ID: 1152568387

View in Genome Browser
Species Human (GRCh38)
Location 17:81110542-81110564
Sequence CCCGGCGTGCGTCTTTGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 26}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152568383_1152568387 -10 Left 1152568383 17:81110529-81110551 CCTCCTTCCGGTTCCCGGCGTGC 0: 1
1: 0
2: 0
3: 11
4: 69
Right 1152568387 17:81110542-81110564 CCCGGCGTGCGTCTTTGCCGTGG 0: 1
1: 0
2: 0
3: 3
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152568387 Original CRISPR CCCGGCGTGCGTCTTTGCCG TGG Intronic
900102668 1:968596-968618 CCCGTCGTGTGTCTCTGCCGTGG - Intronic
1062843360 10:688005-688027 CCCGGCTTGCGTCTCGGCCCAGG - Intronic
1074767234 10:116708222-116708244 CCCGGCCTTCGTCTCTGCGGTGG - Intronic
1077471243 11:2761661-2761683 CCCGGCTTGCTCCTTTGCAGGGG - Intronic
1103847500 12:123911455-123911477 CCCGGGGGGGGTCTTTCCCGGGG + Intronic
1113902458 13:113804586-113804608 CCCGGCGTGCGTTTATACCCAGG - Intronic
1113902469 13:113804625-113804647 CCCGGCGTGCGTTTATACCCAGG - Intronic
1113902480 13:113804664-113804686 CCCGGCGTGCGTTTATACCCAGG - Intronic
1113902491 13:113804703-113804725 CCCGGCGTGCGTTTATACCCAGG - Intronic
1113902500 13:113804742-113804764 CCCGGCGTGCGTTTATACCCAGG - Intronic
1132717773 16:1300786-1300808 CCCGGTGTGCGACTCTGCAGAGG + Intergenic
1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG + Exonic
1152568387 17:81110542-81110564 CCCGGCGTGCGTCTTTGCCGTGG + Intronic
1155401583 18:25445650-25445672 CCTGGGGTAAGTCTTTGCCGTGG + Intergenic
1160222161 18:76985340-76985362 CCCGGCCTGCGCCTTTGCTGGGG + Intronic
1160839794 19:1141036-1141058 TCCGGGGTGCGTCTTCTCCGGGG - Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
1183211742 22:36455399-36455421 CCCGTCGTGAGTCTTAGCCTGGG - Intergenic
1183280665 22:36930397-36930419 CCTGGAGTGCTTCTTTGACGGGG + Exonic
953327540 3:42025267-42025289 CCCAGCGTGCCTCGTTGCCAGGG - Intronic
960622803 3:119652887-119652909 CCCGGTGTGTGTCTGTTCCGGGG + Intronic
969559769 4:7939599-7939621 CCCGGCGGGGGTCTCTGCCCCGG - Exonic
1006950664 6:37819421-37819443 CCCGGCGTGCGCCCCTCCCGAGG - Intergenic
1007115456 6:39340024-39340046 CCCGGCCTGTGTGTTTGCCTGGG + Intronic
1016400400 6:143673809-143673831 CCCTGCGTGAGTCTCTGCAGAGG - Intronic
1018447036 6:163867454-163867476 ACCGGCGTGCGTTTTTTGCGGGG + Intergenic
1018826185 6:167409428-167409450 CCCGTGGTGGGCCTTTGCCGAGG - Intergenic
1050290618 9:4150416-4150438 CCTGGCCTGCGACTTTGCCCTGG - Intronic
1054487363 9:65737964-65737986 CTCGGCCCGCGTCTATGCCGGGG + Exonic
1062019880 9:134314236-134314258 CCCGGCCTGTGCCTTTGCCAGGG - Intergenic