ID: 1152568586

View in Genome Browser
Species Human (GRCh38)
Location 17:81111376-81111398
Sequence GACAGCCTTGTGGGGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152568571_1152568586 30 Left 1152568571 17:81111323-81111345 CCTGACTCGCAGCGCCAGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 80
Right 1152568586 17:81111376-81111398 GACAGCCTTGTGGGGACTGGAGG 0: 1
1: 0
2: 3
3: 36
4: 249
1152568577_1152568586 4 Left 1152568577 17:81111349-81111371 CCTTCGGGTGTGTGTGCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1152568586 17:81111376-81111398 GACAGCCTTGTGGGGACTGGAGG 0: 1
1: 0
2: 3
3: 36
4: 249
1152568576_1152568586 16 Left 1152568576 17:81111337-81111359 CCAGCTTGGGCTCCTTCGGGTGT 0: 1
1: 0
2: 1
3: 6
4: 77
Right 1152568586 17:81111376-81111398 GACAGCCTTGTGGGGACTGGAGG 0: 1
1: 0
2: 3
3: 36
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152568586 Original CRISPR GACAGCCTTGTGGGGACTGG AGG Intronic
900212186 1:1461632-1461654 GACCCCCATGTAGGGACTGGAGG + Intronic
900212197 1:1461671-1461693 GACCCCCATGTAGGGACTGGAGG + Intronic
900224890 1:1528407-1528429 GACCCCCGTGTCGGGACTGGAGG + Intronic
900305380 1:2004063-2004085 GACAGACTTGGGGGGCCTGGAGG + Intergenic
900374931 1:2349349-2349371 GGCAGCCTTGTGGGTGCTGAGGG - Intronic
900513709 1:3071701-3071723 GTCAGCATTGTGGGGAGGGGAGG - Intronic
900531791 1:3157441-3157463 AACACCTTTGTGGGGGCTGGGGG + Intronic
900796072 1:4709203-4709225 GCCTGCCTGGTGGGGGCTGGTGG + Intronic
901405202 1:9040467-9040489 GACAGTCTTGCAGGGGCTGGAGG + Intronic
901891546 1:12270613-12270635 GACAGCCATGGGGGGAGAGGAGG - Intronic
904132946 1:28288835-28288857 GGCAGCCTTGTAGGGACAGAAGG + Intergenic
905087749 1:35398057-35398079 GACAGCCTTATGGGGTGGGGAGG + Intronic
907450545 1:54542990-54543012 CACAGCCTGGTGGGGACGGAGGG - Intronic
907461363 1:54607583-54607605 GACAGCCCTGTGTGGGCTGGAGG + Intronic
907746322 1:57217343-57217365 GTCAGCCTTATGGGGCCTGAGGG + Intronic
907937420 1:59055224-59055246 GTCAGCCATGTGAAGACTGGAGG + Intergenic
909453951 1:75829418-75829440 GACAGCTTTGAAGAGACTGGTGG + Intronic
911446806 1:98004766-98004788 GACAGATCTGTGGGGCCTGGTGG - Intergenic
912560547 1:110548388-110548410 GGCAGCTTTGTGGGCAATGGTGG + Intergenic
913113696 1:115678218-115678240 GACAGATCAGTGGGGACTGGAGG + Intronic
913333015 1:117682776-117682798 GGCAGGCTTTTGGGGGCTGGGGG + Intergenic
913609148 1:120493483-120493505 GAAAGCCTTGTGGGTTCTGCAGG - Intergenic
913709261 1:121465059-121465081 ACCAGCCTGGTGGGGAGTGGAGG + Intergenic
913986298 1:143569181-143569203 GAAAGCCTTGTGGGTTCTGCAGG + Intergenic
914204681 1:145516966-145516988 GAAAGCCTTGTGGGTTCTGCAGG + Intergenic
914370879 1:147023260-147023282 GAAAGCCTTGTGGGTTCTGCAGG - Intergenic
914483804 1:148090153-148090175 GAAAGCCTTGTGGGTTCTGCAGG + Intergenic
914582044 1:149028356-149028378 GAAAGCCTTGTGGGTTCTGCAGG + Intronic
916894837 1:169151568-169151590 GACAGCCTGGGGGGGACTAGCGG - Intronic
920304369 1:205009214-205009236 CACAGCCTAATGGGGACTGAGGG - Intronic
920362537 1:205429260-205429282 CACAGCCTTGTGGGGAGGGTGGG + Intronic
920963352 1:210682928-210682950 AGCAGCCATCTGGGGACTGGTGG - Exonic
922403132 1:225281532-225281554 GACATATTTGTGGGGAATGGGGG + Intronic
922483485 1:225955762-225955784 ATCAGCCTTGTGGGGAATGGAGG + Intergenic
1063449352 10:6140995-6141017 GTAAGTCTTGTGGGGATTGGGGG - Intergenic
1063749428 10:8926001-8926023 GAAAGGATAGTGGGGACTGGAGG - Intergenic
1064326158 10:14353552-14353574 GGCAGCCTTGTGGAGACGGAGGG - Intronic
1065507250 10:26441467-26441489 GACAGCTTTTGGGGGACTAGAGG + Intronic
1066702685 10:38146725-38146747 GTCAGCCTTGTGGAGCCTGTGGG - Intergenic
1069827742 10:71264664-71264686 TAGAGCCGTGTGTGGACTGGCGG + Intronic
1070739196 10:78891542-78891564 GACAGTCTTGTGGGCATTGGTGG + Intergenic
1071002809 10:80849994-80850016 GGCAACATTGTGGGAACTGGAGG + Intergenic
1071044749 10:81360375-81360397 GACACATTTGAGGGGACTGGAGG + Intergenic
1071224282 10:83509737-83509759 GACAGGTCAGTGGGGACTGGTGG - Intergenic
1071801734 10:89070666-89070688 GAAGGCCTTGTTGGGATTGGTGG - Intergenic
1072441822 10:95463827-95463849 CACTGCCTTGTGGGCCCTGGGGG - Intronic
1072970087 10:100009885-100009907 GACAGCGGGCTGGGGACTGGCGG - Exonic
1075716472 10:124558596-124558618 GTCAGCCCTGTGGGGGTTGGGGG + Intronic
1075774827 10:124975994-124976016 GACTGTCTTGTGGGGAGCGGAGG + Intronic
1077021515 11:419157-419179 GGGGGCCTTGTGGGGACTGTGGG + Intronic
1077320432 11:1938568-1938590 GACAGGATTGTGGGGGCTGGAGG - Exonic
1077474155 11:2778543-2778565 CAGAGCCTGGTGGGGAGTGGGGG - Intronic
1079407222 11:20157280-20157302 GAGAGCCGTGTTGGGACTGGGGG - Intronic
1081289529 11:41307563-41307585 GACACCATTGTGGGGACAGGTGG + Intronic
1083434759 11:62634709-62634731 GACAGCCAGGTAGGGCCTGGGGG - Intronic
1083651234 11:64206056-64206078 GTGAGCCTCGTGGGGACTCGGGG + Intergenic
1083756286 11:64793405-64793427 AACAGCCCTGTGGGGCCAGGGGG + Intronic
1084649297 11:70479367-70479389 GAGAGCCCAGTAGGGACTGGAGG + Intronic
1085389735 11:76176303-76176325 GACAGCCACGTGGGGAGTGTGGG + Intergenic
1085529717 11:77184164-77184186 GACAGAGTGGTGGTGACTGGTGG + Intronic
1088332267 11:108666058-108666080 GACAGACCTGTGGAGTCTGGAGG - Intronic
1088335472 11:108698942-108698964 GACAGCCATGTGGATACTTGAGG - Intronic
1089737707 11:120561490-120561512 GAGAGCCACGTGGGGACTAGGGG + Intronic
1090605666 11:128420748-128420770 TACAGCCTTGTGGGAACAGAGGG + Intergenic
1091631914 12:2168438-2168460 AACAGCCTTGTGGGAACTCCTGG - Intronic
1092237929 12:6821610-6821632 GACAGCTTTGTGGGGGGCGGGGG - Exonic
1093024295 12:14232542-14232564 GACAGCCTTCTGGGCCCTGTGGG - Intergenic
1093632543 12:21426395-21426417 GAAAGCCATGTGGAGTCTGGGGG - Intergenic
1101192714 12:102351751-102351773 GAGAACCTTGTGGTGAGTGGGGG - Intergenic
1102082065 12:110106490-110106512 CACAGCCTAGTGTGGACTCGTGG - Intergenic
1102469406 12:113151128-113151150 GGCACCCTTGTAGGCACTGGGGG - Intronic
1103527698 12:121578975-121578997 GACATTATTGTGGGGGCTGGAGG + Intronic
1103611441 12:122126589-122126611 GAATGCCTCGTGGGGGCTGGTGG + Intronic
1107253617 13:38395725-38395747 GTCTGCCTTTTGGGGACTGTAGG + Intergenic
1107994111 13:45843779-45843801 GACAGCCAGGTGGGGAGTGTGGG + Intronic
1111948008 13:94685925-94685947 GACAGCCTTGGAGTGACTGAGGG - Intergenic
1113115819 13:106873867-106873889 GGCAGCCCTGTGGGATCTGGAGG - Intergenic
1113865270 13:113517848-113517870 GACCTCCTTGTGGGGAGTGTGGG + Intronic
1114564972 14:23623998-23624020 GGCAACCTGGAGGGGACTGGTGG - Intergenic
1115734899 14:36315658-36315680 GACCTCATTGTGGGGAGTGGGGG - Intronic
1116999470 14:51357466-51357488 GACAGGCATGTGTGGACTTGTGG + Intergenic
1117225175 14:53651011-53651033 GGCACCCGTGAGGGGACTGGTGG - Intergenic
1118646217 14:67843294-67843316 GACAGCATTGTGGGGGAGGGGGG - Intronic
1119758567 14:77135627-77135649 GGCAGCCATGTGGGGGATGGAGG + Intronic
1121010548 14:90517695-90517717 CACAGCCATGTGGGGACCTGTGG + Intergenic
1121283133 14:92713784-92713806 GGCAGCCTTGTGGGGGCGGGGGG - Intronic
1121582882 14:95044314-95044336 CACAGCCCTGTGGGCACTGTGGG + Intergenic
1121632309 14:95430325-95430347 GCCAGCCTGGTGGGTCCTGGTGG - Intronic
1122419849 14:101568573-101568595 GAAAGGCTTGGGGGCACTGGGGG + Intergenic
1122575289 14:102738092-102738114 GACAGCCTGCTGGAGACAGGTGG + Intergenic
1122738397 14:103856781-103856803 GACAGCGTTGTGAGTAATGGCGG - Intergenic
1122748924 14:103918694-103918716 GACAGCCCTCTGGGGGCAGGTGG - Intronic
1123387599 15:19831151-19831173 GAGAGCCTTGTGGCGTATGGTGG - Intergenic
1124149932 15:27168334-27168356 GACTGCCTGCTGGGGAGTGGTGG - Intronic
1124563134 15:30793425-30793447 GCCAGGCTTCTGGGGACAGGGGG + Intergenic
1124960158 15:34387796-34387818 GACAGGCTTTTGGGGACAGGGGG - Intronic
1124976787 15:34534017-34534039 GACAGGCTTTTGGGGACAGGGGG - Intronic
1130863019 15:87908258-87908280 GACAGCATGGTGGGGGGTGGCGG - Intronic
1131570949 15:93535527-93535549 GCCAGCCCTGTGGGGAGGGGTGG - Intergenic
1132605054 16:790161-790183 GAGAGCCCTGTGGGGAAGGGAGG - Exonic
1132805913 16:1775087-1775109 GACAGCCAGGTGGGGCCGGGCGG - Exonic
1132944870 16:2527304-2527326 GGCAGGCTTGTGGGCACTGAGGG - Intronic
1133025491 16:2987383-2987405 GCCAGCCTGGTGGGGTCTGCAGG + Intergenic
1134624170 16:15712211-15712233 GACATCCATGTGGGAACGGGAGG + Intronic
1137666687 16:50253824-50253846 TACATGCTGGTGGGGACTGGAGG + Intronic
1137763655 16:50960878-50960900 GCTAGCCTAGTGGGGAGTGGAGG + Intergenic
1138340563 16:56286424-56286446 GACACACATGTGGGGAGTGGGGG + Intronic
1138341226 16:56290291-56290313 TACAGCCTTGTTGGGTCAGGGGG - Intronic
1142194620 16:88733722-88733744 GGCAGCCAAGTGGGGCCTGGTGG - Exonic
1144279236 17:13708108-13708130 AACAGCCTTGTGGGCCTTGGGGG + Intergenic
1144553193 17:16259719-16259741 ACCAGCATTGAGGGGACTGGTGG + Intronic
1144738511 17:17568281-17568303 GACAGGGTCGTGGGGGCTGGAGG - Intronic
1146199379 17:30843062-30843084 GAAAGCCTTTTTGGGCCTGGTGG + Intronic
1147198448 17:38783264-38783286 GACAGCCTTGTGGTGAAGGTGGG - Intronic
1147935260 17:44007255-44007277 CGCAGCCTGGTGGGGACTGCAGG - Intronic
1148201812 17:45754177-45754199 GGCAGCCTTGAGGGGAAGGGGGG - Intergenic
1151675603 17:75595847-75595869 GACAGCCAGGAGGGGGCTGGAGG + Intergenic
1152303584 17:79508940-79508962 GAGAGCCTGATGTGGACTGGGGG - Intronic
1152568586 17:81111376-81111398 GACAGCCTTGTGGGGACTGGAGG + Intronic
1152738143 17:82007517-82007539 CACAGCCTGGTGGTCACTGGGGG - Intronic
1153753328 18:8255941-8255963 GCCAGGCTTCTGGGAACTGGTGG + Intronic
1155592423 18:27442961-27442983 GACACCCTTGTGGGAAAAGGAGG + Intergenic
1156498007 18:37538511-37538533 GACAGCGTTGTGGGTGCTTGGGG - Intronic
1157247673 18:46068912-46068934 GACAGCCTTGTGTTGACAGCAGG + Intronic
1157328530 18:46686394-46686416 GGCAGCCTTGTGGGGAATGTGGG + Intronic
1157451928 18:47795472-47795494 GACTGGCTTCTGGGGAGTGGGGG - Intergenic
1159109782 18:64043014-64043036 CACAGGCTTGTGGGCACTGTGGG + Intergenic
1159480194 18:68980558-68980580 GGCAGCCTTGAGGGCACAGGTGG + Intronic
1162392053 19:10395738-10395760 GACAGGCTTGGGGGGCCGGGCGG - Intronic
1162574758 19:11492736-11492758 CACAGCCTTCTCGGCACTGGGGG - Intronic
1163174886 19:15557309-15557331 GACAGGCTTCTGGGGATTGGAGG - Intergenic
1163373386 19:16914944-16914966 GACAGCCCTGTGGGGACAGATGG - Intronic
1164922986 19:32103464-32103486 AAAAGACTTGTTGGGACTGGAGG - Intergenic
1165076002 19:33280232-33280254 GGCAGGGTTGTGAGGACTGGAGG + Intergenic
1168346211 19:55651327-55651349 GACAGCCGTGGTGGGGCTGGGGG + Exonic
926049896 2:9737828-9737850 AAGTGCCTGGTGGGGACTGGGGG - Intergenic
926055823 2:9773387-9773409 GACAGCCAAGTGGGGAGAGGTGG - Intergenic
927201818 2:20582893-20582915 GGCAGGCTTGTAGGCACTGGAGG - Intronic
927557942 2:24049425-24049447 TACAGACTTGTGGGGGGTGGGGG - Intronic
927845913 2:26472910-26472932 GACAGCCTGGGGGGGCCTGAGGG - Intronic
927885109 2:26713412-26713434 GACTGTATTGTGTGGACTGGGGG + Intronic
928397019 2:30950560-30950582 GCCAGCCCTTTGGGGACAGGGGG - Intronic
929460638 2:42100458-42100480 GACATCCTAGTGGAGACTGATGG + Intergenic
932711848 2:74071311-74071333 GACAGCCTGCTGTGGACTGAAGG - Intronic
933920344 2:87039491-87039513 AACAGGCTGTTGGGGACTGGGGG - Intergenic
933931280 2:87154295-87154317 AACAGGCTGTTGGGGACTGGGGG + Intergenic
934002653 2:87730408-87730430 AACAGGCTGTTGGGGACTGGGGG + Intergenic
934617083 2:95778877-95778899 GGCAGCCTTGTGGGAGGTGGTGG + Intergenic
934643810 2:96045682-96045704 GGCAGCCTTGTGGGAGGTGGTGG - Intergenic
934837227 2:97601776-97601798 GGCAGCCTTGTGGGAGGTGGTGG - Intergenic
936361841 2:111811136-111811158 AACAGGCTGGTGGGGACTGGGGG - Intronic
936724605 2:115298013-115298035 TTCAGCATTGTGAGGACTGGCGG - Intronic
937452152 2:122010599-122010621 CACAGCCCTGTGGGGAGTGCTGG + Intergenic
937871300 2:126788161-126788183 AACAGCCTGGTGAGGGCTGGTGG + Intergenic
941734635 2:168959797-168959819 CATTGCCTTGTGGGAACTGGGGG + Intronic
946443259 2:219714861-219714883 CAATGCCTTGTGGGGTCTGGGGG + Intergenic
946805080 2:223463581-223463603 GACCCCGTTGTGGGGTCTGGAGG - Intergenic
1172342134 20:34166815-34166837 GACAGCTTTGTGGGAATTTGTGG - Intergenic
1172801787 20:37581173-37581195 CCCAGCCTTGGGGAGACTGGGGG + Intergenic
1173733182 20:45342415-45342437 GCCAGGCCTGCGGGGACTGGCGG - Intronic
1175443694 20:59006946-59006968 GGCAGCCCTGGGGGGACGGGAGG - Intronic
1175967235 20:62665786-62665808 GACAGATTTGGGGGGACAGGTGG - Intronic
1175967247 20:62665815-62665837 GACAGGTTTGGGGGGACAGGTGG - Intronic
1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG + Intergenic
1176685288 21:9842904-9842926 GACAGTCTTGTGGGGGGTGGGGG - Intergenic
1178745821 21:35249233-35249255 AACAGGCTTGTGGGGATTGCAGG + Intronic
1179735763 21:43391016-43391038 AATGGCCTTGTGAGGACTGGAGG - Intergenic
1181604496 22:23972101-23972123 GACAGCCTGGTTGGGGCGGGCGG + Exonic
1182106050 22:27690326-27690348 AACAGCCATATGGGGACAGGAGG + Intergenic
1182614576 22:31578342-31578364 CAGAACCTTGTTGGGACTGGAGG + Intronic
1183216032 22:36480723-36480745 GACTGCATTGTGGGGTCTGCAGG + Exonic
1183361415 22:37385047-37385069 GACAGCCCTGAGGGTACTGGAGG - Intronic
1183406226 22:37631917-37631939 GCCAGCCGGGTGGGGGCTGGGGG + Intronic
1183947404 22:41334460-41334482 AACAGCCTGGCAGGGACTGGGGG - Intronic
1184856539 22:47149561-47149583 GGCAGCTTTGTGAGGACTAGTGG + Intronic
950668054 3:14509190-14509212 GAGAGCCTGGTGGGGGCTGCAGG - Intronic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
953981206 3:47414041-47414063 GACAACCTGCTGGTGACTGGCGG - Exonic
954217503 3:49132765-49132787 GAGGGCCTGGTGGGGGCTGGGGG - Intronic
954280033 3:49570724-49570746 GAGAGCCTGGTGGGGACTCTTGG + Intronic
954662958 3:52235910-52235932 TACAGCCCTGTGGGGGGTGGGGG + Intronic
958698136 3:97553322-97553344 GACAGCCTTGTGAGGACATGAGG - Intronic
961451850 3:127005751-127005773 GACAGTCTCATGGGGACTTGGGG + Intronic
961454946 3:127019380-127019402 GGCAGCCCTGGTGGGACTGGAGG + Intronic
961634179 3:128322478-128322500 GACAGCCTGGTGGGGTTTCGAGG + Intronic
962335634 3:134527745-134527767 GGCAGCCTTGGGTGGCCTGGGGG - Intronic
964203505 3:154144978-154145000 GTCATCCTTCTGGGGAGTGGTGG - Intronic
966160431 3:176961918-176961940 CACAGCCTTGTGGAGATTGGGGG - Intergenic
968941772 4:3642792-3642814 GACATCAGTGTGGGGACGGGGGG + Intergenic
970538600 4:17055348-17055370 CACAGTATGGTGGGGACTGGTGG - Intergenic
979692397 4:123573931-123573953 GACAGCCTTTTGAGGACTGGAGG - Intergenic
980911375 4:138997738-138997760 GGCAGCATTGTGGTGACTTGGGG + Intergenic
982317331 4:154045042-154045064 GAGAGCATCATGGGGACTGGGGG + Intergenic
984092734 4:175394623-175394645 GGCAGCCATGTGGGGACTAACGG + Intergenic
984122137 4:175758811-175758833 GACCGCCTCCTGGGCACTGGAGG - Intronic
985524774 5:396272-396294 GACGGCCGTGTGGGGACAGCAGG + Intronic
986799868 5:11247437-11247459 GGCCACCTTGTGGGGACTGTGGG + Intronic
988628797 5:32906794-32906816 GGCAGCCTAATGGGGAATGGTGG + Intergenic
990968089 5:61471428-61471450 GACTACCTGGTGGGCACTGGTGG + Intronic
992804104 5:80320032-80320054 GACAGCCTTGTGGGGAGGAAGGG - Exonic
994616327 5:102108369-102108391 GACAGCCATCGGGGGACTAGGGG - Intergenic
996520828 5:124423751-124423773 GACAGCCTTGAGGAGAGTAGTGG + Intergenic
997427871 5:133816583-133816605 GACACTCTAGTGGGGATTGGTGG - Intergenic
997651711 5:135526728-135526750 GACAGCCTTGTGGGTATGGGAGG - Intergenic
998376531 5:141694618-141694640 GAGAGCCTTGTGGGCAATGGTGG + Intergenic
1001416991 5:171552230-171552252 GAAAGACTTGTGGAGCCTGGTGG - Intergenic
1003749645 6:9041154-9041176 GAGAGTCTGGTGGGGACTTGGGG + Intergenic
1004529027 6:16436564-16436586 GAAAGCAATGTGGTGACTGGGGG + Intronic
1006196240 6:32244239-32244261 GACATCCTGGTGGGGAGTGGAGG - Intergenic
1006984902 6:38169668-38169690 GACAGCCTTGGGGAGGCTGAGGG + Exonic
1007749253 6:44062161-44062183 GGCAGCCTTGTGGCCACAGGTGG + Intergenic
1008610052 6:53177356-53177378 GACATTCTTATGGAGACTGGAGG - Intergenic
1010720884 6:79282168-79282190 GTCAGGCTTCTGGGGGCTGGTGG + Intergenic
1011055364 6:83198108-83198130 GATAGCTTTGTGGAGACTGTGGG - Exonic
1012912359 6:105132538-105132560 GACACTCTTGTGGGGGCTGGTGG - Intronic
1014094164 6:117441567-117441589 GACAGGCTTGTAGGGATTGAGGG + Intronic
1015946281 6:138504565-138504587 GACAGCCCTGTGGGGAAAGGTGG + Intronic
1017442358 6:154475648-154475670 GTCAGTCTTCTGGGGACAGGAGG + Intronic
1017815975 6:158016958-158016980 GACAGCTTCCTGGGGGCTGGAGG - Intronic
1019595449 7:1856368-1856390 GGCTGGCCTGTGGGGACTGGCGG - Intronic
1020043257 7:5020196-5020218 GGCAGCCTAGTGGGGGCTGGTGG + Intronic
1022246233 7:28562450-28562472 GACAGAGTTCTGGGGATTGGAGG + Intronic
1022452017 7:30524330-30524352 GCCAGGCTTCTGGGGACAGGGGG - Intronic
1022467363 7:30660803-30660825 GACAGCCTGGTGGGTAAGGGTGG - Intronic
1022491953 7:30827529-30827551 GGCATTCCTGTGGGGACTGGTGG - Intronic
1023826222 7:44011641-44011663 GGCAGCCTAGTGGGGGCTGGTGG - Intergenic
1026089802 7:67290514-67290536 GGCAGCCTAGTGGGGGCTGGTGG - Intergenic
1026724493 7:72860002-72860024 GGCAGCCTAGTGGGGGCTGGTGG + Intergenic
1026746652 7:73018343-73018365 GGCAGCCTAGCGGGGGCTGGTGG + Intergenic
1026750304 7:73046486-73046508 GGCAGCCTAGCGGGGGCTGGTGG + Intergenic
1026753951 7:73074596-73074618 GGCAGCCTAGCGGGGGCTGGTGG + Intergenic
1026757602 7:73102632-73102654 GGCAGCCTAGCGGGGGCTGGTGG + Intergenic
1027032756 7:74902901-74902923 GGCAGCCTAGCGGGGGCTGGTGG + Intergenic
1027089801 7:75290854-75290876 GGCAGCCTAGCGGGGGCTGGTGG - Intergenic
1027093446 7:75318782-75318804 GGCAGCCTAGCGGGGGCTGGTGG - Intergenic
1027097089 7:75346749-75346771 GGCAGCCTAGCGGGGGCTGGTGG - Intergenic
1027119394 7:75505826-75505848 GGCAGCCTAGTGGGGGCTGGTGG - Intergenic
1027272435 7:76529782-76529804 GGCAGCCTAGTGGGGGCTGGTGG + Intergenic
1027322258 7:77020921-77020943 GGCAGCCTAGCGGGGGCTGGTGG + Intergenic
1027325888 7:77048855-77048877 GGCAGCCTAGTGGGGGCTGGTGG + Intergenic
1029128599 7:98312872-98312894 GCCAGGCTTGTGGGTGCTGGAGG - Intronic
1029398200 7:100323750-100323772 GGCAGCCTAGCGGGGGCTGGTGG - Intergenic
1029718102 7:102344206-102344228 GGCAGCCTAGTAGGGGCTGGTGG + Intergenic
1029754513 7:102565050-102565072 GGCAGCCTAGTGGGGACTGGTGG - Intronic
1029772463 7:102664133-102664155 GGCAGCCTAGTGGGGACTGGTGG - Intronic
1031516863 7:122711571-122711593 GGAAGCTTTGTGGGGACTGCAGG - Intronic
1032238448 7:130143154-130143176 CACAGCCATGTGGATACTGGAGG - Intergenic
1034160106 7:148987600-148987622 GACAGCTCTGTGGGACCTGGAGG + Intergenic
1034550494 7:151817516-151817538 GACAGCCTTGGGAAGCCTGGGGG - Intronic
1035284286 7:157796347-157796369 GACATCCCTGTGGGGCCTTGTGG + Intronic
1036649783 8:10634894-10634916 GAGAGTCTTGGGGAGACTGGAGG - Intronic
1036684920 8:10903250-10903272 GACAGTCCTGTGGGGGCTGCAGG - Intronic
1037796227 8:21997528-21997550 GACAGGCTTGCTGGGACTTGTGG + Intronic
1039379089 8:37068031-37068053 AAATGCCTTGTTGGGACTGGAGG - Intergenic
1039786917 8:40842073-40842095 GAGGGCCTTGTGGGGCTTGGGGG - Intronic
1040446916 8:47505140-47505162 GACAGCCTTGAAGGGAGTAGTGG - Intronic
1041786886 8:61644836-61644858 GTCAGCCTTGTGGGGATGAGTGG - Intronic
1042852081 8:73226459-73226481 AACAGACTTGGTGGGACTGGAGG + Intergenic
1046050167 8:109012887-109012909 TACAGCATTCTGGGGTCTGGAGG - Intergenic
1049431690 8:142568292-142568314 GACGGCCTTGTGAGGACTCGGGG + Intergenic
1049779970 8:144424435-144424457 GACAGCTGTGTGGGAACTGAAGG + Intronic
1051943975 9:22543304-22543326 GACACTCTTGTGGATACTGGAGG + Intergenic
1052785743 9:32826651-32826673 AACAGCCTTATAGAGACTGGAGG + Intergenic
1053784025 9:41638702-41638724 GACAGTCTTGTGAGGGGTGGGGG + Intergenic
1054171982 9:61848844-61848866 GACAGTCTTGTGGGGGGTGGGGG + Intergenic
1054446842 9:65377856-65377878 GACAGTCTTGTGGGGGGTGGGGG + Intergenic
1054464455 9:65485183-65485205 AACACCCCTGTGGGGACTGCAGG + Intergenic
1054665552 9:67731967-67731989 GACAGTCTTGTGGGGGGTGGGGG - Intergenic
1056616493 9:88171737-88171759 GACAGCCTGGCTGGGCCTGGTGG + Intergenic
1057047315 9:91896325-91896347 GACAGCATTGTGGGGAAGCGGGG - Intronic
1059441185 9:114307792-114307814 GACAGCCTGGTGGGCAGTGTGGG - Intronic
1060504452 9:124187573-124187595 GTCAGCCCTGTGGGGGATGGAGG - Intergenic
1061011226 9:127955779-127955801 CAAAGCCTTGTGGAGCCTGGAGG - Intronic
1061593824 9:131615821-131615843 GACAGGGTCGTGGGGGCTGGAGG - Intronic
1062107515 9:134763998-134764020 GGCAGCGTGGTGGGGTCTGGGGG + Intronic
1062533921 9:137013385-137013407 GACAGCCTTGGTGGGCCAGGCGG - Intronic
1189302055 X:39959113-39959135 GGCAGCCTTGTTGGAACTGGTGG + Intergenic
1190120640 X:47656624-47656646 GGAAGCCATGTGGGTACTGGGGG + Intronic
1190966098 X:55303152-55303174 GACAGCTTTGAAGAGACTGGTGG - Intergenic
1193151101 X:78125377-78125399 GTCAGCCATGTGAGCACTGGGGG + Exonic
1194611659 X:96052066-96052088 TACTGCCTTTTGGGTACTGGGGG + Intergenic
1197135413 X:123054328-123054350 GACAGCCTCGTGGGGGGTGAGGG - Intergenic
1197969430 X:132099849-132099871 GACTGGCATTTGGGGACTGGAGG - Intronic
1198594532 X:138222207-138222229 GGCACTCTTGTGGGGGCTGGGGG - Intergenic
1199591199 X:149469807-149469829 GAGAGCCTTGTGAGGAGTTGGGG + Intergenic
1199673216 X:150163736-150163758 GACAGCCCTATGGGCAATGGTGG + Intergenic
1199743367 X:150756536-150756558 GCCACCCATGTGGAGACTGGGGG - Intronic
1200805441 Y:7428598-7428620 GACAGCTTTGAGGAGACTAGTGG + Intergenic
1201937693 Y:19425529-19425551 GACAGCTGTGTAGGCACTGGAGG - Intergenic