAAGCTGTGACAGG + Intergenic
1023043850 7:36194984-36195006 CTGGAAATTGGAGCTCTGTCTGG - Intronic
1029700567 7:102244170-102244192 CAGTGTCGGGAAGCTCTGTCGGG - Intronic
1034001036 7:147413522-147413544 CTGGAGATGGAAGCTCAGGCAGG + Intronic
1036792450 8:11730514-11730536 CAGGAGCTGGGAGCTTTGTCTGG + Intronic
1038840099 8:31176894-31176916 CTGGATCTTCAAGTTCTGTATGG + Intergenic
1049160355 8:141093835-141093857 CTGGGTCCAGAAGCTCCGTCAGG - Intergenic
1052938032 9:34109735-34109757 CTGGCCCTGGAAGCTCAGGCAGG + Intronic
1055890406 9:81117749-81117771 CTGGATCAGGATGCTGTGTTGGG - Intergenic
1057004665 9:91546795-91546817 CTGGGTCTGCAGGCTCTGGCGGG + Intergenic
1059031253 9:110699499-110699521 TTGGCTCTGGAAGCTCTGAAAGG + Intronic
1059329965 9:113528707-113528729 CTGGGCCTGGAAGCTGTCTCTGG + Intronic
1060599569 9:124869098-124869120 CCGGATCCGGAAGCGCCGTCAGG - Exonic
1203406260 Un_KI270538v1:17437-17459 GTGGATATTGAAGCTCTTTCTGG + Intergenic
1187261216 X:17686782-17686804 CTGGATCTGGATAGTGTGTCTGG + Intronic
1187622673 X:21075921-21075943 CTGGATTTGGAGTCTATGTCTGG + Intergenic
1187882489 X:23860189-23860211 CTGGATCTGGAATCTCCCTGGGG - Intronic
1190186251 X:48237152-48237174 CAGGAGCTGGAAGCTCTGATTGG + Intronic
1190201834 X:48368404-48368426 CAGGAGCTGGAAGCTCTGATTGG - Intergenic
1190208705 X:48427007-48427029 CAGGAGCTGGAAGCTCTGATTGG + Intergenic
1190668675 X:52719019-52719041 CAGGAGCTGGAAGCTCTGATTGG - Intergenic
1190670742 X:52739385-52739407 CAGGAGCTGGAAGCTCTGATTGG + Intergenic
1190876153 X:54461684-54461706 CACAATCTGGAATCTCTGTCTGG + Intronic
1192556629 X:72095169-72095191 CAGGACCTAGAAGCTCTTTCGGG + Intergenic
1195877365 X:109555945-109555967 CTGGATCTGGACCCCCTGTCTGG + Intergenic
1198332453 X:135634201-135634223 CTGGCTCTGGTGGCCCTGTCTGG + Intergenic