ID: 1152569187

View in Genome Browser
Species Human (GRCh38)
Location 17:81114078-81114100
Sequence CTTCAGCCCCCCATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141622
Summary {0: 1, 1: 4, 2: 301, 3: 9943, 4: 131373}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152569180_1152569187 3 Left 1152569180 17:81114052-81114074 CCTCCTGGGTTCAAGCGATCCTC 0: 592
1: 28668
2: 104549
3: 171883
4: 205632
Right 1152569187 17:81114078-81114100 CTTCAGCCCCCCATGGAGCTGGG 0: 1
1: 4
2: 301
3: 9943
4: 131373
1152569181_1152569187 0 Left 1152569181 17:81114055-81114077 CCTGGGTTCAAGCGATCCTCCCA 0: 374
1: 6655
2: 36299
3: 120770
4: 247167
Right 1152569187 17:81114078-81114100 CTTCAGCCCCCCATGGAGCTGGG 0: 1
1: 4
2: 301
3: 9943
4: 131373
1152569178_1152569187 9 Left 1152569178 17:81114046-81114068 CCTCGCCCTCCTGGGTTCAAGCG 0: 2
1: 316
2: 26426
3: 98583
4: 157825
Right 1152569187 17:81114078-81114100 CTTCAGCCCCCCATGGAGCTGGG 0: 1
1: 4
2: 301
3: 9943
4: 131373
1152569179_1152569187 4 Left 1152569179 17:81114051-81114073 CCCTCCTGGGTTCAAGCGATCCT 0: 7
1: 425
2: 1776
3: 3306
4: 5068
Right 1152569187 17:81114078-81114100 CTTCAGCCCCCCATGGAGCTGGG 0: 1
1: 4
2: 301
3: 9943
4: 131373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152569187 Original CRISPR CTTCAGCCCCCCATGGAGCT GGG Intronic
Too many off-targets to display for this crispr