ID: 1152571600

View in Genome Browser
Species Human (GRCh38)
Location 17:81123550-81123572
Sequence CCTTTATGTGCAGGCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152571600 Original CRISPR CCTTTATGTGCAGGCTCCAC AGG (reversed) Intronic
900117476 1:1034747-1034769 CCTCTATGTGCAGGGGCCTCGGG - Intronic
900517192 1:3088147-3088169 CCTGTGTGTGCAAGCTGCACCGG - Intronic
902521801 1:17022377-17022399 GCTTTATTTGTAGGCTACACAGG - Intronic
904037431 1:27566474-27566496 CCTGTCTGTGCAGACTCCTCAGG - Intronic
906217668 1:44053277-44053299 CCCTTATGTGCAGGCTTTTCTGG + Intergenic
909818130 1:80023589-80023611 CCTACATGAGCAGGCTCTACAGG - Intergenic
912179231 1:107197636-107197658 CCTCTGTCTTCAGGCTCCACTGG + Intronic
912732855 1:112125098-112125120 CCTTTCTATGCTGCCTCCACAGG - Intergenic
917459785 1:175220046-175220068 GCTTTTCCTGCAGGCTCCACAGG - Intergenic
918244625 1:182648139-182648161 TGTGGATGTGCAGGCTCCACGGG - Exonic
919193149 1:194249038-194249060 GCTTTATGTCCTGGCTGCACGGG - Intergenic
919599994 1:199610881-199610903 CATTACTGTGTAGGCTCCACAGG + Intergenic
922598997 1:226835608-226835630 CCCATCTGTGCAGGCCCCACTGG + Intergenic
923395439 1:233557447-233557469 CCTTTATTTGCACGCTCAAGAGG + Intergenic
1067836047 10:49642454-49642476 CCATCATGTGCAGGCTCTGCAGG - Intronic
1076290309 10:129340658-129340680 CCTTGATGTGCAGACTCCCGGGG + Intergenic
1076298283 10:129404305-129404327 CCTCTATGTGCGGGCTGCACAGG - Intergenic
1076945658 10:133647803-133647825 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
1077263485 11:1636375-1636397 CCCTTAAGTGCAGGCAGCACTGG + Intergenic
1077515047 11:2996314-2996336 CGTTTTTGTGCAGCCACCACTGG + Intergenic
1077940145 11:6832156-6832178 CCTTCTTGTGAAGCCTCCACAGG + Intergenic
1077978403 11:7274204-7274226 CCTTAATGAGGGGGCTCCACTGG - Intronic
1081290456 11:41318959-41318981 CCGTTATGTTCAGGCACCAAAGG - Intronic
1082916638 11:58445002-58445024 ACTTTATGTGCTGGTTTCACTGG - Intergenic
1083815633 11:65130886-65130908 CCCTGCTGTGCAGGCTCCCCAGG + Intronic
1084494762 11:69497490-69497512 CCTTTGTGTGCAAACACCACCGG + Intergenic
1088316304 11:108510216-108510238 GATTTCTGTGCAGGCTCCAGTGG + Exonic
1088550096 11:111004017-111004039 CCTCTTTGTGCAGACCCCACTGG + Intergenic
1089749879 11:120643431-120643453 CCCTGATGTGCAGAGTCCACAGG - Intronic
1095440308 12:42232905-42232927 CCTTTATGTGTAGGCTGAAGAGG - Intronic
1099036327 12:77592030-77592052 ACTTAATGGGCAGGCACCACAGG + Intergenic
1101159584 12:101959826-101959848 CATTTATCTGAAGGCTCAACTGG + Intronic
1101323998 12:103698483-103698505 CCTGGATGGGCAGGCTCCCCGGG - Intronic
1101511581 12:105397869-105397891 CCTTTATCTGAAGGCTTGACTGG - Intergenic
1104246202 12:127043748-127043770 CCTATATGATCATGCTCCACAGG + Intergenic
1104598196 12:130134134-130134156 GCTTCTTGTGCAGGCTCCATGGG - Intergenic
1108078396 13:46706472-46706494 CTTTTATTTGCAGTCTCCCCTGG + Intronic
1112978826 13:105355755-105355777 CCATGTTGTGCAGTCTCCACAGG - Intergenic
1122597320 14:102902570-102902592 CCTGTAAGTGCAGGTCCCACGGG - Intronic
1123927684 15:25134349-25134371 CCTTTCTGTGCAGGCTTCCAGGG + Intergenic
1130798953 15:87240953-87240975 CCTCTCTGTGAAGGCTCCAGGGG - Intergenic
1131173109 15:90192199-90192221 CCTTTGGGTTCAAGCTCCACTGG + Intronic
1131771550 15:95743200-95743222 CTTTTCTGTGCACACTCCACTGG + Intergenic
1133011220 16:2912755-2912777 CCGTTATGTGCAGGCTCCATGGG - Intronic
1137617055 16:49854874-49854896 GCTTTCTGTGCTGGCTCCCCGGG - Intronic
1139409371 16:66746994-66747016 CCTGTATGTACAGACTCCAGTGG + Intronic
1142645619 17:1312361-1312383 CCTTGCTGTGGAGGCCCCACTGG + Intergenic
1143567693 17:7734480-7734502 CCTTTATCTGCCGGGTCCAGTGG - Exonic
1145720543 17:27067550-27067572 GCTTTAAGTGCAAGCTGCACTGG + Intergenic
1148025892 17:44587387-44587409 CCTTTCTGTGCACTCCCCACCGG - Intergenic
1149738100 17:59015790-59015812 CCTTTTTTTGAAGGCTCCCCAGG - Exonic
1149978912 17:61293732-61293754 CCATTATGTGCAGGATCTACTGG + Intronic
1150283096 17:63940697-63940719 ACTCTGTGTGCAGGCACCACGGG + Exonic
1152571600 17:81123550-81123572 CCTTTATGTGCAGGCTCCACAGG - Intronic
1153345255 18:4018583-4018605 CCTTTATATGCAGGTTACATGGG - Intronic
1160910373 19:1471177-1471199 CCGTAACGTGCAGGCTCCGCTGG - Exonic
1163709300 19:18836512-18836534 CCTTTCTGTCCAGCCACCACTGG - Intronic
1164829113 19:31307190-31307212 TCTATATGTGCAGACTGCACTGG + Intronic
1165969760 19:39617635-39617657 TCTTTGTGTGCAGACTCAACAGG + Intergenic
1168352129 19:55682205-55682227 CCTCTAGGTGAAGGCTACACAGG - Intronic
925912890 2:8584508-8584530 CCTTTATCTGCAGGACCCGCTGG + Intergenic
926756237 2:16238448-16238470 CCTTTATAAACAAGCTCCACAGG + Intergenic
927033023 2:19141929-19141951 CCTATCTGTGCAGCCTCCAGTGG - Intergenic
934975004 2:98795770-98795792 TTTTTATGTGCGGGTTCCACGGG - Intronic
936244831 2:110817445-110817467 CCTTCATCTGGAGGCTGCACTGG + Intronic
940751396 2:157629809-157629831 CTTTAATGTTCAGGCTCCATAGG - Intergenic
940864836 2:158807582-158807604 CCTTTATAAGCAGACTTCACTGG - Intronic
943554328 2:189383318-189383340 CCTTTGTGTGCACTCTTCACTGG + Intergenic
944325454 2:198398729-198398751 CCTTTATGTTCTGGCTCTGCTGG + Intronic
946669574 2:222088561-222088583 CCTTTATGTTCCAGCTGCACTGG - Intergenic
1169928017 20:10803225-10803247 CCTATATGGGCAGGCTTAACGGG + Intergenic
1171783650 20:29443887-29443909 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
1175757258 20:61537703-61537725 CCTTTCTGTGCAGACTCAAAAGG + Intronic
1176411147 21:6450259-6450281 CCTTTGTGTGCAGGCTGTCCTGG - Intergenic
1179450604 21:41465972-41465994 CCATTCTGTGCAGGCTGCAGTGG - Exonic
1179686640 21:43058581-43058603 CCTTTGTGTGCAGGCTGTCCTGG - Intronic
1182425101 22:30267487-30267509 TCTTTGTAGGCAGGCTCCACTGG + Intergenic
949281469 3:2352450-2352472 CGGGTAGGTGCAGGCTCCACGGG + Intronic
950623110 3:14223790-14223812 CCTTTAACTTTAGGCTCCACTGG + Intergenic
952870988 3:37901231-37901253 CCTTTCTGTGTATGCTCCAAAGG + Intronic
953272944 3:41463523-41463545 CCTACATGGGCAGGCTTCACAGG + Intronic
954885819 3:53872515-53872537 TCTTCATGTACAGGCTCCAATGG - Exonic
956367093 3:68515960-68515982 GCATTATTTGCAGGCTGCACTGG + Intronic
957081821 3:75642661-75642683 CTTTTATGAGCAGGCTGCCCTGG + Intergenic
957140757 3:76352681-76352703 CCTTTATGTGCAGTCTCCTGTGG + Intronic
961461265 3:127051857-127051879 GCTTTGAGTGCAGGCTTCACAGG + Intergenic
962352169 3:134664068-134664090 CCCCTAGGTGCAGGCTCCAGAGG - Intronic
965673495 3:171171517-171171539 CTTATATGTACAAGCTCCACTGG - Intronic
968466216 4:752696-752718 CCTGTGTGTGCAGCCTCCTCCGG + Intronic
970580758 4:17471993-17472015 CCTTCATCTGAAGGCTCGACTGG - Intronic
978065137 4:104388738-104388760 CCTTTCTGGTCAGGCTACACAGG + Intergenic
985449049 4:190048314-190048336 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
985779908 5:1865098-1865120 CCCTTATCTCCAGGATCCACAGG - Intergenic
987898765 5:23983284-23983306 CCTTTCTGTGCAGCCTCTTCTGG + Intronic
989949335 5:50279319-50279341 ACTATCTGTGCAGACTCCACAGG - Intergenic
990459290 5:56016113-56016135 CCTTTATGTGAGGCCTCCCCAGG + Intergenic
994176026 5:96712413-96712435 CCTTTATGTCCAGGCTCAAGTGG + Intronic
997836153 5:137194920-137194942 CCTGTCTGGTCAGGCTCCACAGG + Intronic
1003411999 6:5873621-5873643 CCTTTATGTGGGGCCTCCACAGG - Intergenic
1003572783 6:7267006-7267028 CATTTATCAGCAGGCTACACAGG - Intergenic
1005764630 6:28998764-28998786 CCCCTGTGTGCAGGATCCACAGG - Exonic
1007227485 6:40325293-40325315 CCTTTCTGGGGAGGCTCCTCTGG - Intergenic
1011658887 6:89577065-89577087 TCTTTATGTGCAGAATCCACAGG + Intronic
1012423875 6:99093611-99093633 CCTTTGTTTGCAGGCACCCCTGG + Intergenic
1012763654 6:103335501-103335523 CCTAGTTGTGCAGGCTACACAGG + Intergenic
1013340840 6:109213978-109214000 CACTTAGGTGCAGGCTCCCCAGG - Intergenic
1015107471 6:129553698-129553720 CCTTATTGTGCCTGCTCCACTGG - Intergenic
1018939574 6:168300171-168300193 CCTTTGTGTGAGGGCTGCACTGG - Intronic
1022712156 7:32862172-32862194 CTTTGATGTGCAAGCACCACTGG - Intergenic
1022911720 7:34905213-34905235 CTTTGATGTGCAAGCACCACTGG + Intergenic
1025115783 7:56256668-56256690 CCTTGAAATGCAGGCTCTACAGG - Intergenic
1026200230 7:68207874-68207896 CCTTGAAATGCAGGCTCTACAGG - Intergenic
1035593695 8:837272-837294 CCTTCTTCTGCAGGCTGCACAGG - Intergenic
1035649366 8:1253318-1253340 CCTTTATCTCCCGGCTCCATCGG + Intergenic
1035704817 8:1667498-1667520 CCTATAAGTACAGGCTCCATAGG - Intronic
1038119035 8:24591251-24591273 CCTTGATGTGAAGACTCCTCTGG - Intergenic
1038744236 8:30242705-30242727 CAGTTATCTGCAGGCTTCACTGG - Intergenic
1039328951 8:36515230-36515252 ACTTTCTGTGAAGGCTCCAGGGG - Intergenic
1039937124 8:42054735-42054757 CCTTTAGTTGCCAGCTCCACAGG - Intergenic
1045378039 8:101594639-101594661 CCTTTGTGTTCAGTCTCCACAGG - Intronic
1047415868 8:124663977-124663999 CCTTTGTCTGCAGACACCACTGG - Intronic
1051053162 9:12954446-12954468 CCGTTATCTGAAGGCTCAACTGG + Intergenic
1052248905 9:26373552-26373574 ATTTTATGTGCCGGCTTCACTGG - Intergenic
1053338425 9:37299985-37300007 TTTATATGTGCAGGTTCCACAGG + Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1055943697 9:81673881-81673903 CCTGTATCTGCAGGCTGCATGGG + Intronic
1056809524 9:89753560-89753582 ACCTTATGTGTAGGGTCCACTGG + Intergenic
1060434810 9:123584293-123584315 CCTTTATATGCAGTGACCACAGG - Intronic
1060851913 9:126884876-126884898 CCTTTCAGTGGAGGCTTCACAGG - Exonic
1062345003 9:136110498-136110520 CCCCCATGTGCAGCCTCCACAGG - Intergenic
1062656614 9:137606970-137606992 CCTGGGTGTGCAGGCTCCCCTGG + Intronic
1203444287 Un_GL000219v1:40844-40866 CTTTTATGAGCAGGCTGCCCTGG - Intergenic
1191109794 X:56795542-56795564 TCTTGATGTGTAGGCTGCACTGG + Intergenic
1191111323 X:56804964-56804986 CCTGGATGTGTAGGCTGCACTGG + Intergenic
1198730200 X:139720280-139720302 CCCTTTTGTGGAGACTCCACGGG - Intergenic