ID: 1152569403

View in Genome Browser
Species Human (GRCh38)
Location 17:81115137-81115159
Sequence GCGCCCTCCCCCATATCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152569403_1152569409 -8 Left 1152569403 17:81115137-81115159 CCCGGGGATATGGGGGAGGGCGC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1152569409 17:81115152-81115174 GAGGGCGCGGCACCCCTCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1152569403_1152569415 16 Left 1152569403 17:81115137-81115159 CCCGGGGATATGGGGGAGGGCGC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1152569415 17:81115176-81115198 CAGGTGGCTGAGCCCACAGCAGG 0: 1
1: 1
2: 3
3: 42
4: 566
1152569403_1152569407 -10 Left 1152569403 17:81115137-81115159 CCCGGGGATATGGGGGAGGGCGC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1152569407 17:81115150-81115172 GGGAGGGCGCGGCACCCCTCGGG 0: 1
1: 0
2: 0
3: 20
4: 195
1152569403_1152569411 0 Left 1152569403 17:81115137-81115159 CCCGGGGATATGGGGGAGGGCGC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1152569411 17:81115160-81115182 GGCACCCCTCGGGGGACAGGTGG 0: 1
1: 0
2: 0
3: 20
4: 151
1152569403_1152569408 -9 Left 1152569403 17:81115137-81115159 CCCGGGGATATGGGGGAGGGCGC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1152569408 17:81115151-81115173 GGAGGGCGCGGCACCCCTCGGGG 0: 1
1: 0
2: 0
3: 20
4: 182
1152569403_1152569410 -3 Left 1152569403 17:81115137-81115159 CCCGGGGATATGGGGGAGGGCGC 0: 1
1: 0
2: 0
3: 13
4: 180
Right 1152569410 17:81115157-81115179 CGCGGCACCCCTCGGGGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152569403 Original CRISPR GCGCCCTCCCCCATATCCCC GGG (reversed) Intronic
902361175 1:15943371-15943393 GCCCCCTCCCCCACACCCACTGG - Intronic
902542125 1:17163001-17163023 TTGCCCTCCCCCATCTGCCCGGG + Intergenic
904611229 1:31727315-31727337 GCGCCCTCTCCCCTCTCCCGAGG - Exonic
904677093 1:32205333-32205355 CCCCCCTCCCCCATAGCACCTGG - Exonic
904724937 1:32539811-32539833 GCGCCTTCCCGCCTTTCCCCGGG - Intronic
904863606 1:33559359-33559381 GCCCCCTCAGCCATATACCCAGG + Exonic
906076945 1:43058820-43058842 GCAGCCTCTCCCATCTCCCCAGG + Intergenic
907562588 1:55404438-55404460 TCTCCCTCCCCCAGAACCCCTGG + Intergenic
910330529 1:86068290-86068312 CACCCCTCCCCCATCTCCCCTGG + Intronic
912569104 1:110608440-110608462 GGGCCCTCCCCCCTACCCTCCGG + Intronic
913449602 1:118984260-118984282 GCGCGCGCCACCACATCCCCAGG + Intronic
913968348 1:143395034-143395056 GCACACTCCCCCATTTCTCCCGG - Intergenic
914062726 1:144220630-144220652 GCACACTCCCCCATTTCTCCCGG - Intergenic
914116424 1:144745724-144745746 GCACACTCCCCCATTTCTCCCGG + Intergenic
917445036 1:175099696-175099718 GCTCCCTCCTCCCTAACCCCTGG - Intronic
917981366 1:180271685-180271707 GCGCCCCACCCCCTCTCCCCAGG - Intronic
919830988 1:201539887-201539909 GCGCCCTCCCGCCAATCTCCCGG + Intergenic
920080295 1:203368249-203368271 GCGCCTTGCCCCATTTCACCAGG - Intergenic
923062520 1:230488914-230488936 TCCCCCACTCCCATATCCCCTGG + Intergenic
923160729 1:231312495-231312517 GCTCACTCCCTCATATCCTCTGG - Intergenic
924017607 1:239744482-239744504 GGTCCCTCCCCCATAGCCACCGG - Intronic
1063606787 10:7529626-7529648 TCCCCCTCCCCCATGCCCCCAGG - Intergenic
1065488598 10:26258541-26258563 ACCCCCTCCCCACTATCCCCAGG + Intronic
1068033841 10:51735824-51735846 GCCCCCTGCCCCATATCCATGGG - Intronic
1069930542 10:71878607-71878629 GCCCCACCCCCCATGTCCCCGGG - Intergenic
1070402640 10:76066873-76066895 GCTCCCTCTCCCAGATACCCAGG - Intronic
1070832379 10:79426085-79426107 GGGGCCTCTCACATATCCCCAGG - Intronic
1073150582 10:101308763-101308785 GCCCCATCCCCCATCTCCCTGGG + Intergenic
1075393887 10:122113208-122113230 GGGCCATCCCCTATCTCCCCGGG + Intronic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1077192790 11:1262422-1262444 GCCCCCTGCCCCCTGTCCCCTGG - Intergenic
1077216684 11:1397983-1398005 GCGCCCTCCCACCTCTGCCCGGG - Intronic
1077353648 11:2104806-2104828 GAGCCCGCCCCGAAATCCCCAGG + Intergenic
1077718051 11:4600866-4600888 GGGCTCTCACCCATGTCCCCTGG - Intronic
1078093749 11:8283906-8283928 GCACCCTCCCCCACAGCCCCCGG + Intergenic
1078710866 11:13789625-13789647 TCCCCCTCCCCCATACCCCATGG - Intergenic
1086412321 11:86554988-86555010 GAGCCCTCCCCCATCCCCTCAGG - Intronic
1087368245 11:97248693-97248715 GGGTGCTCCCACATATCCCCAGG - Intergenic
1088170068 11:106986439-106986461 GCACCCTCCCTGCTATCCCCAGG - Intronic
1088923906 11:114281443-114281465 CCTCCCTCCACCATACCCCCAGG - Intronic
1090198722 11:124839257-124839279 GAGCCCTCCCCCACCTCCCCGGG + Intergenic
1090876298 11:130791620-130791642 GCCCCCTACCCCATGTTCCCAGG - Intergenic
1091305077 11:134531524-134531546 TCCCTCTCCCCCACATCCCCGGG + Intergenic
1091309428 11:134562061-134562083 GAGCCCTCCCCCAAACCCCTGGG - Intergenic
1092171170 12:6374905-6374927 GTGCCCTCTCCCATCACCCCTGG + Exonic
1096232226 12:49903048-49903070 GTACCCTCCCCCTTAGCCCCAGG + Intronic
1096309262 12:50505529-50505551 GCGCCCTCCCGCTTCTGCCCAGG + Intronic
1102145155 12:110649693-110649715 GTGCCCACCCCCACATCCCAGGG - Intronic
1103595312 12:122021721-122021743 GCGCCCTTCGCCACCTCCCCAGG + Exonic
1103779498 12:123389396-123389418 GCCCCCTCCCCCGCTTCCCCCGG + Intronic
1104329806 12:127833995-127834017 GCGCCCACCCCCAATTCCCGGGG + Intergenic
1113064642 13:106360617-106360639 GAGACCTCCTTCATATCCCCAGG + Intergenic
1113271243 13:108676905-108676927 GAGCCCTCCCCGACATCCTCAGG + Intronic
1116734116 14:48667287-48667309 TCCCCCTCCCCCAATTCCCCTGG + Intergenic
1119561838 14:75596787-75596809 CCCCCCGCCCCCACATCCCCTGG + Intronic
1119936134 14:78594000-78594022 TCTCCTTCCCCCATGTCCCCAGG + Intronic
1122209728 14:100166365-100166387 GCAGCCTCCCCCACAGCCCCGGG - Intergenic
1128147065 15:65337642-65337664 GCCCCCTCCCCCAAGTCCCTGGG - Intronic
1129738851 15:77980167-77980189 GGCCCCTTCCCCATCTCCCCTGG + Intergenic
1129847109 15:78773014-78773036 GGCCCCTTCCCCATCTCCCCTGG - Intronic
1130254793 15:82320876-82320898 GGCCCCTTCCCCATCTCCCCCGG + Intergenic
1130600180 15:85269130-85269152 GGCCCCTTCCCCATCTCCCCCGG - Intergenic
1131258671 15:90877335-90877357 GAGCCCTCCCTCAGAGCCCCAGG - Intronic
1132393328 15:101454600-101454622 CCTCCCTCCCCCACAGCCCCTGG - Intronic
1132494466 16:254727-254749 GCCCCCTCCGCCCCATCCCCTGG - Intronic
1132514119 16:358371-358393 GGGCCCTACCTCATATGCCCTGG + Intergenic
1132558327 16:582462-582484 ACCCCCTCCCCCTTACCCCCAGG + Intronic
1132618921 16:855323-855345 GCCCCCACCCCCATCTCCCCTGG + Intronic
1139359374 16:66388065-66388087 GCCCCCTCCCTCATTTCCCCAGG + Intronic
1140630670 16:76848369-76848391 GAGCCCCCCCCCAAATCCCTAGG + Intergenic
1141239419 16:82251336-82251358 TCCCCATCCCCCTTATCCCCAGG + Intergenic
1142496092 17:307037-307059 GGGGCCTCCCCCACCTCCCCAGG + Intronic
1143377069 17:6473119-6473141 CCTCCCTCCCCCATTTCCACGGG + Intronic
1143390222 17:6555830-6555852 GCCCCCTCCCCCATCGACCCTGG - Intronic
1143742701 17:8965833-8965855 GCGCCCGGCCCCACATCCTCTGG + Intergenic
1143864958 17:9917047-9917069 GGGGGCTCCCCCATATTCCCAGG - Exonic
1146175574 17:30664042-30664064 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1146349021 17:32080088-32080110 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1147138984 17:38451122-38451144 GCTCCCTCCCCCATTTCCTCTGG - Intronic
1147421568 17:40324453-40324475 GGGCCATACCCCAGATCCCCCGG - Intronic
1148028136 17:44602272-44602294 GCGCCCTCCCCCTCTGCCCCAGG - Intergenic
1149711839 17:58750482-58750504 CCTCCCTCCCCCAGAACCCCTGG + Intergenic
1150131780 17:62673263-62673285 TCGCCCTCCCCAGTATCCACAGG - Intronic
1152569403 17:81115137-81115159 GCGCCCTCCCCCATATCCCCGGG - Intronic
1152618400 17:81348442-81348464 GTCCCCACCCCCATCTCCCCAGG - Intergenic
1152636522 17:81432685-81432707 CCACCCTCCCCCGCATCCCCAGG + Intronic
1153362537 18:4213713-4213735 GGGACCTCCCCCATATCTCAAGG + Intronic
1154038779 18:10833419-10833441 GGGCCCTGCCCCAGAACCCCTGG + Intronic
1154177380 18:12094264-12094286 GGGGCTTCTCCCATATCCCCAGG - Intronic
1156488981 18:37485371-37485393 GCGCGCCCCCCCAAATCCCTGGG - Intronic
1158689255 18:59645655-59645677 GCACCCTCCCCCATATTCTAAGG + Intronic
1158759662 18:60369468-60369490 GCACCCTCCCCTATATGCCATGG - Intergenic
1160745234 19:708486-708508 GCGCCCTCCACCAGATACTCCGG + Intergenic
1161086724 19:2338871-2338893 GCCCCCTGCCCCATCTCCTCGGG - Intronic
1161811173 19:6472178-6472200 GCCCCCCCACCCATATCCCTAGG + Intronic
1162018190 19:7856832-7856854 GCGGCCTCCCCCACAGCCGCGGG + Intronic
1162725913 19:12689678-12689700 CCGCCCTCCCCCACACCACCAGG + Intronic
1162971680 19:14184329-14184351 CACCCCTCCCCCATCTCCCCTGG - Intronic
1162983388 19:14253868-14253890 GTGCCCTCCCCCATTTCCCAAGG + Intergenic
1163664761 19:18598125-18598147 GCGCCCCCTCCCCTCTCCCCAGG + Intronic
1163723054 19:18907324-18907346 GCGCCCCACCCCACATCTCCCGG - Intronic
1164697143 19:30253713-30253735 GCGCCACCCCACATGTCCCCAGG - Intronic
1166336976 19:42114171-42114193 GCCACCTCCCCCAGCTCCCCAGG - Intronic
1167579378 19:50332849-50332871 CCTCCCTCCCCCATTACCCCAGG + Intronic
1202702135 1_KI270712v1_random:172502-172524 GCACACTCCCCCATTTCTCCCGG - Intergenic
927144008 2:20149141-20149163 ACCCTCTCCCCCATCTCCCCTGG + Intergenic
929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG + Intergenic
930037139 2:47093568-47093590 GCGACCTGCCCCTTTTCCCCAGG + Intronic
931629795 2:64288557-64288579 GTGGCCTCCCCCACTTCCCCAGG + Intergenic
934173048 2:89555948-89555970 GCACACTCCCCCATTTCTCCCGG - Intergenic
934283362 2:91630305-91630327 GCACACTCCCCCATTTCTCCCGG - Intergenic
937221243 2:120344365-120344387 GTGCCCTCACCCAGCTCCCCGGG - Intergenic
938157555 2:128954583-128954605 GTGCCCTCCTCCCTCTCCCCTGG - Intergenic
940878631 2:158923317-158923339 CCCCACTCCCCCATAGCCCCAGG - Intergenic
941903179 2:170696945-170696967 GCTCGCTGCCCCACATCCCCAGG + Intergenic
948023674 2:234758370-234758392 GCTCCCTCCCTCACCTCCCCAGG + Intergenic
948947513 2:241228580-241228602 GCGCCCACCCCCAGCTCCACGGG + Exonic
1169748827 20:8970673-8970695 CCCCCCTCCCCCATAGCCACAGG + Intergenic
1171184191 20:23113174-23113196 GCCCCCTCCCCCACATTCCCAGG + Intergenic
1175985679 20:62763161-62763183 GCCCCCTCCCCCACAACCACAGG - Intergenic
1177729694 21:25012377-25012399 CCTCCCTTCCCCCTATCCCCCGG + Intergenic
1178358901 21:31931938-31931960 GCGCCCACCGCCATATACACAGG + Intronic
1180180836 21:46118067-46118089 GCACCCTCCACCACATCCCACGG - Intronic
1180914555 22:19476574-19476596 CCCCCCACCCCCATATCCACAGG + Intronic
1180968406 22:19802375-19802397 GTGCCCTCCCACACAGCCCCTGG + Intronic
1181638980 22:24187096-24187118 GTGCCCTCACCCACAGCCCCTGG + Intronic
1181644786 22:24225480-24225502 GCCCCCTCCCTCCTCTCCCCTGG + Intronic
1182266950 22:29124389-29124411 GCCCCCTCCCCCAGAAACCCTGG - Intronic
1185057102 22:48586859-48586881 GAGGCCTGCCCCATGTCCCCTGG + Intronic
950329628 3:12146019-12146041 CAGCCCTCCCCCATGTCCCAGGG - Intronic
950547941 3:13649846-13649868 GCTCCCTTCCCCCTAACCCCTGG - Intergenic
950901998 3:16506213-16506235 CCACCCTCCCCCTTATCCCATGG - Intronic
954116501 3:48469595-48469617 GGACCCTCCTCCATCTCCCCAGG + Intronic
954529545 3:51307019-51307041 GATCCCTTCCCCACATCCCCAGG + Intronic
954622773 3:52005358-52005380 CTGCCCTCCCCAATCTCCCCTGG + Intergenic
955015376 3:55064471-55064493 GCACTCTCCTCCATCTCCCCAGG - Intronic
960048335 3:113218233-113218255 GAGCCCTCCCCCACCTTCCCTGG + Intronic
964041664 3:152268745-152268767 GCGCCCTCCCGCGCTTCCCCGGG - Exonic
964600627 3:158497209-158497231 TCCCCCTCCCCCCTAGCCCCTGG + Intronic
968703824 4:2069189-2069211 GCCGCCTCCCCCTTCTCCCCTGG + Intergenic
968951004 4:3691458-3691480 GCGCCCACGGCCATATCCCAGGG + Intergenic
985636291 5:1037472-1037494 GCGCCCTCCCTGATATAACCTGG + Intronic
989435753 5:41411013-41411035 CTGCCCTCCCCCATTTGCCCAGG - Intronic
990233386 5:53739588-53739610 GCACACTCCACCATCTCCCCTGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
992553979 5:77885412-77885434 CAGCCCTCCCCCATATCATCTGG - Intergenic
998458722 5:142293790-142293812 CCCCTCTCCCCCACATCCCCAGG - Intergenic
998788803 5:145743947-145743969 GCGCCCATCTCCATAGCCCCAGG + Intronic
999177329 5:149640544-149640566 GCTGCCTCCCCCACATCCCTGGG - Intergenic
1001444186 5:171770456-171770478 GGGCCCTCCTCCATGTTCCCTGG + Intergenic
1002481740 5:179505941-179505963 GAGCCCTCTCCCACAACCCCTGG - Intergenic
1003087067 6:3068742-3068764 GCGCCCTCCCCCAGCACGCCCGG + Intronic
1007195349 6:40055628-40055650 GCCCCCCTCCCCATCTCCCCGGG - Intergenic
1007725830 6:43915074-43915096 GGGCCCTCCTCCATGTGCCCAGG - Intergenic
1007991513 6:46260808-46260830 GAGCTCTCCCACATGTCCCCAGG + Intronic
1011818912 6:91227502-91227524 CCTCCATCCCCCATCTCCCCAGG + Intergenic
1015420865 6:133006767-133006789 TCCCCCTCCCCCACAACCCCTGG - Intergenic
1016438727 6:144063364-144063386 GCGTCCCCAGCCATATCCCCGGG + Intronic
1025210298 7:57016520-57016542 GCCCCCACCCCCATGTCCCGCGG + Intergenic
1025661657 7:63560327-63560349 GCCCCCACCCCCATGTCCCGCGG - Intergenic
1026817046 7:73521635-73521657 GCGCCCCCCGCCGGATCCCCTGG + Intronic
1029086921 7:98019039-98019061 TCTCCATCCCCCTTATCCCCAGG + Intergenic
1031668216 7:124511867-124511889 CCTCCCTCCCCACTATCCCCTGG - Intergenic
1032095275 7:128935121-128935143 GCCCCTTCCCCCATTTCCCCTGG - Intergenic
1033221305 7:139527686-139527708 GTCCCCTCTCCCATACCCCCAGG - Intronic
1033600478 7:142885348-142885370 GCTCCCTTCCCCACCTCCCCAGG - Intronic
1034507543 7:151505972-151505994 ACGCCCTACCCCAGCTCCCCGGG - Intronic
1035057688 7:156046822-156046844 CCGCCCTCACCCACAGCCCCAGG - Intergenic
1037977274 8:23222771-23222793 GCCCCCTCCCACATTCCCCCAGG + Intronic
1041329891 8:56713564-56713586 GCTCCCACCCGCACATCCCCAGG + Intergenic
1041881894 8:62761330-62761352 CCGTCCTCCCCCACCTCCCCAGG - Intronic
1042212582 8:66395920-66395942 TCCCCCTCCCTCATAGCCCCTGG - Intergenic
1044068234 8:87723885-87723907 GTGACCTCCCCCATGTTCCCCGG + Intergenic
1047728117 8:127702280-127702302 TTTCCCTCCCCCATCTCCCCAGG - Intergenic
1047998780 8:130359571-130359593 GCGCCCTACCCCTCACCCCCGGG + Intronic
1049081530 8:140446939-140446961 GCACCCTCCCGCAGCTCCCCTGG + Intronic
1049361733 8:142215280-142215302 GCGCCCCCACCCTCATCCCCAGG - Intronic
1050435920 9:5610693-5610715 GCGCCCTCCCCCACAGGCCAAGG + Intergenic
1052865995 9:33465006-33465028 GGGCCCAGCCACATATCCCCAGG + Intronic
1053307281 9:36993868-36993890 CTGCCCTCTCCCATACCCCCAGG + Intronic
1056494441 9:87141947-87141969 GCTCCTTCCCCCACTTCCCCGGG - Intergenic
1056708317 9:88970103-88970125 TCACCCTCCCCCACACCCCCAGG + Intergenic
1056965568 9:91160886-91160908 TCGCCCTCCCCAGTATCCCCTGG - Intergenic
1057026508 9:91737986-91738008 CCTCCCTCCCTCATAACCCCTGG - Intronic
1061150674 9:128826347-128826369 GCCCGCCCCCCCATTTCCCCTGG - Intronic
1061799029 9:133104202-133104224 GGGCCCTCCTCCCTACCCCCAGG + Intronic
1061859474 9:133460513-133460535 GAGCCCTCCCCCCGCTCCCCAGG + Intronic
1187625282 X:21105224-21105246 ACCCCCTCCCCCAAAACCCCAGG - Intergenic
1189699307 X:43700411-43700433 ACGACCACCCCCATATCCACAGG - Intronic
1191684667 X:63878067-63878089 GCTCCCTCCCCACTAACCCCTGG - Intergenic
1191861246 X:65667961-65667983 GCGCCCTCCGCCATAGCCAAGGG + Intronic
1192395027 X:70771907-70771929 GGACCCACCCCCATAGCCCCAGG + Intronic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1199843205 X:151671671-151671693 GCGGCCTCTCCCACATCCCAAGG + Exonic