ID: 1152572515

View in Genome Browser
Species Human (GRCh38)
Location 17:81127017-81127039
Sequence GCAGCTCCTGCACTGAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 446}

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152572515_1152572529 11 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572529 17:81127051-81127073 GGGGTGGGGGGCAGGTCTCGGGG 0: 1
1: 1
2: 10
3: 83
4: 838
1152572515_1152572535 24 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572535 17:81127064-81127086 GGTCTCGGGGGAGGGGGAGACGG 0: 1
1: 1
2: 9
3: 111
4: 1332
1152572515_1152572522 -4 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572522 17:81127036-81127058 CTGCATATGTGGAAGGGGGTGGG 0: 1
1: 1
2: 0
3: 22
4: 254
1152572515_1152572526 3 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572526 17:81127043-81127065 TGTGGAAGGGGGTGGGGGGCAGG 0: 1
1: 0
2: 12
3: 271
4: 3090
1152572515_1152572534 18 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572534 17:81127058-81127080 GGGGCAGGTCTCGGGGGAGGGGG 0: 1
1: 0
2: 3
3: 82
4: 905
1152572515_1152572520 -8 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572520 17:81127032-81127054 GGAGCTGCATATGTGGAAGGGGG 0: 1
1: 0
2: 3
3: 18
4: 254
1152572515_1152572521 -5 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572521 17:81127035-81127057 GCTGCATATGTGGAAGGGGGTGG 0: 1
1: 0
2: 2
3: 17
4: 283
1152572515_1152572525 -1 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572525 17:81127039-81127061 CATATGTGGAAGGGGGTGGGGGG 0: 1
1: 0
2: 2
3: 47
4: 523
1152572515_1152572531 15 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572531 17:81127055-81127077 TGGGGGGCAGGTCTCGGGGGAGG 0: 1
1: 0
2: 2
3: 59
4: 535
1152572515_1152572527 9 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572527 17:81127049-81127071 AGGGGGTGGGGGGCAGGTCTCGG 0: 1
1: 0
2: 11
3: 156
4: 1408
1152572515_1152572532 16 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572532 17:81127056-81127078 GGGGGGCAGGTCTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 47
4: 664
1152572515_1152572523 -3 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572523 17:81127037-81127059 TGCATATGTGGAAGGGGGTGGGG 0: 1
1: 0
2: 0
3: 32
4: 492
1152572515_1152572528 10 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572528 17:81127050-81127072 GGGGGTGGGGGGCAGGTCTCGGG 0: 1
1: 1
2: 15
3: 156
4: 1207
1152572515_1152572536 25 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572536 17:81127065-81127087 GTCTCGGGGGAGGGGGAGACGGG 0: 1
1: 1
2: 2
3: 39
4: 468
1152572515_1152572518 -10 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572518 17:81127030-81127052 CAGGAGCTGCATATGTGGAAGGG 0: 1
1: 0
2: 0
3: 19
4: 217
1152572515_1152572524 -2 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572524 17:81127038-81127060 GCATATGTGGAAGGGGGTGGGGG 0: 1
1: 0
2: 1
3: 49
4: 553
1152572515_1152572533 17 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572533 17:81127057-81127079 GGGGGCAGGTCTCGGGGGAGGGG 0: 1
1: 0
2: 3
3: 45
4: 700
1152572515_1152572519 -9 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572519 17:81127031-81127053 AGGAGCTGCATATGTGGAAGGGG 0: 1
1: 0
2: 0
3: 22
4: 263
1152572515_1152572530 12 Left 1152572515 17:81127017-81127039 CCTCGGCTCAGTGCAGGAGCTGC 0: 1
1: 0
2: 1
3: 24
4: 446
Right 1152572530 17:81127052-81127074 GGGTGGGGGGCAGGTCTCGGGGG 0: 1
1: 1
2: 3
3: 67
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152572515 Original CRISPR GCAGCTCCTGCACTGAGCCG AGG (reversed) Intronic
901156800 1:7145649-7145671 CCAGCTCCTGCAGTGACCCCAGG - Intronic
901164136 1:7204895-7204917 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
901407610 1:9059944-9059966 GCAGCACCTGCAAGGAGCCCTGG + Intronic
901625800 1:10624359-10624381 GCAGCTCCTGGACGGAGGCGAGG - Exonic
901988357 1:13092891-13092913 GCAGACCCTGCACTGGGCCCCGG - Intergenic
901993455 1:13133876-13133898 GCAGACCCTGCACTGGGCCCCGG + Intergenic
904016553 1:27425769-27425791 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
904163919 1:28540878-28540900 GCAGTTGCTGCAGTGAGCCAAGG - Intergenic
904477212 1:30773058-30773080 GCAGCTCCTGCACTTCTCCATGG - Intergenic
904808382 1:33147393-33147415 ACAGCGCCTGCACGGAGCCCTGG - Exonic
904827154 1:33280999-33281021 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
906203265 1:43973402-43973424 GCAGGTCCTGCACTGGTCCTGGG + Intergenic
906299658 1:44672826-44672848 GCAGCACCTGCACTGTGCCAGGG + Intronic
906549186 1:46648177-46648199 GCAGGGACTGCAGTGAGCCGAGG - Intronic
908528914 1:65014750-65014772 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
908728365 1:67200458-67200480 GCAGAGCCTGCAGTGAGCCAAGG - Intronic
908855154 1:68418336-68418358 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
909841397 1:80330170-80330192 GCGGAGCCTGCAGTGAGCCGAGG + Intergenic
910454499 1:87382933-87382955 GCACCTCCTGCACAGAGTCTGGG - Intergenic
912040073 1:105378952-105378974 GCAGAACTTGCAGTGAGCCGAGG - Intergenic
913984912 1:143556098-143556120 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
915018788 1:152760679-152760701 GCGCCTCCTGCCCTGAGCTGAGG + Exonic
915129092 1:153684879-153684901 GCAGCCCCTCCTCAGAGCCGTGG - Intronic
919474457 1:198017278-198017300 GCAGCTGCTTGACTGAGCCATGG - Intergenic
919713830 1:200754648-200754670 GCAGAGCTTGCACTGAGCCGAGG - Intronic
919806919 1:201385873-201385895 GCAGCTCCTGGGGTGAGCCATGG - Intronic
922555186 1:226527429-226527451 TCAGCTCCTGCACCGAGGTGCGG + Intergenic
923658379 1:235938036-235938058 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
923926737 1:238636889-238636911 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
924711796 1:246535588-246535610 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1063803634 10:9611709-9611731 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1064122998 10:12635472-12635494 AGAGCTCCTGCACTGCGCCGTGG - Intronic
1065630128 10:27671309-27671331 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
1066288017 10:33987446-33987468 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1066385731 10:34939788-34939810 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1067656457 10:48195833-48195855 GCAGCTCCAGCACAGAACAGAGG - Intronic
1067732532 10:48822391-48822413 GCAGCTTCTGCACTTGGCTGAGG - Exonic
1067787715 10:49262763-49262785 GAAGCTGCTCCCCTGAGCCGTGG - Intergenic
1068049420 10:51930556-51930578 GCAGAAGCTGCAGTGAGCCGAGG - Intronic
1068644173 10:59446841-59446863 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1070495763 10:77020569-77020591 GCACGGCCTGCACTGAGCAGCGG + Intronic
1070541592 10:77419120-77419142 TCAGCTACTGCACTGAGGTGGGG + Intronic
1070823861 10:79379754-79379776 GCAGCTCCCGCACACAGCCCTGG - Intergenic
1071297987 10:84236226-84236248 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1072542723 10:96410529-96410551 GCAGCTCCCGCACGGGGCAGCGG + Intronic
1072693928 10:97589509-97589531 GCAGCCCTTTCACTGAGCCTGGG + Intronic
1072944350 10:99796434-99796456 GCAGATCTTGCAGTAAGCCGAGG + Intronic
1073145455 10:101278163-101278185 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1073411159 10:103342994-103343016 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1073560764 10:104494788-104494810 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1073773610 10:106762458-106762480 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1075172554 10:120128709-120128731 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1075353816 10:121752127-121752149 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1075612613 10:123865720-123865742 GCAGCTACTGCCCAGAGCTGAGG + Intronic
1076776411 10:132700337-132700359 CCAGCCCCTGCCCTGGGCCGAGG + Intronic
1076890512 10:133280972-133280994 GCAGGTGCTGGACTGAGCTGAGG + Intronic
1076890569 10:133281166-133281188 GCAGGTGCTGGACTGAGCTGAGG + Intronic
1077517708 11:3011878-3011900 GCCTCTCCTTCTCTGAGCCGAGG - Intronic
1078425291 11:11244788-11244810 GGAGCTCCTGCTCTGTGCCAGGG - Intergenic
1083106099 11:60360271-60360293 GCATCTCCTGCAGTAAGCCTGGG - Intronic
1083194987 11:61080610-61080632 CCAGCTCCTGCAATGAGGTGAGG - Intergenic
1083299047 11:61730738-61730760 GCAGCCCCTGCCCGGAGCCCTGG + Intronic
1083443502 11:62691982-62692004 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1083510241 11:63202561-63202583 GCAGCTTAGGCACTGAGCCGTGG - Intronic
1083758527 11:64803682-64803704 GGAGGTCCTGCTCTGATCCGGGG + Exonic
1084147439 11:67272578-67272600 GCAGCTGCAGCACTGAGCACTGG - Intronic
1085240827 11:75053761-75053783 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1085257194 11:75181827-75181849 GCAATCCCTGCACTGAGCAGAGG + Intronic
1085523227 11:77150172-77150194 CCAGCTCCTCCCCTGAGACGGGG - Intronic
1085882647 11:80485881-80485903 TGAGCTCCTGCAAAGAGCCGTGG - Intergenic
1086498757 11:87430919-87430941 GCAGCTCCAGCACAGCACCGTGG - Intergenic
1087471702 11:98583838-98583860 GCAGCGGTTGCAGTGAGCCGAGG - Intergenic
1087636046 11:100702737-100702759 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1087987175 11:104697201-104697223 GCAACTCCTCCACCGAGCAGTGG + Intergenic
1087987278 11:104698350-104698372 GCAACTCCTCCACCGAGCAGTGG - Intergenic
1088876708 11:113942206-113942228 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1089144144 11:116312126-116312148 CCGGCTCCTTCACTGGGCCGTGG + Intergenic
1089246039 11:117120733-117120755 GCAGAGGTTGCACTGAGCCGAGG + Intergenic
1089277313 11:117346350-117346372 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1089973069 11:122710086-122710108 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1090657494 11:128857114-128857136 GCAGCTCCTGCCCTGGGCTTCGG + Intronic
1090782169 11:130016928-130016950 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1091180060 11:133596288-133596310 GCAGCTCCTGCTCAGAGTGGGGG - Intergenic
1091219609 11:133922312-133922334 GCAGCTCCTTCCCTGTGCGGTGG - Intronic
1091544075 12:1488915-1488937 GCAGCTCCTGCTCGCAGCCCAGG - Intronic
1091860201 12:3774417-3774439 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1091983578 12:4887107-4887129 GCGGAGCCTGCAGTGAGCCGAGG + Intergenic
1092285247 12:7124842-7124864 GCAGCCCCTCCACTGAGCGAGGG + Intronic
1092541447 12:9421851-9421873 GCAGCTGCTGGCCTGTGCCGGGG - Intergenic
1092563546 12:9641672-9641694 GCAGCTGCAGGACTGAGCAGAGG - Intergenic
1094511596 12:31100652-31100674 GCAGCTGCTGGCCTGTGCCGGGG + Exonic
1094537404 12:31334434-31334456 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1094819169 12:34211408-34211430 GCAGCCCCTGCGCTGGGCCCGGG - Intergenic
1094819245 12:34211700-34211722 GCAGCGCCTGCGCTGGGCCTGGG - Intergenic
1094830513 12:34298051-34298073 GCAGCCCCTGCACTGGGCCCTGG + Intergenic
1094833088 12:34309352-34309374 GCATCCCCTGCACTGGGCCCCGG + Intergenic
1094833365 12:34310944-34310966 GCAGCTCCTGCACGGGTCCCGGG + Intergenic
1095097024 12:38154401-38154423 TCAGCCCCTGCACTGGGCCCGGG + Intergenic
1095097492 12:38156239-38156261 GCAGCCCCTGCACTGTTCCCGGG + Intergenic
1095803673 12:46294951-46294973 GCAGAGGTTGCACTGAGCCGAGG + Intergenic
1096131904 12:49166074-49166096 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
1096549213 12:52361111-52361133 GCAGCTCCTGCAGTGCCCTGGGG - Intronic
1096654305 12:53079146-53079168 CCAGGCCCTGCACTGGGCCGAGG + Intronic
1097003468 12:55898049-55898071 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
1097018224 12:56002224-56002246 GCTGCTGCTGCACAGAGCTGTGG + Exonic
1098222454 12:68284742-68284764 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1099533975 12:83823435-83823457 GCATCTCCTGCCATGAGCCTGGG - Intergenic
1100542199 12:95568033-95568055 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1101936394 12:109061474-109061496 GCAGATGCTGCAGTGAGCTGAGG - Intronic
1102168154 12:110822366-110822388 GCAGATTCTGCCCTGAGCAGAGG + Intergenic
1102238042 12:111307022-111307044 CCAGCTCCTGCAGTGAGCTCTGG - Exonic
1102419111 12:112790122-112790144 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1103487159 12:121290885-121290907 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1103550495 12:121733605-121733627 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1104325454 12:127792135-127792157 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
1104407821 12:128533127-128533149 ACAGCTTCTGCACTGAGAAGAGG - Intronic
1105303240 13:19153170-19153192 GCAGCTCCTCGACTGCACCGTGG - Intergenic
1106142145 13:27020377-27020399 GCTTGCCCTGCACTGAGCCGTGG - Intergenic
1106269128 13:28137706-28137728 ACAGGTGCTGCACTGAGCAGGGG + Intergenic
1108944410 13:56003109-56003131 GCAGCCACTGCACAGAGCAGGGG + Intergenic
1109866610 13:68272771-68272793 GCATCTCCTGCAGTGAACCTAGG - Intergenic
1111474588 13:88727567-88727589 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1113816134 13:113172563-113172585 GCTGCTTCTGCACTGAGCCATGG - Intergenic
1114075485 14:19159175-19159197 GCAGCCCCTGCGCTGGGCCCCGG + Intergenic
1114531378 14:23398697-23398719 GCAGCCCCTGCACTGGGCCAGGG - Intronic
1114665352 14:24374327-24374349 GCAGCTCCTGGGCTGAGCGCTGG - Exonic
1114746056 14:25148623-25148645 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1115798074 14:36961277-36961299 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1116526150 14:45908383-45908405 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1117694350 14:58343760-58343782 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1119135451 14:72214242-72214264 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1119241602 14:73065016-73065038 GCAGATGTTGCAGTGAGCCGAGG - Intronic
1121023292 14:90595263-90595285 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1121333759 14:93064213-93064235 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1121495714 14:94390289-94390311 ACAGCTCCAGCACTGGGCTGTGG + Intronic
1121873039 14:97426718-97426740 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1122778490 14:104133688-104133710 GGAGGCCCTGCCCTGAGCCGGGG + Intergenic
1123017859 14:105384141-105384163 GGAGCTCCAGCCCTGAGCTGAGG - Intronic
1202898314 14_GL000194v1_random:22399-22421 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1123450202 15:20355063-20355085 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
1123710785 15:22986064-22986086 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1123830293 15:24129055-24129077 GCGGAGCCTGCAGTGAGCCGAGG + Intergenic
1123939890 15:25211717-25211739 TGATCTCCTGCACTGAGCTGTGG + Intergenic
1123940745 15:25215464-25215486 TTGGCTCCTGCACTGAGCTGTGG + Intergenic
1123941832 15:25220418-25220440 TCGGCTCCCGCACTGAGCCAGGG + Intergenic
1123943311 15:25227028-25227050 TCGGCTCCTGCACTGAGCTCTGG + Intergenic
1123945717 15:25237911-25237933 TCAGCTCCTGCACTGAGCTGGGG + Intergenic
1125880004 15:43185555-43185577 GCAGCTCCGGCACTTGGCGGAGG + Exonic
1126018716 15:44378114-44378136 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1126039893 15:44579457-44579479 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1126621503 15:50644967-50644989 GCAGAGGCTGCAGTGAGCCGTGG - Intronic
1126817481 15:52468232-52468254 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1127273709 15:57423921-57423943 GGAGCTCCAGCACCGAGCTGCGG - Intronic
1127415371 15:58752070-58752092 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1127656564 15:61061283-61061305 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1129755108 15:78093272-78093294 ACAGCACCTGCACAGAGCCAGGG + Intronic
1132048310 15:98585069-98585091 GCAGGGCTTGCAGTGAGCCGAGG - Intergenic
1132175403 15:99710308-99710330 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1132646256 16:1000622-1000644 ACAGCCACTGCACAGAGCCGGGG - Intergenic
1132703803 16:1232583-1232605 GCATCTCCGGCACTCGGCCGAGG - Intergenic
1132707715 16:1253812-1253834 GCATCTCCGGCACTCGGCCGAGG + Intergenic
1132965079 16:2648934-2648956 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1133072826 16:3257678-3257700 GCAGATGTTGCAGTGAGCCGAGG + Intergenic
1133320603 16:4911041-4911063 GCAGCTCCTGCTCAGAGCGTGGG - Intronic
1133332388 16:4982547-4982569 GCAGCCCCAGCACAGAGCCTGGG + Intronic
1134878682 16:17725411-17725433 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1134912576 16:18041006-18041028 GCAGATCTTGCAGCGAGCCGAGG + Intergenic
1135675855 16:24414333-24414355 GCAGATGCTGCAGTGAGCCGAGG - Intergenic
1135787976 16:25367425-25367447 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1136186400 16:28591182-28591204 GAAGCTCCTGCCCTGAGCCCTGG + Intronic
1136522104 16:30803718-30803740 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1137724889 16:50650533-50650555 GCTGCTCCTGGCCTGAGCCTGGG + Intergenic
1138340210 16:56284294-56284316 GCTGATGCTGCACTGAGCCCTGG - Intronic
1139308458 16:66007986-66008008 CCAGCCCCTACCCTGAGCCGAGG + Intergenic
1139389391 16:66596604-66596626 GCAGAGGTTGCACTGAGCCGAGG + Intergenic
1140550650 16:75862175-75862197 GGAGCTGCTGCACTGAGAGGAGG - Intergenic
1141518563 16:84562661-84562683 GCAGCTCCTGCCCTGAGGATGGG - Intergenic
1142853688 17:2717984-2718006 GCAGAGGCTGCAGTGAGCCGGGG - Intergenic
1142981218 17:3673112-3673134 GCAGAAGCTGCAATGAGCCGAGG + Intronic
1143573788 17:7777865-7777887 GCAGCTGCTGCATTGGGTCGGGG + Intronic
1143776913 17:9205642-9205664 GCAGCTCCTGCATTGCGATGGGG + Intronic
1144852731 17:18252163-18252185 GCAGAGCCGGCACTGAGCCTGGG + Intronic
1146274103 17:31504196-31504218 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1147030140 17:37627268-37627290 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1147112085 17:38270577-38270599 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1147294854 17:39473987-39474009 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1147677593 17:42218775-42218797 GCATCTCCTCCACTGGGCCGGGG + Exonic
1147688446 17:42300796-42300818 GCATCTCCTCCACTGGGCCGGGG - Exonic
1147915362 17:43882355-43882377 GGAGCTCCTGCAGTGCGCGGGGG + Exonic
1148417487 17:47518224-47518246 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1148753555 17:49960111-49960133 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1151715780 17:75830410-75830432 GCAGCTTCTGCTCAGAGGCGCGG + Exonic
1152217989 17:79045532-79045554 GCACCTCCAGAACTGAGCCCAGG - Intronic
1152224678 17:79087230-79087252 GCAGCTCCTGCACTCAGGCTGGG - Intronic
1152572515 17:81127017-81127039 GCAGCTCCTGCACTGAGCCGAGG - Intronic
1152895396 17:82907939-82907961 GCAGGTCCCCCACTGAGCCCAGG - Intronic
1153123771 18:1764730-1764752 TCACCTCCTGCTCTGAGCCCTGG + Intergenic
1154132895 18:11751657-11751679 GCAGCCCCTCCGCTGCGCCGCGG - Intronic
1154408328 18:14118124-14118146 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1156236678 18:35212231-35212253 GCGGAGCCTGCAGTGAGCCGAGG - Intergenic
1156642258 18:39116468-39116490 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1157291716 18:46414341-46414363 GCAGCACCTACACAGAGCCCTGG - Intronic
1157483046 18:48068204-48068226 GCGGAGCCTGCAGTGAGCCGAGG - Intronic
1160039087 18:75328990-75329012 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1160510645 18:79451677-79451699 GCAGCTCCTGAGCTGAGCGCTGG - Exonic
1162081566 19:8220887-8220909 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1162164197 19:8741096-8741118 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1162165269 19:8748565-8748587 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1162166334 19:8756019-8756041 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1162167400 19:8763475-8763497 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1162168341 19:8769775-8769797 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1162169407 19:8777228-8777250 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1162170088 19:8782540-8782562 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1162297613 19:9824217-9824239 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1162954284 19:14089910-14089932 GCAGCCCCTGCACGCGGCCGCGG + Exonic
1162959655 19:14118205-14118227 GCCGCTGCCGCACTGAGCGGGGG - Intergenic
1163569789 19:18074353-18074375 ACAGCTGCTGCCCTGAGCCTGGG - Intronic
1165023879 19:32945402-32945424 GCAGCTCCTGCAGTGATGCCTGG - Intronic
1166100015 19:40566152-40566174 GCACCTCCAGCACTGAGGAGGGG - Exonic
1166957769 19:46476945-46476967 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1167208398 19:48117775-48117797 CCAGCGCCTGCAGTGAGCAGAGG + Exonic
1167529501 19:50006441-50006463 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1168100956 19:54140662-54140684 GCAGCTCCTCCACAGAGAAGGGG - Intronic
1168162850 19:54523623-54523645 GCAGATCCTGGAATGAGCCCAGG + Intergenic
1168514314 19:56998268-56998290 GCAGGCCCTGCACTGAGTCCGGG - Intergenic
1202647933 1_KI270706v1_random:158307-158329 TCAGCCCCTGCACTGGGCCCCGG + Intergenic
925792864 2:7510606-7510628 GTGGCTCCTGCAGTGTGCCGTGG + Intergenic
926162602 2:10499405-10499427 GCTGGTCCTGCACTGTGCGGGGG + Intergenic
928146723 2:28785140-28785162 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
928217611 2:29375384-29375406 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
928485337 2:31725190-31725212 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
930861485 2:56078830-56078852 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
930978772 2:57496651-57496673 GCGGAGCTTGCACTGAGCCGAGG - Intergenic
931113357 2:59137425-59137447 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
931678059 2:64717689-64717711 GCAGAGCATGCAGTGAGCCGAGG + Intronic
933303518 2:80569708-80569730 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
933494865 2:83037508-83037530 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
935489080 2:103695170-103695192 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
935699229 2:105796570-105796592 GCAGCGTCTGGACTGAGCCTGGG + Intronic
936410680 2:112255183-112255205 GCGGCGCCTGCGCAGAGCCGAGG - Intergenic
936434527 2:112492660-112492682 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
936744638 2:115560301-115560323 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
936999094 2:118446883-118446905 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
937368377 2:121281313-121281335 GGGGCTCCTGCACAGAGCCAGGG + Intronic
937429462 2:121826151-121826173 GCAGCTCCTGCTCAGAGTCTGGG - Intergenic
937545423 2:123011623-123011645 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
937967266 2:127523140-127523162 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
937974841 2:127576453-127576475 GCAGCTCTGGCACTGACCCAGGG - Intronic
938307971 2:130267551-130267573 GAAGCTACTGCTCTGAGCCTGGG - Intergenic
938422407 2:131155463-131155485 GCAGCTCCGGCCCTGAGCATAGG + Intronic
938489828 2:131755640-131755662 TCAGCCCCTGCACTGGGCCCCGG + Intronic
939985876 2:148829532-148829554 TGAGCTCCTGCCCTGAGCCCTGG - Intergenic
941585751 2:167356135-167356157 GCAGTTCCTGCAGTGAGCAGGGG - Intergenic
941701636 2:168610043-168610065 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
942039159 2:172040812-172040834 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
943583011 2:189706316-189706338 GCAGAGCCTGCAATGAGCTGAGG + Intronic
943950001 2:194121339-194121361 ACAGCTCCTGCAGTGTGCTGCGG - Intergenic
944048199 2:195437792-195437814 CCAGCTCCTGCACCCAGCGGAGG + Intergenic
944486139 2:200207817-200207839 GCAGCGGTTGCAGTGAGCCGAGG - Intergenic
944731050 2:202517878-202517900 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
945955368 2:216081712-216081734 GTAGCTCCTGCCCTTAGCCCAGG + Exonic
946711000 2:222505202-222505224 CCAGCTCTTGCAATAAGCCGAGG - Intronic
946950888 2:224873511-224873533 GCTGCGGCTGCACTGAGCTGAGG + Intronic
947706968 2:232284116-232284138 GCAGCCCCTGAACTGAGACCTGG - Intronic
948566463 2:238890285-238890307 GCCGGTCCTGCACAGAGCAGCGG - Intronic
948595945 2:239079376-239079398 GCTGCTCCGGCAGTGAGCCCGGG - Intronic
1168795660 20:608968-608990 GCAGCTCCTGCAATGTGTCCTGG - Intronic
1168888344 20:1276011-1276033 ACAGCTCCTTCACAGAGCCCAGG + Intronic
1168966422 20:1901236-1901258 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1169378724 20:5088239-5088261 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1170886196 20:20341827-20341849 CCAGCTACTTCACCGAGCCGTGG + Exonic
1171216123 20:23353550-23353572 GCAGGTGTTGCAGTGAGCCGAGG + Intronic
1172615742 20:36282586-36282608 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1172633577 20:36394507-36394529 GTGGCTTCTGCAGTGAGCCGGGG + Intronic
1172952339 20:38730175-38730197 GCAGCACCTGCACTGACTCCAGG + Intergenic
1173353349 20:42264718-42264740 CCAGCTCCTGCAGTGACCCAAGG - Intronic
1174600570 20:51721095-51721117 GCAGCTCTTGCCCTGAGAAGAGG - Intronic
1174824174 20:53754510-53754532 GCAGCTCCTGCCCTGGGCTGTGG - Intergenic
1175762662 20:61571886-61571908 GCATGTACTGCACAGAGCCGAGG - Intronic
1176003289 20:62844476-62844498 GCTGAGCCTGCAGTGAGCCGTGG - Intronic
1176121100 20:63454945-63454967 GCCCCTCCTGCACTAAGCTGGGG + Intronic
1176603916 21:8814422-8814444 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1176618001 21:9038392-9038414 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1179154480 21:38838231-38838253 ACAGCTCCAGCAATGCGCCGTGG - Intergenic
1180111480 21:45656887-45656909 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1180346200 22:11705999-11706021 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1180918457 22:19505910-19505932 GCAGCTGCTGTACTGAGCACAGG + Intronic
1181566101 22:23739341-23739363 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1183034368 22:35129971-35129993 GCAGATGTTGCAGTGAGCCGAGG - Intergenic
1183361474 22:37385353-37385375 GCAGCTCTTGAACGGAGCCTGGG - Intronic
1183502174 22:38187233-38187255 GCAGAGACTGCAGTGAGCCGAGG + Intronic
1183719569 22:39554613-39554635 GAAGCTCCTGCAGTCAGCCAGGG + Intergenic
1185177085 22:49334115-49334137 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
949754505 3:7393190-7393212 GCAGTTGCTGCACTGCCCCGAGG - Intronic
950263966 3:11561393-11561415 GCATCTCCTGACCTGAGCTGGGG + Intronic
950281488 3:11711497-11711519 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
950521537 3:13500650-13500672 GGAGCTCCTGGACTGAGCCTGGG + Intronic
950664718 3:14488280-14488302 GCAGCTCCTTCACTGCCCCCTGG + Exonic
950827246 3:15837030-15837052 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
951650480 3:24946194-24946216 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
951955108 3:28244656-28244678 GCAGCGGTTGCAGTGAGCCGAGG + Intronic
952853033 3:37744540-37744562 GCTGCTCCCTCACTGAGCCATGG + Intronic
952979888 3:38726304-38726326 GCATCTCATGCACAGAGCCTGGG + Intronic
954057603 3:48040629-48040651 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
954147426 3:48641258-48641280 GCTGCTCATGCCCTGAGCCAAGG - Intronic
954357452 3:50094222-50094244 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
954419779 3:50412652-50412674 GCAGCTGCTGCTCTGAGGAGTGG + Intronic
955332190 3:58056667-58056689 GCGGCGACTGCAGTGAGCCGAGG - Intronic
956224128 3:66936648-66936670 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
957839043 3:85641861-85641883 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
958839152 3:99182727-99182749 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
959856097 3:111160937-111160959 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
959934281 3:112013283-112013305 GCAGGTCCTACCCTGAGCTGTGG - Intronic
962859712 3:139388691-139388713 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
963057005 3:141194105-141194127 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
964011474 3:151897349-151897371 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
964350085 3:155794049-155794071 GCAGCTGCTGCAGTGAGCTGAGG - Intronic
964518160 3:157534875-157534897 GCAGCTCCTGCACCATGCTGGGG + Intergenic
964987727 3:162765693-162765715 GCATCTCCTGCAGTGAACCTGGG - Intergenic
965695694 3:171406292-171406314 GTAGCTCCTGCAATGTGCCATGG - Intronic
967204874 3:187110375-187110397 GCACCTCCTGCTCTCAGCTGGGG + Intergenic
967848325 3:194062504-194062526 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
968135304 3:196216305-196216327 GAAGCCCCTGCCCTGGGCCGGGG - Intronic
968518057 4:1023130-1023152 GCCGCTCCTTCACTGAGCCCAGG - Intronic
968844634 4:3033652-3033674 GCAGATGCTGCAGTGAGCTGAGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969388597 4:6873979-6874001 GCAGTTGCTGCTCTGAGCCAGGG + Intronic
969963748 4:10973379-10973401 ACAGTCCCTGCACTGAGCCTGGG - Intergenic
974069089 4:57108391-57108413 GCAGCTCCTGATCTTAGCCAAGG - Intronic
976399335 4:84589876-84589898 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
980687822 4:136253463-136253485 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
981315569 4:143336852-143336874 GAAGCTCCGGCACCGAGTCGGGG + Exonic
984064577 4:175032690-175032712 GCACCTCCTGTAGTGAGCCTGGG - Intergenic
984269981 4:177537825-177537847 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
984406922 4:179344376-179344398 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
984425898 4:179585429-179585451 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
984477706 4:180258048-180258070 GCAGGTGTTGCAGTGAGCCGAGG + Intergenic
985132812 4:186756365-186756387 GAGGCTCCTCCACTGAGCAGAGG - Intergenic
986238517 5:5935213-5935235 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
987063217 5:14262391-14262413 GCAGTTCCTGGAGTGAGCCTGGG + Intronic
987897964 5:23972676-23972698 GCAGACCTTGCAGTGAGCCGAGG + Intronic
988051798 5:26041176-26041198 GCAGCTGCTGCACTGCCCCAAGG + Intergenic
990941674 5:61208298-61208320 GCAGCTTCAGCACAGAGCCATGG - Intergenic
991564515 5:67991025-67991047 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
992452770 5:76888441-76888463 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
992683823 5:79180282-79180304 GCAGGGCTTGCAGTGAGCCGAGG + Intronic
996195823 5:120605871-120605893 GCACCTCCTGCACTTAGTAGGGG + Intronic
996482552 5:123991131-123991153 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
996831388 5:127744024-127744046 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
997414628 5:133715955-133715977 TCTGCTCCTTCACTCAGCCGAGG - Intergenic
998092846 5:139381116-139381138 CCAGCTCCTGCACTGTGAGGAGG + Intronic
998546509 5:143032479-143032501 TCAGCTCTTTCACTGAGCCAAGG - Intronic
999106497 5:149075556-149075578 GAAGCTCCTGCACTAAACAGAGG - Intergenic
999194570 5:149773433-149773455 GCGGCTCCTGCTCTGCCCCGTGG + Intronic
1001332559 5:170772597-170772619 GCAGGTCCTGCCCTGTGCCATGG - Intronic
1001468705 5:171992357-171992379 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1004481589 6:16024446-16024468 GCAGAGATTGCACTGAGCCGAGG + Intergenic
1004700725 6:18077141-18077163 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1004952786 6:20693060-20693082 GCAGAGCTTGCAGTGAGCCGAGG + Intronic
1005992531 6:30912317-30912339 GCAGCTCCGACTCTGAGCCAGGG - Exonic
1006167579 6:32074082-32074104 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1006170153 6:32087761-32087783 CCAGGTCCTGCACCGTGCCGCGG + Intronic
1006229581 6:32571824-32571846 GCAGAGGCTGCAGTGAGCCGTGG + Intronic
1006320375 6:33316219-33316241 GCAGCTTCTGCAGTGGGCAGTGG - Exonic
1006579830 6:35070555-35070577 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1007582999 6:42970277-42970299 GCTGCTGCTGCACTAAGCAGTGG + Intronic
1008540044 6:52538425-52538447 CCAGCTCCTGCCCTGAGGAGAGG - Intronic
1009058615 6:58370182-58370204 GCAGAGGCTGCAGTGAGCCGAGG + Intergenic
1009232222 6:61076937-61076959 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1011678191 6:89756851-89756873 GCAGAGCCTGCTGTGAGCCGAGG + Intronic
1011822893 6:91273608-91273630 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1013264167 6:108478367-108478389 GCGGAGCCTGCATTGAGCCGAGG + Intronic
1015560087 6:134504675-134504697 GCAGAGCCTGCAGTGAGCCCTGG + Intergenic
1016590110 6:145735154-145735176 GGAGCTCCCGCTCTGCGCCGGGG + Intronic
1016993609 6:149945871-149945893 GCAGACGCTGCAGTGAGCCGAGG + Intronic
1017004724 6:150021661-150021683 GCAGACGCTGCAGTGAGCCGAGG - Intronic
1018226742 6:161636247-161636269 GCACATCCTGCACAGAGCTGTGG - Intronic
1018811141 6:167299315-167299337 CCAACTCCTGCACTCTGCCGGGG + Intronic
1018992572 6:168685257-168685279 CCAGTATCTGCACTGAGCCGGGG + Intergenic
1019410495 7:904610-904632 GAAGCACCCGCCCTGAGCCGTGG - Intronic
1019465185 7:1184186-1184208 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1019681192 7:2350712-2350734 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1020200412 7:6075498-6075520 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1020257475 7:6510213-6510235 GCAGCTCCAGGGCTGAGCCTGGG + Intronic
1020275443 7:6621975-6621997 CCAGCTCCTGCTCTGACCCCAGG - Exonic
1023462569 7:40414975-40414997 GCGGATGTTGCACTGAGCCGAGG + Intronic
1024645993 7:51370940-51370962 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1025758690 7:64370344-64370366 GCAGAACTTGCAGTGAGCCGAGG - Intergenic
1026858669 7:73770703-73770725 GCGGCTCCTGCAAACAGCCGCGG - Intergenic
1026898704 7:74025654-74025676 GGAGCTCCTGCAATGAGCAGAGG + Intergenic
1027129679 7:75582048-75582070 GTGGCTCCTGCCCTGAGCCCAGG - Intronic
1027213576 7:76169154-76169176 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1027219538 7:76205061-76205083 GCAACTCCTTCACTGAGCCAAGG + Intronic
1027385964 7:77660038-77660060 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1027586308 7:80062994-80063016 GCAGAGCCTGCAGTGAGCCGAGG - Intergenic
1028999527 7:97138868-97138890 GCGCCTCCTGCAGTGAGCCTGGG - Intronic
1029870791 7:103690679-103690701 GCAGCTCATGCACTCAGCAAAGG - Intronic
1030358560 7:108570063-108570085 GCTGCTCCTCCACAGAGCTGAGG - Exonic
1031373241 7:120993790-120993812 CCAGCACCTGTACTGAGACGTGG - Intronic
1032795199 7:135270813-135270835 GCTGCTCCTGCAGTGGGCAGAGG - Intergenic
1033477163 7:141702108-141702130 GCCGCTGCTGCGCTGGGCCGAGG - Exonic
1033540166 7:142349220-142349242 GCAGTTCCTGCCATGAGCCTCGG + Intergenic
1033555799 7:142487851-142487873 GCAGCCCCTGCCATGAGCCTCGG + Intergenic
1033558178 7:142507370-142507392 GCAGCCCCTGCCATGAGCCTCGG + Intergenic
1034269628 7:149797320-149797342 GCAGCTGCTGCACTGGCCCAGGG + Intergenic
1034522899 7:151633995-151634017 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1035714948 8:1746981-1747003 GGAGCTCCACCACCGAGCCGAGG + Intergenic
1036082079 8:5568067-5568089 GCATCTCCTCCAGTGAGCCCAGG - Intergenic
1036128156 8:6082744-6082766 CCAGCTTCTGCCCTGAGCCCAGG + Intergenic
1036467666 8:9016751-9016773 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1038475136 8:27860704-27860726 TGAGCTGCTGCACTCAGCCGAGG + Intergenic
1038532572 8:28330460-28330482 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1039223703 8:35364096-35364118 GCAGAGGCTGCACTGAGCTGAGG + Intronic
1039523720 8:38194920-38194942 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1040057219 8:43069710-43069732 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1040275892 8:46013487-46013509 GCAGACCCTGCACTGGGCCTGGG - Intergenic
1040277390 8:46020986-46021008 GCAGCCCCTGCACTGGGCCCGGG - Intergenic
1042583126 8:70304532-70304554 GCAGGTGTTGCAGTGAGCCGAGG - Intronic
1042737767 8:72008009-72008031 GCAGCTACTGAATTGAGCAGAGG + Intronic
1043452691 8:80383822-80383844 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1043736713 8:83757066-83757088 GCAGAGGTTGCACTGAGCCGAGG + Intergenic
1044136516 8:88592604-88592626 GCAGAGGCTGCAGTGAGCCGAGG - Intergenic
1045043894 8:98256081-98256103 GCAGAGACTGCAGTGAGCCGAGG - Intronic
1048292612 8:133192088-133192110 GCAGGTCCTGCCCTGGGCTGTGG - Intronic
1048709529 8:137193338-137193360 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1048712363 8:137226710-137226732 GCATCTCCTGCAGTGAGCTGAGG - Intergenic
1049551657 8:143262778-143262800 GCAGCACCTGCACTGTTCCCTGG - Intronic
1049616724 8:143578731-143578753 CCAGCTCCTGCCCTGGGCCTGGG + Intergenic
1049755710 8:144310488-144310510 GCGCCTGCTGCACGGAGCCGAGG - Intronic
1050887736 9:10786783-10786805 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1051734581 9:20185595-20185617 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1055119334 9:72640698-72640720 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1055269974 9:74547024-74547046 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1056391458 9:86145249-86145271 GCAGAGCTTGCAGTGAGCCGAGG - Intergenic
1057128926 9:92640078-92640100 TCAGCTCCTGCAGGGAGCCCAGG + Intronic
1058135193 9:101299465-101299487 TCAGTCCCTGCACTGAGCAGAGG - Intronic
1058508797 9:105694364-105694386 CCAGGTCCTGCACTGCGCCCAGG + Intergenic
1059218667 9:112591149-112591171 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1059539766 9:115118546-115118568 GCAGCTGCTGCCCAGAGCCCAGG - Intergenic
1060147822 9:121267851-121267873 GCAGCTCCTGAGCTGGGCTGGGG - Intronic
1060651351 9:125329738-125329760 GCAGAGACTGCAGTGAGCCGAGG - Intronic
1061428227 9:130514683-130514705 GCAGATGTTGCAGTGAGCCGAGG + Intergenic
1061499545 9:130994012-130994034 GCAGCTGCTGCAGGGACCCGAGG - Intergenic
1062541781 9:137044754-137044776 GCAGCTGCTGTGCTGAGCCCGGG - Intronic
1062574179 9:137198900-137198922 GCAGCACCTGCCCTGATCCCAGG - Intronic
1185751906 X:2618090-2618112 GCGGAGCCTGCAGTGAGCCGTGG + Intergenic
1186618641 X:11215032-11215054 GCAGCTCCAGCTCTCAGCCCTGG - Intronic
1186668729 X:11747306-11747328 GCAGATATTGCAGTGAGCCGAGG - Intergenic
1186823874 X:13318126-13318148 GCAGATGTTGCAGTGAGCCGAGG + Intergenic
1186868218 X:13742589-13742611 GCAGAGGCTGCAGTGAGCCGAGG - Intronic
1187544309 X:20232502-20232524 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1188859683 X:35242610-35242632 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1189449693 X:41117643-41117665 GCAGAGCTTGCAGTGAGCCGAGG - Intronic
1189992814 X:46610613-46610635 GCTGCTGCTGCTTTGAGCCGGGG - Intronic
1190149878 X:47936646-47936668 ACAGCTCAGGCACTGAGCTGGGG + Intronic
1190222737 X:48522738-48522760 GCAGAGGCTGCAGTGAGCCGGGG - Intronic
1190324540 X:49198973-49198995 GCAGCACCTTCACAAAGCCGAGG + Exonic
1191253388 X:58269704-58269726 GCAGCCCCTGCACTGGGCCCGGG - Intergenic
1191257850 X:58287506-58287528 GCAGCCCCTGCGCTGGGCCTGGG + Intergenic
1191258375 X:58289687-58289709 GCAGCCCCTGCACCAAGCCCAGG + Intergenic
1192181133 X:68916472-68916494 GCAGCCCCTGCACTGGGTCCTGG - Intergenic
1192460719 X:71314693-71314715 GCAGAGGCTGCAGTGAGCCGGGG + Intergenic
1192705555 X:73526130-73526152 GCAGCTCCGAGACTGAGCGGCGG - Intergenic
1194528141 X:95005627-95005649 GCAGAGCTTGCAGTGAGCCGAGG + Intergenic
1195686937 X:107595868-107595890 GCAGAGGCTGCAGTGAGCCGAGG + Intronic
1196624984 X:117868242-117868264 GGAGCTCATGCACAGAGCTGGGG - Intergenic
1197707105 X:129641906-129641928 GCAGCAGCTGACCTGAGCCGGGG + Intergenic
1199635217 X:149806995-149807017 CCAGCTCCTGGAGTGAGCCCTGG + Intergenic
1201151380 Y:11097227-11097249 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1201152403 Y:11101327-11101349 TCAGCCCCTGCACTGGGCCCAGG - Intergenic
1201763824 Y:17562502-17562524 GCAGCCCCTGCACCGGGCCCGGG - Intergenic
1201837729 Y:18343488-18343510 GCAGCCCCTGCACCGGGCCCGGG + Intergenic