ID: 1152566623

View in Genome Browser
Species Human (GRCh38)
Location 17:81103221-81103243
Sequence CAGGCCCTGATGGGCCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152566608_1152566623 24 Left 1152566608 17:81103174-81103196 CCCACCGGAGTTTGACCTTGTGC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 23
4: 233
1152566611_1152566623 9 Left 1152566611 17:81103189-81103211 CCTTGTGCGTCCCTGTCCGTTCC 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 23
4: 233
1152566610_1152566623 20 Left 1152566610 17:81103178-81103200 CCGGAGTTTGACCTTGTGCGTCC 0: 1
1: 0
2: 0
3: 0
4: 39
Right 1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 23
4: 233
1152566612_1152566623 -1 Left 1152566612 17:81103199-81103221 CCCTGTCCGTTCCTCCTTCCTCC 0: 1
1: 0
2: 6
3: 102
4: 1029
Right 1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 23
4: 233
1152566609_1152566623 23 Left 1152566609 17:81103175-81103197 CCACCGGAGTTTGACCTTGTGCG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 23
4: 233
1152566613_1152566623 -2 Left 1152566613 17:81103200-81103222 CCTGTCCGTTCCTCCTTCCTCCA 0: 1
1: 0
2: 2
3: 67
4: 638
Right 1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 23
4: 233
1152566615_1152566623 -7 Left 1152566615 17:81103205-81103227 CCGTTCCTCCTTCCTCCAGGCCC 0: 2
1: 1
2: 35
3: 220
4: 1740
Right 1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG 0: 1
1: 0
2: 0
3: 23
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152566623 Original CRISPR CAGGCCCTGATGGGCCCCGC GGG Intronic
900193045 1:1359531-1359553 CAGGCCCCGAGGGCCCCAGCTGG + Intronic
900335396 1:2160667-2160689 CAGGCCATGACAGGCCCAGCAGG - Intronic
900405458 1:2490974-2490996 CAGGCTCTGCTGGGGGCCGCTGG + Intronic
900484409 1:2914614-2914636 CTCTCCCTGAGGGGCCCCGCTGG + Intergenic
900644441 1:3702632-3702654 CAGGCCCTGCTGGGGCCCCAGGG - Intronic
900970421 1:5989666-5989688 CAGGCCGTGATGGCCCCAGGTGG + Intronic
901207525 1:7505513-7505535 CAGGCCCAGATGGGGCCGGGAGG + Intronic
901303862 1:8218302-8218324 CAGGCCTTCCTGGGCCCCACAGG + Intergenic
901639782 1:10687396-10687418 CTGGCCCTTCTGGGCCCTGCTGG - Intronic
903649269 1:24913188-24913210 CAGGCCCTGAGGGCCAACGCGGG - Intronic
904278037 1:29396956-29396978 CAGGGCCAGATGGGACCCCCAGG + Intergenic
905868832 1:41391508-41391530 CAGGCCCTGGTGGCCCCTGCGGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906321903 1:44822478-44822500 CAGCCCCTGATGAGCCCCCTTGG - Exonic
906529571 1:46515771-46515793 CAGGCCCAGGTTGGCCCAGCAGG - Intergenic
914917232 1:151826186-151826208 CAGGCCCAGATTGGCCACGTGGG - Intronic
915522741 1:156457357-156457379 CAGGCGAGGACGGGCCCCGCAGG + Intergenic
915622719 1:157095731-157095753 CAGGGCCTGCTGGGACTCGCTGG - Intronic
916587040 1:166157781-166157803 CAGGCCCTAATGGGCAGCCCTGG - Intronic
917536379 1:175877382-175877404 CAGGGCCTGGTGGGCTCTGCAGG + Intergenic
917782660 1:178414715-178414737 CAGGCCCAGATGGGTTCCTCTGG - Intronic
917976870 1:180245391-180245413 CAGCCCCTGATGGCCCCTGATGG + Intronic
919919180 1:202158154-202158176 CTGGCGCTGAAGGGCCCAGCGGG + Exonic
920251294 1:204624170-204624192 CAGGAGCTGAGGGGCCCAGCAGG - Intronic
922800747 1:228363769-228363791 CAGGCCCTGCTGCTCACCGCAGG + Intronic
1062824372 10:557467-557489 CAGGCCATGATGGCCTCTGCTGG + Intronic
1064144377 10:12815821-12815843 CAGGACCTGATGGGCTGAGCAGG + Intronic
1064787219 10:18911366-18911388 CAGGCCCTGATTTGTCCTGCAGG - Intergenic
1069780220 10:70950696-70950718 CAGGCCCTGAAGGCCCTCTCTGG + Intergenic
1074892543 10:117747697-117747719 CAGGCCCTGCTGTGCCCATCTGG + Intergenic
1075872027 10:125778036-125778058 CAGCCCCTGATGCCCACCGCTGG + Intergenic
1076548354 10:131260919-131260941 CAGGCTCAGCTGGGCCCTGCAGG + Intronic
1076548385 10:131261023-131261045 CAGGCTCAGCTGGGCCCTGCAGG + Intronic
1076683677 10:132187348-132187370 CCGGCCCTGCCGGGCCCTGCCGG + Intronic
1076697089 10:132252068-132252090 CCAGCCCTGAGGGGCCCAGCAGG - Intronic
1076737713 10:132466157-132466179 CAGGGCCTGAGGGGCACCACTGG + Intergenic
1076745328 10:132510039-132510061 GAGGCCAGGATGGGCCCAGCCGG + Intergenic
1076930271 10:133527766-133527788 CAGGCCCCGGAGGCCCCCGCCGG + Intronic
1076994644 11:292118-292140 CAGGCCCTGCAGGGCCCTACGGG - Intronic
1077147030 11:1050942-1050964 CAGGCGCTGCCGGGCCCTGCAGG + Intergenic
1077413151 11:2412807-2412829 CGGGCCCTGAGGGGCCCTGGGGG + Exonic
1079245594 11:18750027-18750049 CAGAGCCTGATGGGCCCTGAGGG + Intronic
1079401928 11:20112784-20112806 CAGGCCTTGATTGGCCCATCTGG + Intronic
1082821223 11:57545970-57545992 CAGCCCCTGCTCGGCCCCGGGGG + Exonic
1082821291 11:57546169-57546191 GAGGCCATGAAGGGCCCCACTGG - Intronic
1083640957 11:64145032-64145054 CAGGCTCTGCTGGGCCCTCCAGG + Intronic
1085263925 11:75225198-75225220 CAGGCCATGCTGGGCCTTGCAGG - Intergenic
1085526547 11:77167333-77167355 CAGGCCCTGGTGGGCGCCTATGG + Intronic
1088877706 11:113949579-113949601 CAGGCCATGATGGGCAGCGGGGG + Intergenic
1091588916 12:1831536-1831558 CCGGCCCTGCTGGGGCCCGAGGG + Intronic
1094839540 12:34337161-34337183 CCGGAGCTGCTGGGCCCCGCGGG + Intergenic
1094841953 12:34345951-34345973 CCGGAGCTGCTGGGCCCCGCGGG - Intergenic
1096147463 12:49289100-49289122 CAGGCCCTGAGTGGCCCTGCTGG - Intergenic
1096548362 12:52356525-52356547 CGGGCCCTGCTGGAGCCCGCGGG - Intergenic
1096884376 12:54701750-54701772 CAGCCCCTCATGTGCCCGGCTGG + Intergenic
1102593997 12:113978510-113978532 TTGGCCCTGGTGGGCCCTGCTGG + Intergenic
1102908760 12:116696794-116696816 CTGGCCCTGCTGGGACCCCCAGG - Intergenic
1103542937 12:121678923-121678945 CAAACCCTGATTGGCCCAGCTGG + Intergenic
1105405318 13:20128175-20128197 CGGGCCCTGGCCGGCCCCGCTGG - Intergenic
1105512174 13:21060750-21060772 CCCGCCCTGTTGGCCCCCGCCGG - Intronic
1106072545 13:26426364-26426386 CAGGACCTGATGGGCCAGGGTGG - Intergenic
1112494893 13:99896509-99896531 CTAGCCCCGAGGGGCCCCGCAGG + Exonic
1113459661 13:110473007-110473029 CAGGGCCAGATGGGCCCCCTGGG + Exonic
1113762915 13:112862683-112862705 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113762953 13:112862899-112862921 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113762971 13:112863007-112863029 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113762989 13:112863115-112863137 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113762999 13:112863169-112863191 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763009 13:112863223-112863245 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763018 13:112863277-112863299 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763028 13:112863331-112863353 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763039 13:112863385-112863407 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763050 13:112863439-112863461 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763095 13:112863710-112863732 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763121 13:112863872-112863894 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763129 13:112863926-112863948 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763160 13:112864142-112864164 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763180 13:112864250-112864272 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763228 13:112864520-112864542 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763239 13:112864574-112864596 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763262 13:112864682-112864704 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763270 13:112864736-112864758 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763298 13:112864899-112864921 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763333 13:112865115-112865137 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763344 13:112865170-112865192 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113763363 13:112865278-112865300 CAGGTGGTGATGGACCCCGCTGG - Intronic
1113767404 13:112889816-112889838 CAGGCCCGGATCCACCCCGCAGG - Intergenic
1113895110 13:113759294-113759316 CTGGGCCTGCTGGACCCCGCAGG + Exonic
1113905870 13:113818999-113819021 CAGGCCCTGGTGGTCCCTGAGGG - Intergenic
1114528479 14:23380682-23380704 CAGGCCATGCTGGGCTCCTCGGG - Intergenic
1117912653 14:60649540-60649562 CAGCCCCGGATAGGCGCCGCCGG - Intronic
1120173890 14:81273628-81273650 CAGGCTGGGCTGGGCCCCGCCGG + Intronic
1120554907 14:85917901-85917923 CTGGCCCTTTTGGTCCCCGCTGG - Intergenic
1121274874 14:92660598-92660620 CAGGCCTCGATGGGCCTTGCAGG - Intronic
1122452814 14:101824809-101824831 GAGGCCTTGCTGGGCCCCACAGG - Intronic
1122987284 14:105218336-105218358 CAGGCCTTGCTGGGCCACGCAGG - Intronic
1123676072 15:22711080-22711102 CGGGGCCTGGTGGGCCCGGCGGG + Intergenic
1123722254 15:23069688-23069710 CCGGGCGTGGTGGGCCCCGCGGG + Intergenic
1123752883 15:23372464-23372486 CTGGGCCTGGTGGGCCCCGCGGG - Intergenic
1123947019 15:25243777-25243799 AAGGCCCTGAAGGGCCTCTCAGG + Intergenic
1124328271 15:28784994-28785016 CGGGGCCTGGTGGGCCCGGCGGG + Intergenic
1128656702 15:69467816-69467838 AAGGAGCTAATGGGCCCCGCCGG - Intergenic
1128711936 15:69878616-69878638 CAGGCCCTCTTGGGCCCTGCGGG + Intergenic
1129654865 15:77517182-77517204 CAACCCCTGATGGTCTCCGCAGG - Intergenic
1131131251 15:89901899-89901921 CAAGCACTCATGGGCCCCACAGG - Intronic
1131377655 15:91938966-91938988 CAGGCCCAGATGAGCCCAGAGGG - Intronic
1132626808 16:895165-895187 GAGGTCCTGATGGCCCCGGCAGG - Intronic
1133259254 16:4538000-4538022 CAGCCCCTGCCGAGCCCCGCGGG - Intronic
1136315914 16:29454734-29454756 CAAGGCCCGATGGGTCCCGCGGG + Exonic
1136393362 16:29979016-29979038 CAGGCCCTGAAGCGCCCCGTGGG - Exonic
1136430491 16:30194076-30194098 CAAGGCCCGATGGGTCCCGCGGG + Exonic
1141663133 16:85452518-85452540 CAGGGGCTTCTGGGCCCCGCCGG - Intergenic
1142150095 16:88508879-88508901 CAGGTCCTCAGGGGCCCCGCGGG + Intronic
1142681366 17:1550970-1550992 CAGGACCTGATGGGACACGAAGG + Intronic
1142696048 17:1634576-1634598 CAGGCCTTCCTGGGCCCCTCCGG + Exonic
1143525312 17:7468470-7468492 AAGGCCCTGATGGTGCCTGCAGG - Intronic
1144826452 17:18108179-18108201 CAGGCCCAGACTGGCCCCTCCGG + Intergenic
1144828703 17:18120443-18120465 CAGGCCCCGGTGGGCGCCGAAGG - Exonic
1147365609 17:39957236-39957258 CAGGCCCTGATGGGACTCTGTGG + Intergenic
1147994827 17:44354812-44354834 CAGCCCCCGAGGGCCCCCGCCGG + Exonic
1148127200 17:45242961-45242983 CAGGCCCTGATGGGAGGCACAGG - Intronic
1148644887 17:49214177-49214199 CAGGCCCTGAGGGGCACCCGAGG + Intronic
1152095409 17:78269208-78269230 CAGGGCCTGCTGGGCCCCCTTGG + Intergenic
1152294110 17:79456729-79456751 CAGGCTCTGAAGGGCCCTGGGGG - Intronic
1152566623 17:81103221-81103243 CAGGCCCTGATGGGCCCCGCGGG + Intronic
1152568133 17:81109253-81109275 CAGGACCTGCTGGGCCGTGCGGG + Intronic
1154153520 18:11926243-11926265 CAGGGCATGATGGCCCCGGCAGG + Intergenic
1157553124 18:48594938-48594960 CAGGGCCTGCTGGGCCCTGAAGG + Intronic
1160456640 18:79006518-79006540 CAGCACCCGATGAGCCCCGCGGG + Intergenic
1160837756 19:1132648-1132670 CAGGCCCTGCTGCGCCCCCCTGG + Intronic
1160981133 19:1817131-1817153 CAGGCCCAGATGGGGCCAGATGG + Intronic
1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG + Intergenic
1162320748 19:9969653-9969675 CAGGTCCTGATGGGCCCCCAGGG - Exonic
1162572847 19:11482651-11482673 CACGCGCAGATTGGCCCCGCCGG - Intronic
1162744651 19:12791719-12791741 GAGGCCCGGAGCGGCCCCGCAGG + Exonic
1162936203 19:13982996-13983018 CTGTCCCTGATGGCCCCTGCCGG + Intronic
1162954260 19:14089814-14089836 CAGGCCCGGACGGGCGCCGCCGG - Exonic
1163420998 19:17213572-17213594 CAGTTCCTGGTGGGCCCAGCAGG + Intronic
1165075132 19:33276229-33276251 GAGGCCATGAGGGGCCCGGCAGG - Intergenic
1165213573 19:34254224-34254246 CAGGCCCCGACGGGCACTGCAGG - Intergenic
1165304456 19:34995068-34995090 CAGGCCCAGAAGGCCCCAGCTGG + Intronic
1165617894 19:37218253-37218275 CAGGCTCGGCTGGGGCCCGCAGG + Intronic
1166340387 19:42133495-42133517 CATGCCCGCCTGGGCCCCGCAGG + Intronic
1167138667 19:47634168-47634190 CAGGCCTTGACGGGCTCTGCAGG + Intronic
1167492108 19:49798957-49798979 CAGGCCCTGATAGGCCCAGGCGG - Intronic
1167566785 19:50261790-50261812 CAGTCCCTGAGGGGCCCTGTGGG + Intronic
1167591924 19:50408927-50408949 AAGGCCCAGATGGGCCTCGGGGG - Intronic
1168268484 19:55236657-55236679 CTGGCCCAGACGGGCCCCCCTGG + Exonic
925413199 2:3651923-3651945 CAGACCCTGATGGGCCCACAGGG - Intergenic
926154867 2:10448209-10448231 CAGGCGCTGACGGGCGCGGCGGG - Exonic
926170001 2:10547165-10547187 CAGCCCCTGAGTGGCCCAGCTGG - Intergenic
926323530 2:11765346-11765368 TGGGCCCTGATGGGCCCTGATGG + Intronic
926700659 2:15801128-15801150 CAAGCCTTGGTGGGCCCCGGCGG + Intergenic
927506815 2:23620241-23620263 AACTCCCTGATGGGCCCCGCTGG - Intronic
927690484 2:25204598-25204620 GAGGCCGTGAGGGGCCCTGCGGG - Intergenic
927713938 2:25341186-25341208 CCGGCCCTCCTCGGCCCCGCGGG - Intronic
930008259 2:46915326-46915348 CAGGTCCTGTCGGGCCCGGCGGG - Intronic
933713034 2:85341611-85341633 CAGACCCTGATGCTCCCAGCAGG - Intergenic
933778397 2:85785555-85785577 CAGGCCCTGGTGAGCCCCGTGGG - Intronic
934119801 2:88828245-88828267 CAGGGCCTGAGGGGCCATGCGGG + Intergenic
934539129 2:95159794-95159816 CTGGCTCTGAAGGGCCCCGGCGG - Intronic
934732769 2:96669813-96669835 CAGGCTCTGATTGGCCAGGCGGG + Intergenic
936163274 2:110100783-110100805 CAGGGCCTGAGGGGCCATGCGGG + Intronic
938392474 2:130916426-130916448 CAGGCCCCGAGGGGCTCCCCAGG + Intronic
947720910 2:232368662-232368684 CAGGGCCACCTGGGCCCCGCGGG + Intergenic
947854582 2:233314488-233314510 CACGCCCTGGTCAGCCCCGCAGG + Intronic
948055783 2:235008356-235008378 CTGGCCCTCCTGGGCCCTGCAGG - Intronic
948574593 2:238941527-238941549 GAGGCCCAGCTGGGCCCCACAGG + Intergenic
948760814 2:240189958-240189980 CAGGCCCTGGTGGCCTCTGCAGG - Intergenic
948897210 2:240933058-240933080 CAAGCCCTGGTGGGCCTCGGTGG + Intronic
1172827502 20:37802910-37802932 CATGCCATGATTGGCCCCGAAGG + Exonic
1173945319 20:46945698-46945720 CACGCCCAGAAGGGCCCAGCAGG - Intronic
1175900478 20:62358076-62358098 CAGGCCCTGGTGGTCCCCAAAGG - Intronic
1176430784 21:6574191-6574213 CAGGCCCCGGTGGGCTGCGCGGG - Intergenic
1178695770 21:34792102-34792124 CTGGCCCGGCTGGGCCCCGCGGG - Exonic
1179514800 21:41899115-41899137 CAGGTCCTGCTGGACCCCGACGG - Exonic
1179543546 21:42099995-42100017 CAGACCCAGATGGGCCACACCGG - Intronic
1179706178 21:43181653-43181675 CAGGCCCCGGTGGGCTGCGCGGG - Intergenic
1179982078 21:44900851-44900873 CAAGGCCTGCTGGGCCCCTCAGG - Intronic
1181039275 22:20184296-20184318 CAGGCCCTTATGTACCCCACAGG + Intergenic
1181269880 22:21652732-21652754 CAGGAGCTGACGGGCCACGCAGG - Intronic
1181352455 22:22268354-22268376 CAGGCCCTGACTGGCCCCTGTGG - Intergenic
1182086487 22:27564675-27564697 CAGCCCCTGCTGGGCCAGGCTGG + Intergenic
1183589100 22:38769611-38769633 CAGGCCATGCTGGGCCTCGCAGG + Intronic
1184190904 22:42893695-42893717 CAGGCCCTGATGCGCCCCTGGGG + Intronic
1185020854 22:48374044-48374066 CATCCCCTGCTGGGCCCCCCGGG + Intergenic
1185282980 22:49983592-49983614 CAGGCCCTGGAGGGCCGGGCAGG - Intergenic
1185289766 22:50017456-50017478 CAGGGCCTGATGGGACCCACCGG + Intronic
1185367730 22:50444569-50444591 CAGGACCTGATGGGCCAGGAAGG + Intronic
951655158 3:24999019-24999041 CAGTCCCTAATGGGCCCAGCTGG + Intergenic
954387512 3:50252047-50252069 CAGGCCCAGAGGGGCTCCACAGG - Intronic
961199939 3:125037630-125037652 CAGCCACTGCTGGGCCCTGCTGG + Intronic
961485035 3:127210363-127210385 CAGACCCTGAGGAGGCCCGCAGG + Intergenic
961639472 3:128355981-128356003 CAGGCCCTGCTGGGCACCAGGGG + Intronic
962891655 3:139677770-139677792 CAGCCCCTGCTAGGCCCAGCAGG - Exonic
964793392 3:160473569-160473591 CTGGCCCTGATGCTGCCCGCAGG + Intronic
968444288 4:641580-641602 CAGGGCCTCATGGGTCCCCCAGG - Intronic
973619481 4:52712585-52712607 CAGCCCCTGATCGGACCCACGGG - Intergenic
985481079 5:111312-111334 CAGGCCCTGAGTGGCCCCAGTGG + Intergenic
986000023 5:3623074-3623096 CAGGCTCTGGTGAGCACCGCCGG + Intergenic
989097287 5:37793104-37793126 CAGCCACTCATGGGCCCAGCAGG - Intergenic
990186194 5:53212490-53212512 CAGGCTTTAATGGGCCCCGCTGG + Intergenic
997373871 5:133383214-133383236 CAGACCCTGGTGGGCTCAGCAGG + Intronic
997510106 5:134448236-134448258 CAGGCCCTGAGTGGTCCAGCAGG + Intergenic
997635062 5:135398867-135398889 CAGGCCTTGTCGGGCCGCGCGGG - Intronic
997654485 5:135545188-135545210 CAGGCCCTAATCCGCCCCGTTGG + Intergenic
998470778 5:142382223-142382245 CAGCCCCTGATGGGCCTCAGAGG - Intergenic
1002368136 5:178729301-178729323 CTGGCCCTGGTGGGCTCAGCGGG - Intronic
1002385189 5:178860747-178860769 CTGGCCCTGGTGGGCTCAGCGGG + Intronic
1002427899 5:179186571-179186593 CATGCCCAGGTGGGCCCTGCAGG - Intronic
1006052861 6:31356998-31357020 CAGGACCTGAGGAGCCGCGCCGG - Intronic
1006060381 6:31414485-31414507 CTGGGCCTGCTGGGCCCCCCAGG + Intronic
1006072824 6:31509257-31509279 CTGGGCCTGCTGGGCCCCCCAGG + Intronic
1013980511 6:116121900-116121922 CAGGCCCTGCTGGACCTCGAGGG - Exonic
1014904065 6:127004879-127004901 CAGGACCTGAAGGGGCCTGCAGG + Intergenic
1016948816 6:149560825-149560847 CATGCCCTGGTGGGCACCTCTGG - Intergenic
1017882567 6:158572095-158572117 CAGGCCCTGCTGGGGGCAGCGGG + Intronic
1018945146 6:168342736-168342758 CAGGCCCTGCTTGGCTCCCCTGG + Intergenic
1019272788 7:159870-159892 CGGACCCTCACGGGCCCCGCGGG + Intergenic
1019501500 7:1367051-1367073 CAGGCCCCGAGGGCACCCGCAGG - Intergenic
1019514487 7:1433740-1433762 CTGGCCCTGCTGGGACCCGTGGG + Intronic
1019579194 7:1751645-1751667 GAGCCCGTGATGGGGCCCGCAGG + Intergenic
1019776931 7:2917409-2917431 CAGGCCCTGCTGGGCTTGGCAGG + Intronic
1023121172 7:36910411-36910433 CAGGCTCTGATGGGTCCTGCAGG + Intronic
1024010037 7:45259416-45259438 CAGGCCCCCATGGGCGCCTCTGG + Intergenic
1024061641 7:45702999-45703021 CAGCTCCTGATGTGCCCCGCAGG - Intronic
1025025689 7:55514560-55514582 CAGGCCCTGAAGGGCACAGAAGG + Intronic
1025261695 7:57424696-57424718 CAGGCCCTCCAGGACCCCGCGGG - Intergenic
1026039982 7:66860066-66860088 CAGCCCCTGATGGGTTCTGCAGG + Intergenic
1026448698 7:70508211-70508233 CAGGCTCTAATGGGTCCCACTGG - Intronic
1029127884 7:98307660-98307682 CTGGGCGTGATGGTCCCCGCAGG - Intronic
1029222135 7:98998978-98999000 CAGGCCCTGCAGGCCCCCACAGG + Intronic
1029297894 7:99556009-99556031 CAGGTCCTGGTGGGCCCCTTTGG - Intronic
1032508860 7:132455998-132456020 CTGGCCCTGATGGGCCTGACAGG + Intronic
1034116131 7:148585576-148585598 CTGGCTCTGATTGGCCCAGCTGG + Intergenic
1035781183 8:2229384-2229406 CGGGCCCAGATGGGGCCTGCAGG - Intergenic
1037598847 8:20376603-20376625 CAGGCCATGATGGGACCAGGAGG + Intergenic
1040580782 8:48697068-48697090 CAGGCTGTGCTGGGCCACGCAGG - Intergenic
1042186278 8:66139340-66139362 AAGGCCCAGATGGACCCCCCAGG - Intronic
1047256354 8:123216238-123216260 CAGGCCATGTGGGGCCTCGCAGG + Intergenic
1048531902 8:135257288-135257310 CAGGCCCTGGTGGGATCCACTGG - Intergenic
1048614454 8:136058778-136058800 CAGCCCCATATGGGCCCCCCAGG + Intergenic
1048967540 8:139625349-139625371 CAGACCCTGACTGGCCCTGCTGG + Intronic
1049644853 8:143731656-143731678 CAGGCCCTGCAGGGCCCTGTGGG - Intronic
1055814176 9:80185554-80185576 CAGGCCCTGCCGGGCCCGGGTGG - Intergenic
1056756043 9:89382752-89382774 CTGGTCCTGTTGGGTCCCGCGGG + Intronic
1060051259 9:120379965-120379987 CAAGCCAAGATGGGCCCCCCAGG - Intergenic
1060665077 9:125427954-125427976 AAGGCTCTGAGGGACCCCGCAGG + Intergenic
1061140537 9:128763566-128763588 CAGGCGCTTATGGGCCCTGTAGG - Intronic
1061986274 9:134132035-134132057 AGGGCCCTGATGGGCCCCTGTGG + Intergenic
1062045707 9:134423557-134423579 CTGGCCATACTGGGCCCCGCCGG + Intronic
1062682208 9:137788037-137788059 GAGGGCCTGATGGCTCCCGCTGG + Intronic
1203785080 EBV:123074-123096 CAGGCCCTGATGCGCCTGGCCGG - Intergenic
1188004374 X:25007173-25007195 CAGGCCCAGCGGCGCCCCGCTGG + Exonic
1188590672 X:31830754-31830776 TAGGCCATGATGGTCCCAGCTGG + Intronic
1199851430 X:151727032-151727054 CAGGGGCTCAAGGGCCCCGCTGG + Intergenic
1200075395 X:153548148-153548170 CAGGCCCTGATGGCCACTGCCGG - Intronic