ID: 1152573408

View in Genome Browser
Species Human (GRCh38)
Location 17:81130212-81130234
Sequence CTGGGAACACAGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 872
Summary {0: 1, 1: 0, 2: 17, 3: 93, 4: 761}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152573408_1152573421 2 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573421 17:81130237-81130259 GAGCTGGGGGTGGGCAGTGATGG 0: 1
1: 1
2: 17
3: 130
4: 1198
1152573408_1152573427 30 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573427 17:81130265-81130287 GCCTCAGGCTGGAAGCTTCCTGG 0: 1
1: 0
2: 4
3: 34
4: 272
1152573408_1152573424 5 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573424 17:81130240-81130262 CTGGGGGTGGGCAGTGATGGGGG 0: 1
1: 1
2: 11
3: 131
4: 931
1152573408_1152573422 3 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573422 17:81130238-81130260 AGCTGGGGGTGGGCAGTGATGGG 0: 1
1: 1
2: 7
3: 62
4: 563
1152573408_1152573426 19 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573426 17:81130254-81130276 TGATGGGGGAAGCCTCAGGCTGG 0: 1
1: 0
2: 4
3: 27
4: 223
1152573408_1152573425 15 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573425 17:81130250-81130272 GCAGTGATGGGGGAAGCCTCAGG 0: 1
1: 0
2: 2
3: 45
4: 345
1152573408_1152573418 -7 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573418 17:81130228-81130250 TTCCCAGAGGAGCTGGGGGTGGG 0: 1
1: 0
2: 8
3: 65
4: 569
1152573408_1152573423 4 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573423 17:81130239-81130261 GCTGGGGGTGGGCAGTGATGGGG 0: 1
1: 1
2: 15
3: 108
4: 917
1152573408_1152573417 -8 Left 1152573408 17:81130212-81130234 CCCTCCTGCCTCTGTGTTCCCAG 0: 1
1: 0
2: 17
3: 93
4: 761
Right 1152573417 17:81130227-81130249 GTTCCCAGAGGAGCTGGGGGTGG 0: 1
1: 0
2: 6
3: 66
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152573408 Original CRISPR CTGGGAACACAGAGGCAGGA GGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900539881 1:3197328-3197350 CTGGGGGCACACAGGAAGGAGGG - Intronic
900602174 1:3507629-3507651 CTGGAGACAGGGAGGCAGGAAGG + Intronic
900648340 1:3718937-3718959 CTGGGAACACAGTGGCCTGCAGG - Intronic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
900985979 1:6072961-6072983 ATGGCAACAAAGAGGCAGGTGGG + Intronic
901234729 1:7661703-7661725 CTGTGAAGAGAGAGGCAGGGGGG - Intronic
901813797 1:11782446-11782468 CTGGGAAAAAAGGGGCATGAAGG + Intronic
902513463 1:16978272-16978294 ATGGCAACAAAGAGGCAGGCCGG + Exonic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902928036 1:19710212-19710234 CTTGGGACGCTGAGGCAGGAGGG - Intronic
903238050 1:21963580-21963602 GTGGAAGCACAAAGGCAGGAAGG + Intergenic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903988155 1:27244447-27244469 CTAGGAAGGCTGAGGCAGGAGGG - Intronic
904337959 1:29810283-29810305 CTGGGACCAGAGAGGGAGGGAGG - Intergenic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
904783922 1:32971385-32971407 CTGGGGACACAAAGGATGGAGGG - Intergenic
905174174 1:36125670-36125692 CCGGGGTCACAGAGGCAGGCGGG + Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
905307406 1:37029217-37029239 CTGGGAAGACAGATGCACTAAGG - Intronic
906048637 1:42852423-42852445 TGGGGAAAACAGAGGCAGGTTGG - Exonic
906258479 1:44368310-44368332 CTGGGAGCACCAAGGCTGGAGGG + Intergenic
906546272 1:46621374-46621396 CTGGCAACTCTGAGGCAGGGAGG - Intergenic
907358836 1:53898281-53898303 GTGGGGTCCCAGAGGCAGGAAGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907478622 1:54726878-54726900 CTTGGGAGACTGAGGCAGGAGGG - Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
908954019 1:69599176-69599198 CTAGGATCACAGAAGTAGGATGG + Intronic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910368692 1:86493302-86493324 CTGGGGAGACAGGGGCAGAAGGG + Intronic
910669360 1:89757647-89757669 CTAGGATTACAAAGGCAGGAAGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911709591 1:101054680-101054702 TTTGGAAGACTGAGGCAGGAGGG - Intergenic
912245327 1:107956142-107956164 CTATGAGCACAGATGCAGGAAGG + Intronic
912262244 1:108121764-108121786 CTCGGAAGGCTGAGGCAGGAGGG - Intergenic
912561855 1:110556647-110556669 CTGGGAAAACAGTGGCAGTTGGG + Intergenic
912697911 1:111855306-111855328 CTGGGAACTCATACTCAGGAGGG - Intronic
912745350 1:112241250-112241272 CTGGGAACACACACTCAGGGAGG + Intergenic
912951395 1:114123039-114123061 CTGGAAGCAAAAAGGCAGGAAGG - Intronic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915561459 1:156690560-156690582 GTAGAAACACAGAGGCAGAAAGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
916573871 1:166050372-166050394 CTGGGATCTTAGAGGCAGGGAGG - Intergenic
916951526 1:169785202-169785224 GGGGGAGCACACAGGCAGGAAGG + Intronic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
918309113 1:183272914-183272936 CTGGGGACAGAAGGGCAGGAGGG - Intronic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919858843 1:201724966-201724988 CTGGGAGCACAGAGCCAGCCTGG - Intronic
919869665 1:201810829-201810851 AAGGGAACAATGAGGCAGGAAGG - Intronic
920436547 1:205950513-205950535 CAGGGAGCTCAGAGGCAGCAGGG + Intergenic
920437959 1:205960427-205960449 CTGGGAACACGGAGACTGGCAGG + Intergenic
920521376 1:206629660-206629682 TTAGGAACACAGAGGCATGGTGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920957101 1:210629712-210629734 CTTTGAAAACAGAGGAAGGAAGG - Intronic
920981203 1:210837268-210837290 CTGGGAACACAGGGGAAGGGTGG - Intronic
921095840 1:211886737-211886759 TTAGGAAGACAGAGGCAGGAGGG - Intergenic
921472783 1:215567951-215567973 CTGGGAAGGGAGAGGCAGAAGGG + Intronic
922789493 1:228303362-228303384 CTGGGTAGGCAGAGGTAGGAAGG - Intronic
922924489 1:229336437-229336459 CTGGGAACAGAGGTGGAGGAAGG - Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924670626 1:246120757-246120779 CTGGAAACACACAGGAGGGATGG - Intronic
924710103 1:246524297-246524319 TCTGGAACACAGAGGCAGGCTGG + Intergenic
1063218338 10:3943916-3943938 CTGTCATCACAGTGGCAGGAAGG + Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063842982 10:10092556-10092578 ATAGGAACAAAGAGGCAGGCAGG + Intergenic
1063911522 10:10835331-10835353 CTGGGAAGACTGAGGCCAGAGGG - Intergenic
1063977916 10:11431740-11431762 CTGAGCAGACAGAGGCATGATGG + Intergenic
1064025569 10:11846092-11846114 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1064133008 10:12726920-12726942 CTGGGAGCACAGGGGCCTGAGGG - Intronic
1064267680 10:13838191-13838213 CTGGGAAGCCTGAGGCAGGATGG - Intronic
1064974196 10:21096619-21096641 CTGGGAAAACTGAGGCAGGAGGG - Intronic
1065208003 10:23375306-23375328 CTGGGAAGCCAGAAGCAAGATGG + Intergenic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1065535679 10:26712805-26712827 CTGGGGCCACTGAGGCTGGAGGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066232456 10:33449568-33449590 ATGTGAGCACAGAGGCAGGCAGG + Intergenic
1067101826 10:43339593-43339615 CTGGGAACAGACACTCAGGACGG + Intergenic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1067563080 10:47317553-47317575 CTTGGAACACAGAGGTTGCATGG + Intergenic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067808421 10:49409013-49409035 CTGGGCACAGAGAGGCAGCTGGG - Intergenic
1068607021 10:59016851-59016873 CTGGGAACACAGTGGCTGCTTGG - Intergenic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1070113572 10:73507881-73507903 CTCGGAAGGCTGAGGCAGGAGGG + Intronic
1070322732 10:75366531-75366553 GTGGGGACACAGAGGCAGAGCGG - Intergenic
1070341084 10:75499031-75499053 CTGGGAACCTGGAGGCAGGAGGG + Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1070914430 10:80144046-80144068 CTGGGGAAACTGAGGCAGGTAGG + Intronic
1070920633 10:80183383-80183405 CTGAGATCCCAGAGGAAGGAAGG - Intronic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072735373 10:97875607-97875629 CTGGGCACAGGGAGGCAGGGAGG + Intronic
1072891497 10:99329294-99329316 CTGGGAACCCAGCCGCAGGCAGG - Exonic
1073104474 10:101024349-101024371 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1073125338 10:101145833-101145855 CTGGGCACAGTGAGGCTGGAGGG - Intergenic
1073347549 10:102795434-102795456 CTGGGAAAGCGGAGGCAGAACGG + Intronic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074904196 10:117846756-117846778 CTGGGAACACTTAAGCAGGGAGG - Intergenic
1075004007 10:118817682-118817704 TTGGGAACACAGAGGGCAGAAGG + Intergenic
1075166335 10:120071288-120071310 ATGGGAACACAGCACCAGGAGGG + Intergenic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075261502 10:120967272-120967294 CTTGGAAGACAGAGACAGGAGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075345914 10:121681880-121681902 AAAGGCACACAGAGGCAGGATGG - Intergenic
1075573765 10:123563612-123563634 CAGCGACCACAGAGCCAGGAAGG - Intergenic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076199385 10:128546468-128546490 CCGGGAACACACAGGCACTAGGG + Intergenic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1076380567 10:130022303-130022325 CTGAGAACCCAGAGGCCGGATGG + Intergenic
1076503023 10:130951807-130951829 CTGGGACCACTGAGGCACCAGGG - Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076669666 10:132112561-132112583 CTGTGAACACAGAGCCAAGCGGG - Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076838378 10:133032585-133032607 CATGGAGCACAGAGGCCGGAGGG + Intergenic
1077034706 11:489033-489055 CGGGGCACCCACAGGCAGGAGGG - Intronic
1077532518 11:3103867-3103889 ATGGGGCTACAGAGGCAGGAAGG - Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078901850 11:15649938-15649960 CTGGGGACACAGGGGCACGAGGG - Intergenic
1079370967 11:19851892-19851914 CTTATAAGACAGAGGCAGGAAGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080338334 11:31225907-31225929 CAGGAAACACAGAGCTAGGAAGG + Intronic
1080615629 11:33942524-33942546 CTTGGAAGACTGAGGCAGGAAGG + Intergenic
1080698564 11:34624346-34624368 ATCTGAAGACAGAGGCAGGAGGG + Intronic
1080878935 11:36301322-36301344 GAGGGAACTCTGAGGCAGGACGG + Intronic
1081811817 11:45918413-45918435 CTGGGGAAACTGAGGCAGTAAGG + Intronic
1082088390 11:48068715-48068737 AGAGGAACACAGAGCCAGGATGG + Intronic
1082665807 11:55974091-55974113 CTTGAAACAGAGAGGCATGAGGG - Intergenic
1082789686 11:57338728-57338750 ATGGTAGCACCGAGGCAGGAGGG - Intronic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1082917719 11:58455953-58455975 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083677091 11:64332255-64332277 GTGGGAAGCCAGAGCCAGGAAGG - Intergenic
1083720709 11:64602224-64602246 CTGGGAACTCATAGGCTGGCAGG - Exonic
1083946865 11:65928496-65928518 CTGGGGAGACTGAGGCAGAAAGG - Intergenic
1084238677 11:67804788-67804810 ATGAGAACACTGAGGCACGAGGG + Intergenic
1084323004 11:68384059-68384081 CTGGGGAAACTGAGGCAGGCAGG - Intronic
1084345356 11:68543606-68543628 CAGGGAAGACTGGGGCAGGAGGG - Intronic
1084542533 11:69796594-69796616 CTGGGATGACGGAGGCAGGCAGG - Intergenic
1084559029 11:69892405-69892427 ATGGGAAAACTGAGGCATGAGGG - Intergenic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084833740 11:71788040-71788062 ATGAGAACACTGAGGCACGAGGG - Intronic
1084887533 11:72220956-72220978 CTGGGACCACTGCGGCAAGATGG + Exonic
1084935032 11:72582340-72582362 CTGGGAAGACAGAGTCATCAAGG - Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085674151 11:78499371-78499393 CTTGGAAGCCTGAGGCAGGAGGG - Intronic
1085745317 11:79110118-79110140 CTGGCAACAGAGAGGGAGGAGGG - Intronic
1087692411 11:101336893-101336915 CAGGGAACACAGTGTCAGGATGG + Intergenic
1088341427 11:108772371-108772393 CAGGGAAGACAGAGACAGAAGGG + Intronic
1088421510 11:109653319-109653341 CTGGGCACTCAGTGGCTGGAAGG - Intergenic
1088830562 11:113532914-113532936 TTGGGAACCAAGGGGCAGGATGG - Intergenic
1089223060 11:116891371-116891393 CTTGGGAGACTGAGGCAGGAGGG + Intronic
1089350753 11:117820373-117820395 CTGAGAAGACAAAGGCAGGATGG + Intronic
1089842012 11:121426696-121426718 TTGGCAACACAGAGGCAGTCTGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090082451 11:123623080-123623102 TTGGGAACACAGAAGCATCAAGG + Intronic
1090296617 11:125593364-125593386 CTGGGAAACTAGAGGCAGGGTGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090582759 11:128178079-128178101 CTTGGAAAACAGGGGCAAGATGG - Intergenic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1092225417 12:6745206-6745228 TTGGGAACATAAAGGCAGGAAGG + Intergenic
1092265628 12:6978285-6978307 CTGGGAAGACAGTGGAAGGAAGG + Intronic
1092288309 12:7142841-7142863 GTAGGAACACAGGAGCAGGACGG - Intronic
1092377542 12:7968307-7968329 CTCTGAAGGCAGAGGCAGGAAGG + Intergenic
1092927319 12:13283078-13283100 CTGTGAAGACTGAGGCAGCAGGG + Intergenic
1093142323 12:15523665-15523687 CTTGGTAGACTGAGGCAGGAGGG + Intronic
1093643451 12:21554919-21554941 TTGGGAAGACTGAGGCTGGAAGG - Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094490736 12:30959072-30959094 CTCGGCAGACAGAGGCAGGTAGG + Intronic
1095471075 12:42537405-42537427 TTTGGGAGACAGAGGCAGGATGG - Intronic
1096090139 12:48893668-48893690 CTGGGAACAGAGACACAGAAAGG - Intergenic
1096216118 12:49798341-49798363 CTGGGCAGAGAGAGGTAGGAGGG - Exonic
1096462384 12:51829161-51829183 CCTGGAACAAAGAGGCTGGAAGG + Intergenic
1096484610 12:51970209-51970231 CTTGGCACACAGAGCCAGCAGGG - Intronic
1096620430 12:52861210-52861232 CTGGGCACAGCCAGGCAGGAGGG + Intergenic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1097192943 12:57228505-57228527 CTGGGAAGGTTGAGGCAGGAGGG - Intergenic
1097328268 12:58303933-58303955 TTTGGAAAACTGAGGCAGGATGG - Intergenic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098349409 12:69541715-69541737 CTCGGGAGACTGAGGCAGGATGG + Intronic
1098459514 12:70716737-70716759 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1099181106 12:79473433-79473455 TTAGGAACAATGAGGCAGGAAGG - Intergenic
1099340874 12:81432342-81432364 CTCGTTACACTGAGGCAGGAGGG - Intronic
1099552459 12:84064972-84064994 TTAGCATCACAGAGGCAGGATGG - Intergenic
1101870526 12:108562127-108562149 CTAGGGACACACAGCCAGGAAGG + Intergenic
1101923944 12:108955884-108955906 ATGAGAAAACAGATGCAGGAAGG + Intronic
1102304116 12:111791792-111791814 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1102437906 12:112939699-112939721 CTGGGATCACAGTGGCAGTGTGG - Intronic
1102473984 12:113176778-113176800 CTGGGAAAGCAGAGGCAGAGAGG - Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1103212959 12:119179677-119179699 CTGGTAAGTCAGGGGCAGGAGGG + Exonic
1103341047 12:120221349-120221371 CTGGGAGCACCCAGGGAGGAAGG + Intronic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103552912 12:121749312-121749334 CTAGGGACAGAGGGGCAGGAAGG - Intronic
1103602497 12:122063229-122063251 CTGGGAACAGACACGCAGGGAGG - Intergenic
1103610908 12:122123805-122123827 CTGGGGAGACTGAGGCAGGAAGG - Intronic
1103620397 12:122183719-122183741 CTGGAGACAGGGAGGCAGGATGG - Intronic
1104051223 12:125195139-125195161 CGGAGAAGACAAAGGCAGGAAGG - Intronic
1104073761 12:125371367-125371389 CTGGGAAGAGACAGGGAGGAAGG + Intronic
1104091091 12:125518364-125518386 CTAGGCCCCCAGAGGCAGGAAGG + Intronic
1104260849 12:127180733-127180755 TTTGGAAAACAGAGGCAGGGGGG - Intergenic
1104328250 12:127820248-127820270 ATGGGAGCACAGAGACAGGGAGG + Intergenic
1104750352 12:131234516-131234538 CTGGGGACACAGAGGAATTAAGG - Intergenic
1104753829 12:131256552-131256574 CTGGGTTCACTGAGGCAGGCGGG - Intergenic
1104782369 12:131429946-131429968 CTGGGGACACAGAGGAATTAAGG + Intergenic
1104814315 12:131637222-131637244 CTGGCAACCCAGTGCCAGGAGGG + Intergenic
1104871675 12:132003101-132003123 CTTGGGAGACTGAGGCAGGATGG + Intronic
1104919914 12:132285322-132285344 CTGCGGACAGAGACGCAGGAGGG + Intronic
1105644371 13:22301669-22301691 ATAGGAACACAAAGGAAGGAAGG - Intergenic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1106193593 13:27475030-27475052 CCTGGAACACAGACCCAGGAAGG + Intergenic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107805287 13:44148066-44148088 CTGGGAACTCACAGTCTGGAGGG - Intronic
1108163367 13:47666248-47666270 GTGGGATCAGAGAGGCAGGAGGG - Intergenic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108773343 13:53732511-53732533 CTGGGAACAGAGAGGCAAAACGG - Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109229401 13:59738307-59738329 AGGGGACCACAGAGGCAAGAGGG + Intronic
1109865034 13:68252456-68252478 CTGGGAACTCTTAGGCAGCAGGG - Intergenic
1110332515 13:74288838-74288860 CTGACAGAACAGAGGCAGGAAGG - Intergenic
1110848174 13:80213381-80213403 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1112219196 13:97470843-97470865 GTGGGGATACAGAGGCAGGTTGG + Intergenic
1112259640 13:97866753-97866775 CTGAGACCACAGAGGCAGCTAGG + Intergenic
1112386460 13:98944700-98944722 CTGGGAACAGCGAGGAAGGCGGG + Intronic
1112543655 13:100342827-100342849 CCAGGGACACTGAGGCAGGAGGG - Intronic
1112580112 13:100671238-100671260 CTTGGGAGACCGAGGCAGGAGGG - Intronic
1113022499 13:105903827-105903849 CTGGGAAGTCTGAGGCAGTAGGG + Intergenic
1114651949 14:24290893-24290915 TTGGGCACACGGAGGAAGGAGGG + Exonic
1115388054 14:32820817-32820839 ATAGGAACACAGAGGAAGGGGGG + Intronic
1116607414 14:47018913-47018935 ATGTGAACACAGAGGACGGACGG - Intronic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1116950748 14:50876452-50876474 CTGAGAATACAGGAGCAGGAAGG + Intronic
1117047282 14:51826241-51826263 CTGGGAACCCACAGATAGGAAGG - Intronic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117339027 14:54778169-54778191 CTGGCAAAAGAGTGGCAGGAAGG - Intronic
1117696649 14:58371171-58371193 CTTGGAAGGCTGAGGCAGGAGGG + Intronic
1117940473 14:60959024-60959046 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1118652514 14:67912626-67912648 GTGAGAACACAGAGGAAGAAGGG + Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119180216 14:72600332-72600354 CTGGGGACAGAGAGGAGGGAGGG - Intergenic
1119520264 14:75279658-75279680 ACGGGAACGCAGCGGCAGGATGG + Intronic
1119666470 14:76488676-76488698 CTGGGAACTCAGAGCTGGGATGG + Intronic
1120061608 14:79989948-79989970 CTTGGGAAACTGAGGCAGGAGGG - Intergenic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121036168 14:90705454-90705476 CTGGGAACCCAGAGGCCGGGTGG - Intronic
1121250948 14:92498909-92498931 CTGGGAGCACAGTGACAGGCTGG - Exonic
1122034321 14:98936406-98936428 CTGATAAAAGAGAGGCAGGAGGG + Intergenic
1122066956 14:99180514-99180536 CTGGGAACACCAAGGCAGAGGGG - Intronic
1122113657 14:99517404-99517426 CTGATAGCACAGAGGCAAGAGGG + Intronic
1122171579 14:99880394-99880416 GTGGGAATACAGAGGAAGAAAGG - Intronic
1122634600 14:103124045-103124067 TTGGGCCCACTGAGGCAGGAAGG - Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1122926536 14:104905700-104905722 GTGGGAACCGAGAGCCAGGACGG + Intergenic
1122926752 14:104906694-104906716 GTGGGAACCGAGAGCCAGGATGG + Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1124190851 15:27574889-27574911 CTGTGACCACAGAGTCAGGTGGG - Intergenic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1125883607 15:43212788-43212810 CTGGGAAGCTAGAAGCAGGAGGG + Intronic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1127235226 15:57042654-57042676 TTTGGGAGACAGAGGCAGGAGGG - Intronic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127418027 15:58776295-58776317 ATGGGGAGACTGAGGCAGGATGG - Intronic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1127873310 15:63091068-63091090 CTGGGAGCAGAGAGGCCAGACGG + Intergenic
1128134845 15:65255196-65255218 CTGGGAATGGAGAGGCAGGAAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128602675 15:69011025-69011047 CTCGGGAGACTGAGGCAGGAGGG + Intronic
1128687951 15:69700852-69700874 ATGGGAAAACAGAGGCTGTAGGG - Intergenic
1128768475 15:70265303-70265325 CCAGGAAGACAGAGGCAGGCAGG - Intergenic
1129054866 15:72812018-72812040 CTGGGTACACAGAGGCCCAAAGG - Intergenic
1129608316 15:77035485-77035507 CTGGGAACAGGGAGGAAAGAGGG - Intronic
1129785205 15:78305303-78305325 GTGGGAACTCAGACTCAGGAGGG - Intergenic
1129798485 15:78395937-78395959 CTGGGATCACACAGGCTGGGAGG + Intergenic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130136678 15:81187485-81187507 CTTGGAAGGCCGAGGCAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130894574 15:88160171-88160193 TGGGGAACCCAGAGGAAGGAGGG + Intronic
1130915439 15:88300973-88300995 CTGTGAGCTCAGAAGCAGGATGG + Intergenic
1132053021 15:98626250-98626272 GTGGGGACAGGGAGGCAGGATGG - Intergenic
1132090055 15:98940927-98940949 CTGAGAGCCCTGAGGCAGGACGG - Intronic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1132651892 16:1025069-1025091 GTGTGAACACCCAGGCAGGATGG - Intergenic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132761519 16:1510733-1510755 CCGGGCACCCAGAGGCAGGTGGG + Exonic
1132826129 16:1906563-1906585 CCGGGAGCACAGACGGAGGAGGG + Intergenic
1132958919 16:2611642-2611664 CTGGAAGGACGGAGGCAGGAGGG - Intergenic
1133224226 16:4332971-4332993 AAGGGAACACTGAGGCAGGAAGG + Intronic
1133283961 16:4682092-4682114 CTGGGAACCCAGAGGCTCAAAGG - Intronic
1133336211 16:5008344-5008366 TGGGGAACACAGTGGCAGGAGGG - Intronic
1133361431 16:5176962-5176984 CTGGGAACACAGAGGATCTAGGG + Intergenic
1133594611 16:7279607-7279629 CTGGGAATAGAGAGGAGGGATGG + Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134247634 16:12551841-12551863 CTGGGGACACAGGAGCAGGCAGG + Intronic
1134912024 16:18036124-18036146 CTGGGAACACTGAGGGGGAAAGG + Intergenic
1135257199 16:20950504-20950526 CTGGGAAGACAGAGGCTTAAAGG - Intronic
1136173509 16:28502509-28502531 CTGGGCACATGGAGGAAGGATGG - Intronic
1136251865 16:29010652-29010674 CTTGGAAAGCTGAGGCAGGAGGG + Intergenic
1136398005 16:30003509-30003531 CTGTGAAGACAGAAGCAGGTTGG + Intronic
1136451663 16:30357299-30357321 CTGAGAACACAGAGCAAGGTGGG + Exonic
1136475688 16:30511751-30511773 CTCAGAACACAGTAGCAGGAAGG + Intronic
1136580793 16:31149732-31149754 CTGGAAAGACAGAGGTAGGCAGG + Intronic
1137592966 16:49705006-49705028 CGGGCAACAAAGAGGCTGGAAGG - Intronic
1138345072 16:56315706-56315728 CTGGGCCCCCAGAGGCAGGGGGG - Intronic
1138431464 16:56971883-56971905 AGGGGAACACTGAGGCTGGAGGG + Intronic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1139052674 16:63145373-63145395 CTTGGGAGACTGAGGCAGGAGGG - Intergenic
1139586941 16:67909951-67909973 GTGGGAAAAGTGAGGCAGGAAGG + Intronic
1139599307 16:67976975-67976997 CAAGGAACCCAGAGGCAGGGTGG - Intronic
1139848857 16:69938905-69938927 CTGAGAACACAAAGCCAGGTTGG - Intronic
1140095099 16:71868357-71868379 TTGGGAAGATAGAGGCAAGAAGG + Intronic
1141137332 16:81474768-81474790 CTGGCACCAAGGAGGCAGGAAGG - Intronic
1141183189 16:81768671-81768693 CTCGGAAGGCTGAGGCAGGAGGG - Intronic
1141217153 16:82035322-82035344 CTGTGAACAGAGAGTCAAGAAGG - Exonic
1141490789 16:84371272-84371294 TTTGGAAGACTGAGGCAGGAGGG + Intronic
1141798113 16:86288021-86288043 CGGGGATGACAGAGCCAGGAGGG + Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142249410 16:88984223-88984245 CTGTGAACACCCAGGCAGGACGG - Intergenic
1142285596 16:89170294-89170316 CACTGACCACAGAGGCAGGATGG + Intergenic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1142743365 17:1942973-1942995 GGGGGAACCCAGAGCCAGGATGG + Intronic
1143868848 17:9943486-9943508 CTGGGAACTGAGAGGAAGAAGGG + Intronic
1144551455 17:16244780-16244802 CTCGGGAGACTGAGGCAGGAGGG - Intronic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1146461454 17:33049026-33049048 TGGGGATCACAGAGGCAGGAAGG + Intronic
1146546087 17:33740064-33740086 TTGGGAGCCCAGAGGCAGAAAGG + Intronic
1146669903 17:34729918-34729940 CTTGGGAGACTGAGGCAGGAAGG + Intergenic
1147156205 17:38545562-38545584 ATGGGAAAACTGAGGCAGGGAGG + Intronic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1148249141 17:46059509-46059531 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1148482617 17:47970079-47970101 CTGGGGACAAGGAGGCTGGAAGG - Intronic
1148896586 17:50842578-50842600 CCAAGAACACAAAGGCAGGAAGG + Intergenic
1149604680 17:57916385-57916407 CTGGGATCAAAGTGGGAGGAGGG - Intronic
1150417137 17:64996799-64996821 CTGGGGACAGAGTGGCAGAATGG - Intergenic
1150561515 17:66299456-66299478 CTGGGAAGACAGAGGCCCAAAGG + Intergenic
1150794527 17:68227123-68227145 CTGGGGACAGAGTGGCAGAATGG + Intergenic
1150947605 17:69765380-69765402 AGGGGAGCACAGAGGAAGGAGGG - Intergenic
1151032989 17:70763414-70763436 CTGGGAACACAGAAGTCTGATGG - Intergenic
1151301967 17:73233005-73233027 CTGGTAACGCAGCGGGAGGAGGG + Intronic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151930515 17:77229012-77229034 CCGGTCACACAGAGGTAGGAAGG - Intergenic
1152028300 17:77825886-77825908 CTAGGAACTCATAGGCAGGGTGG - Intergenic
1152376266 17:79920325-79920347 CTGGGACAATAGAGGCAGCAAGG + Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152811851 17:82386113-82386135 CGGGGAAGGCGGAGGCAGGATGG - Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153498090 18:5720948-5720970 CTAGGAAGACTGAGGCAGGAGGG - Intergenic
1153969230 18:10210167-10210189 AGGGGAACACAGAGGCAGACAGG + Intergenic
1154038743 18:10833154-10833176 CAAGGAACACAGTGGCAGGATGG + Intronic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1155154222 18:23144614-23144636 CTGAGAAGACTGAGGCTGGATGG + Intronic
1156468300 18:37361898-37361920 CCGGGAAGAGAAAGGCAGGAGGG + Intronic
1157102381 18:44742700-44742722 CTAAGGACACAGAGGCAGGCTGG - Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157401860 18:47395442-47395464 CTGGGAACACAGATGATGGCTGG - Intergenic
1157452787 18:47800858-47800880 TTGGGAAAACAGAGGCTGGCTGG + Intergenic
1157776370 18:50399770-50399792 CTGGGAACACTAAGACAGAAGGG - Intergenic
1157978508 18:52353430-52353452 CTTGGGACACAGAGGAGGGAGGG - Intronic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158758701 18:60357688-60357710 CTGGGAACATAGAAGTAGAATGG - Intergenic
1159011862 18:63065607-63065629 CAGGAAGCACAGAGCCAGGAAGG - Intergenic
1159184686 18:64953661-64953683 ATGTGAACAATGAGGCAGGAGGG - Intergenic
1159913412 18:74167218-74167240 CTGGGCACACAGAGACACCAGGG + Intergenic
1159942496 18:74419053-74419075 TTGGGAGCAGCGAGGCAGGAGGG - Intergenic
1160071887 18:75636193-75636215 CTGGGATGACAGAGGTGGGAAGG + Intergenic
1160327865 18:77967347-77967369 CTGGGCACACAGAGTCACCAAGG + Intergenic
1160364615 18:78313587-78313609 ATGAGACCACAGAGGCAGTAGGG + Intergenic
1160389415 18:78518860-78518882 CTGTGCCCACAGAGCCAGGATGG + Intergenic
1160854351 19:1209664-1209686 ATGGGAAGACAGACGCTGGAGGG + Intronic
1160854393 19:1209855-1209877 GAGGGAACACGGAGGCAGGGAGG + Intronic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161545583 19:4878312-4878334 CAGGGAACAAAGAGGCAGCCGGG - Intergenic
1161642859 19:5435301-5435323 CTGGACCCACAGTGGCAGGAGGG - Intergenic
1161927640 19:7313034-7313056 CCGGGAACAGGGAGGAAGGAAGG - Intergenic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1163136653 19:15316292-15316314 CTGGGAATATAGAAGCGGGATGG - Intronic
1163334014 19:16660042-16660064 CTGGGAAGAGAGAGCCAGGCAGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163859155 19:19731958-19731980 CTGGGAAGGCTGAGGCAGAATGG + Intronic
1164604671 19:29589222-29589244 CCTGGTACACAGAGCCAGGATGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165052591 19:33151440-33151462 CTGGGGACAGGCAGGCAGGAGGG + Intronic
1165088103 19:33365329-33365351 CTTGGAAGACTGAGGCGGGAGGG - Intergenic
1165279890 19:34786813-34786835 CTAGGGCCTCAGAGGCAGGAAGG - Intergenic
1165280768 19:34795380-34795402 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1165333683 19:35154975-35154997 CTGGGGAGACTGAGGCAGGCGGG - Exonic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165462521 19:35952542-35952564 ATGTGAGTACAGAGGCAGGAAGG - Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165797407 19:38526970-38526992 CTGGGGAGACAGAGCCAGGCTGG - Intronic
1165952106 19:39480274-39480296 AAGGGAACTCAGAGGCTGGAGGG + Intergenic
1166130789 19:40744495-40744517 CTGGGACCAGAGAGGCTGGGTGG - Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166210882 19:41305915-41305937 CTGGGAATACACACCCAGGAGGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166851581 19:45763948-45763970 CTGGGGAGACGGTGGCAGGATGG - Intronic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
1167176543 19:47868383-47868405 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
1167271416 19:48508662-48508684 GTGGGAAGTGAGAGGCAGGATGG - Intronic
1167326934 19:48832459-48832481 CTGGGGACACACAGGAGGGATGG + Intronic
1167688239 19:50969516-50969538 CTGGGGACACAGAGGTCGGCAGG - Intronic
1167688530 19:50971053-50971075 CTGGGAAGACTGAGGCGGGAGGG - Intergenic
1167777916 19:51573369-51573391 CTGGGTCCAGAGAAGCAGGATGG + Exonic
1167797141 19:51716860-51716882 TTGGGAACAAAGATGCAGCAGGG - Intronic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168428055 19:56255457-56255479 CTGTGAGCACTGAGGCAGGTTGG - Intronic
925542324 2:4979303-4979325 CTGGGCTCAGAGAAGCAGGAAGG - Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
927465698 2:23334738-23334760 CTGGCAGCACAGTGACAGGAGGG - Intergenic
927515600 2:23670068-23670090 CTGAGAACCCAGATGCAGGAAGG - Intronic
927932689 2:27055329-27055351 CTGGGAACACAGAAGCCAGAAGG - Intronic
928100858 2:28436743-28436765 CTGGAATCACAGGAGCAGGAAGG + Intergenic
928407639 2:31026837-31026859 CTGGGAAGACTGAGGAAGAAAGG - Intronic
928558867 2:32456997-32457019 CTTGGGAGACAGGGGCAGGAGGG - Intronic
929477658 2:42268542-42268564 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
929786932 2:45000213-45000235 CTGGGGAGACTGAGGCAGGGAGG + Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
929871191 2:45760774-45760796 GTGGGAACCCAGGGGCAGGAGGG - Intronic
929962804 2:46509027-46509049 GTGGGAAGACAGTGGCTGGAAGG - Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
930748827 2:54912605-54912627 TTGGGTACACACAGACAGGAAGG - Intronic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
932630280 2:73336023-73336045 CTTGGAAGGCTGAGGCAGGAAGG + Intergenic
932702443 2:74001127-74001149 CTGGGAACACAGGGCAGGGAGGG - Intronic
932833617 2:75013577-75013599 CTGGGCACTGACAGGCAGGAGGG + Intergenic
934574163 2:95389988-95390010 CTGGGAACACAGCGCTTGGAAGG - Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
934908675 2:98229795-98229817 CTGAGGTCACAGAGCCAGGAGGG + Intronic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936108805 2:109648234-109648256 CAGAGAACTCAAAGGCAGGAAGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
937108340 2:119340269-119340291 GTGGAAACAGAGAAGCAGGACGG + Exonic
937260032 2:120579455-120579477 CTGGGAGAACCGAGGCACGATGG - Intergenic
937384333 2:121413863-121413885 CTGGGGACAGAGTGGCAGGAAGG + Intronic
937854301 2:126661312-126661334 CAGGGACCACAGAGCCAGGCAGG - Intronic
938181606 2:129189747-129189769 CAGGGAAGACTGTGGCAGGAAGG + Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939167080 2:138651757-138651779 GTGTGAGGACAGAGGCAGGAAGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940765248 2:157783264-157783286 CTAAGTACACAGATGCAGGAAGG + Intronic
940864808 2:158807472-158807494 ATAGGAACACAGGGGCAGGGAGG - Intronic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
941395830 2:164971622-164971644 CTGGGAAGAAAGAGGAAGAAAGG - Intergenic
941706212 2:168661036-168661058 CGGGGAGCAGAGAGGCGGGAGGG + Intronic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
943073902 2:183172349-183172371 CTGGAAACACCCAGACAGGAGGG - Intergenic
944464954 2:199991714-199991736 CTGGGGACAAAGAGGCAGCCAGG - Intronic
945373597 2:209052110-209052132 GTTGGAACACAGAGTCAGAATGG + Intergenic
945607244 2:211950114-211950136 CTGGGATCACAGGGTCTGGAAGG - Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946023351 2:216656941-216656963 TTGTGCCCACAGAGGCAGGAAGG - Intronic
946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG + Intronic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
947402882 2:229746325-229746347 GTGGGAAGGCAGAGGCAGGCTGG + Intergenic
947481759 2:230507137-230507159 CTCAGAAGACAGAAGCAGGAGGG + Intronic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947615978 2:231557217-231557239 CCGGGAACACAGACCCAAGAGGG + Intergenic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948732844 2:239978063-239978085 CAGGGATCCCAGAGGCAGGGAGG - Intronic
948732858 2:239978120-239978142 CAGGGATCCCAGAGGCAGGGGGG - Intronic
948826954 2:240577496-240577518 CTGGGAAGCCAGGGGCAGGAGGG + Intronic
948879736 2:240850620-240850642 CTGGGAGCACCAAGGCTGGACGG + Intergenic
1168850497 20:973345-973367 CTGGGGACACTGAGGCCAGAAGG + Intronic
1168952808 20:1814126-1814148 CTGGGGGCACAGAGGCGGGCTGG - Intergenic
1169068700 20:2708610-2708632 CTTGGAAGGCTGAGGCAGGAAGG + Intronic
1169193709 20:3672627-3672649 CTGGGACCAGAAAGGCAAGAAGG + Intronic
1169200151 20:3705363-3705385 CTGAGAAAACAGAGCCAGGCAGG + Intronic
1169219915 20:3816168-3816190 CTGAGAACAGTGAGGCAGGAAGG - Intergenic
1169758087 20:9064650-9064672 GTGGGGTCACAGAGGCAGCAGGG - Intergenic
1169791427 20:9414336-9414358 CATGGAACACAGAGGCATGCAGG - Intronic
1169889255 20:10434759-10434781 CCTGGAACCCAGAAGCAGGATGG - Intergenic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170531328 20:17295655-17295677 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1170975167 20:21157014-21157036 CTTGGGAGACTGAGGCAGGAGGG + Intronic
1171121366 20:22571830-22571852 CTGGGAAGGGAGAGGCAAGAGGG + Intergenic
1171276520 20:23860741-23860763 AAGGGAACTCAGAGGCTGGAGGG - Intergenic
1172100257 20:32480983-32481005 CTGGGAAATATGAGGCAGGAAGG + Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1173033964 20:39390708-39390730 CCAGGAGCACAGAGGCAGCATGG - Intergenic
1173139634 20:40470856-40470878 CTGGGAAAGCAGAGACAGGCGGG - Intergenic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174435542 20:50503979-50504001 CTGGGTACACATAGCCAGGAAGG - Intergenic
1174559416 20:51419421-51419443 ATGGGAAAAAAGAGGAAGGAGGG - Intronic
1174590258 20:51639567-51639589 CTATGAACACAAAGGCAGAAGGG + Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175018992 20:55824466-55824488 CTGGGAAAACTGAGGCATGGAGG - Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175378475 20:58546054-58546076 CTGGGAAAACTGAGACCGGAGGG - Intergenic
1175584945 20:60131766-60131788 CTGGAAACAGAGAGAGAGGACGG + Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176289442 21:5036355-5036377 CGGGGACCTCACAGGCAGGACGG + Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177416646 21:20801711-20801733 TTGGGAACAGGGAGGTAGGAGGG + Intergenic
1177435403 21:21045539-21045561 CTCGGAAAACTGAGGCAGGAGGG + Intronic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179260187 21:39750995-39751017 CTGGGAACGCAGAGGCCTCAGGG - Intronic
1179301691 21:40117357-40117379 CTGGGAGTACTGGGGCAGGATGG + Intronic
1179441028 21:41394254-41394276 CTGAGATCAGAGAGGCAGGCAGG - Intronic
1179867788 21:44227232-44227254 CGGGGACCTCACAGGCAGGACGG - Intronic
1179988619 21:44934218-44934240 CTTGGAACACACAGGCAGCCAGG + Intronic
1180063978 21:45403985-45404007 CTGGGAAGGCTGAGGCAGGCAGG + Intergenic
1180223119 21:46372466-46372488 CCCAGAACACAGAAGCAGGAGGG - Intronic
1180616235 22:17129939-17129961 CTTGGAAGGCTGAGGCAGGAGGG - Intronic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181006026 22:20013978-20014000 CTGGGGAGACTGAGGCAGGAGGG - Intronic
1181312740 22:21954121-21954143 CTAGGAAGGCTGAGGCAGGAGGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1182735433 22:32529509-32529531 CTGGCAAAACACAGGCGGGAGGG + Intronic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183157438 22:36086152-36086174 CTGGGATCTGAGAGGCAGTATGG - Intergenic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184247443 22:43242731-43242753 CTGGGGACAGAGAGACTGGAGGG - Intronic
1184400405 22:44270620-44270642 GTGGTCTCACAGAGGCAGGATGG - Intronic
1184468344 22:44681952-44681974 CTGAGAGCACAGTGGCTGGAGGG + Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184596609 22:45517766-45517788 TTGGGAGCAAAGGGGCAGGAGGG - Intronic
1184756176 22:46517146-46517168 CTGGGAAAACTGAGGCAGTGGGG - Intronic
1184807627 22:46805695-46805717 CTGGAAACAGAGAGGTGGGATGG + Intronic
1184920340 22:47601108-47601130 CGGGGTACACAGAGGCTGGGAGG - Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
950077393 3:10196687-10196709 CAGGCAGCACTGAGGCAGGAAGG - Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
950527025 3:13530226-13530248 CTGAGAAAACTGAGGCAGAAAGG - Intergenic
950531453 3:13554371-13554393 CTGGGAATTCAGGGCCAGGATGG - Intronic
950549596 3:13658120-13658142 CTGGGTACAAAGAAGCAGCAAGG - Intergenic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950674321 3:14545411-14545433 ATGTGAACACAGAGTCAGGAGGG + Intergenic
951072559 3:18349419-18349441 CTGGGCAGACAGAGTCTGGATGG + Exonic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952243147 3:31555027-31555049 TTTGGAACACAGAGGCAGAGAGG - Intronic
952723246 3:36555361-36555383 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
952958846 3:38577198-38577220 CGGGCAACACACAGGCAGCAAGG + Intronic
953163276 3:40441916-40441938 CTTGGAAGGCTGAGGCAGGAGGG + Intergenic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
953983773 3:47426261-47426283 CTTTCAACACAGGGGCAGGAGGG - Intronic
954577765 3:51686213-51686235 CTGGTCCCACAGAGGCAGGGAGG - Intronic
954627435 3:52030253-52030275 CTTGGATCACAGAGACAGGGAGG + Intergenic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
956031701 3:65044549-65044571 TTATGAACCCAGAGGCAGGAAGG - Intergenic
957054625 3:75434585-75434607 ATGAGAACACTGAGGCACGAGGG + Intergenic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
957979766 3:87494144-87494166 CTAGGAAAAGAGAGGAAGGAAGG + Intergenic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
960989781 3:123303029-123303051 CTGGGTGCACAGGGGCTGGAAGG - Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
961300220 3:125917128-125917150 ATGAGAACACTGAGGCACGAGGG - Intergenic
961571872 3:127804974-127804996 ATGGGAACACAGGGACAGTATGG + Intronic
961798298 3:129425467-129425489 CTGAAAACCCAGAGCCAGGAAGG - Intronic
961821292 3:129577028-129577050 CTGGGACCCCAGAAGCAGGGAGG - Intronic
962347395 3:134628205-134628227 ATGGAAACAAAGATGCAGGAAGG + Intronic
962405025 3:135093225-135093247 TTGGGGACACAGAGACATGATGG + Intronic
962906607 3:139809137-139809159 CTTGGAAGACCGAGGGAGGAGGG + Intergenic
963260137 3:143184162-143184184 CTGGGAGTGAAGAGGCAGGAGGG - Intergenic
963273409 3:143307633-143307655 CTGGGAACAGAAAGGCTGCAGGG - Intronic
964178932 3:153859949-153859971 CTGGGGAGACTGAAGCAGGAGGG - Intergenic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
966670536 3:182521180-182521202 GTGGGAAGACAAAGGCAGGATGG - Intergenic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
968058564 3:195711515-195711537 CTGGGAACACAGGCACAGGTGGG + Intergenic
968074308 3:195808174-195808196 CTGGGAAGACGGGGGAAGGAGGG - Intronic
968474845 4:799380-799402 CTGGGCACATGGAGGCTGGAAGG + Intronic
968538263 4:1148783-1148805 CTGTGGAGACTGAGGCAGGAGGG - Intergenic
968997440 4:3954894-3954916 ATGAGAACACTGAGGCACGAGGG + Intergenic
969115849 4:4870331-4870353 CGCGGAGCATAGAGGCAGGATGG + Intergenic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969523989 4:7694972-7694994 AGGTGAACACAGAGCCAGGACGG - Intronic
969636674 4:8373561-8373583 CTGGGAACACAAAGCCAGGACGG + Exonic
969696326 4:8737193-8737215 CTGGGGACGCAGAGGCTGTAAGG + Intergenic
970482566 4:16492115-16492137 CTCTGAACACAGATGCATGAAGG + Intergenic
970640195 4:18055701-18055723 CTGGGAACACAGGGGCAAGATGG + Intergenic
971377904 4:26069802-26069824 CTGGGCACAGAAAGGCAGAAAGG - Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972425902 4:38932602-38932624 CAGGGGAGACTGAGGCAGGAGGG - Intronic
972568719 4:40291766-40291788 CGGGGAAGACACATGCAGGATGG - Intergenic
972569946 4:40301435-40301457 TGAGGAACACAGAGGCAGAAAGG + Intergenic
972622254 4:40758775-40758797 CTTGGGAGACTGAGGCAGGAGGG + Intronic
972703310 4:41515281-41515303 CTGGGGACGCGGAGGAAGGAAGG - Intronic
973093099 4:46162963-46162985 CTGGGGAGACAAAGGCATGACGG + Intergenic
973318768 4:48788600-48788622 CTCGGAAGGCTGAGGCAGGAGGG - Intergenic
973899851 4:55457709-55457731 TCAGGGACACAGAGGCAGGATGG - Intronic
974100340 4:57409551-57409573 CTGGTACCACAGTGGCAGGGAGG - Intergenic
974771045 4:66414064-66414086 CAGGAAACACAGATGCTGGAGGG + Intergenic
974877441 4:67716325-67716347 CTGGAAACGCAGAGGCATGATGG + Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975278220 4:72527792-72527814 CTGGGTACCAAGAGGAAGGAAGG + Intronic
976072218 4:81254453-81254475 CTGGGTACACAGGGACAGGAAGG - Intergenic
976434256 4:84998869-84998891 CTGGGAACAAAGAGGAAATAAGG + Intergenic
976827298 4:89275015-89275037 ATATGAACACTGAGGCAGGATGG + Intronic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977066606 4:92324309-92324331 CTGGGGACAGAGAGAAAGGATGG - Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
977797115 4:101179545-101179567 CTGGGGACAAAGAGACAGCATGG - Intronic
977979943 4:103309568-103309590 CTGGGAATACAAAGGCAGTCGGG + Intergenic
978074424 4:104511463-104511485 CTGGGAACAGATAGGCATTAAGG + Intergenic
979347694 4:119607627-119607649 CTGGGGAGACTGAGGCAGGAGGG + Intronic
980166423 4:129233610-129233632 ATGGGTAGACAGAGGCAGGTGGG + Intergenic
980550625 4:134329029-134329051 CTGGGAGCACAGAATCAGGCTGG - Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
981108704 4:140910940-140910962 ATGGGCACACAGAGCCAGGTGGG + Intronic
981943372 4:150311540-150311562 CTGGGGACACAGAGGACTGATGG + Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
984144251 4:176042294-176042316 ATGGGAACAGAGTGGCAAGATGG - Intergenic
984563664 4:181301552-181301574 CTGGGAACACAAAGGCGTGGAGG + Intergenic
984707421 4:182857795-182857817 ATAGGATCCCAGAGGCAGGAGGG - Intergenic
984926926 4:184815262-184815284 CTGTGAGCAAAGAGGCAGGGAGG + Intronic
985051871 4:185999251-185999273 TTGAGAGCACAGAAGCAGGAGGG + Intergenic
985888587 5:2699078-2699100 CTGGCAACACAGAGCAAGGATGG + Intergenic
985985785 5:3515198-3515220 CTGGGGACACCGGGGCAGGGGGG - Intergenic
987038623 5:14041265-14041287 CTGGGGACCATGAGGCAGGAAGG - Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
990017592 5:51084540-51084562 CTGGGGTCACACAGACAGGAAGG - Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990635984 5:57726764-57726786 CTCGGAAAACTGAGGCAGGAGGG - Intergenic
992494858 5:77282213-77282235 CTGGGACCACAGGGCCAGGCTGG - Intronic
992640564 5:78765327-78765349 CTGGGAAATCAGTGGGAGGATGG + Intronic
992673953 5:79086455-79086477 CTGGAAACACCAAGGCATGATGG - Intronic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
994276885 5:97849446-97849468 CTGGGAAAAACAAGGCAGGAAGG - Intergenic
994460101 5:100061570-100061592 CTTGGAAGACTGAGGCAAGAGGG + Intergenic
994484250 5:100374999-100375021 CTTGGAAGACTGAGGCAAGAGGG + Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995535202 5:113129125-113129147 CTGAGATCACAGAGATAGGAGGG + Intronic
996358750 5:122623081-122623103 TTGGGAACAGAGAGTAAGGAGGG + Intergenic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
998133668 5:139663609-139663631 CTGGGGAAACTGAGGCATGAAGG + Intronic
999243621 5:150141487-150141509 CTAGGAACACAGAGCCAGAAGGG + Intronic
999950558 5:156645296-156645318 CTGAGAAAACAGAGAGAGGATGG + Intronic
1000751681 5:165102844-165102866 CCTGGAACACAGAGGCAGGGGGG - Intergenic
1001355918 5:171022625-171022647 CTGGGACCAGGGAGGCTGGAAGG - Intronic
1001412880 5:171523355-171523377 CTGGGCACACAAAGGAAGTAGGG - Intergenic
1001946259 5:175780770-175780792 CTCAGAACACAGAGAAAGGATGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002043606 5:176530499-176530521 CTGGGAGCCCAGATGCAGGTCGG + Intronic
1002200247 5:177524033-177524055 CTAGGAAGACACAGCCAGGAGGG + Intronic
1002345714 5:178546465-178546487 CTGGGAGCAGAGAGGAGGGAGGG - Intronic
1002377369 5:178797850-178797872 CTGAGAACTCAAAGGCAGGCAGG - Intergenic
1002449504 5:179310798-179310820 CTGGGGACGCAGAGGCATCAGGG + Intronic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1002994293 6:2268476-2268498 CATGGGACACAGAGCCAGGAGGG + Intergenic
1003032409 6:2613442-2613464 CTTGTAAAAGAGAGGCAGGAGGG - Intergenic
1004427763 6:15517677-15517699 CTGCGGACACTGGGGCAGGACGG + Intronic
1004481056 6:16019559-16019581 CTGGGAACACTTGGGCCGGAAGG - Intergenic
1004527437 6:16422503-16422525 CTTGGAAAAGAGAGGCATGAAGG + Intronic
1004881115 6:20009412-20009434 ATGGGAACACAGTGACAGGATGG + Intergenic
1004929383 6:20447127-20447149 CTCTGAACACAGAGGAAGGAGGG + Intronic
1005632675 6:27723232-27723254 CTGGGGAGACTGAGGCAGGAGGG + Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006535496 6:34696228-34696250 TAGGGACCACGGAGGCAGGAGGG - Intronic
1006920909 6:37626441-37626463 CCAGGAACACAGATGCAGGGAGG - Intergenic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1008502089 6:52193459-52193481 CTGGTAACAGGGAGGGAGGATGG - Intergenic
1009565861 6:65310428-65310450 GTGGGTACTCAGAGGCAGGCAGG - Intronic
1010000004 6:70939695-70939717 ATGAGAACACAGACACAGGAAGG + Intronic
1010767651 6:79794710-79794732 CCTGGAAAACTGAGGCAGGAAGG + Intergenic
1011753548 6:90476686-90476708 CTGGCACCCTAGAGGCAGGAGGG - Intergenic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1014889340 6:126823660-126823682 CTTGGGACGCTGAGGCAGGAAGG - Intergenic
1016393338 6:143597017-143597039 CTGGGAGCAGAAACGCAGGAGGG - Intronic
1017622862 6:156317076-156317098 ATGGGAAGAGAGAGGCAGGGAGG + Intergenic
1017976214 6:159359702-159359724 CTGGTAACACACAGGCTGGCTGG + Intergenic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018471228 6:164100375-164100397 CTGGGACCACAGGAGAAGGAAGG - Intergenic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1018699387 6:166414725-166414747 GTGGGAACACTAAGGAAGGAGGG - Intronic
1019073305 6:169367209-169367231 CTGGGTACGCAGAGGCACAAAGG - Intergenic
1019293126 7:260061-260083 CAGTGAATTCAGAGGCAGGACGG + Exonic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1019410311 7:903900-903922 ATGGGAAGACAGGTGCAGGAAGG - Intronic
1019508221 7:1404112-1404134 CTGGGAACACGGAGAGGGGAGGG - Intergenic
1019547835 7:1587000-1587022 ATGGGAACACTGAGGCAGGGTGG - Intergenic
1019575202 7:1734453-1734475 CTGCGAGCCCAGAGGTAGGATGG + Intronic
1019595578 7:1856882-1856904 CTGGGGACACACAGGCAGCGAGG - Intronic
1020254968 7:6497853-6497875 GGGGGAACACAGAGGTAGGGTGG + Intronic
1020982680 7:15091217-15091239 CTTAGCAAACAGAGGCAGGAAGG + Intergenic
1021378180 7:19934755-19934777 CTGGGAGCAAAGAAGCAGGGTGG - Intergenic
1021585106 7:22199377-22199399 CTTGGAACACAGAGACATGCAGG + Intronic
1021855048 7:24846953-24846975 CTGGGAAGGCTGAGGCAGAATGG + Intronic
1021870776 7:25004117-25004139 CTGGGAACTCAGATGTAGGGAGG - Intergenic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1023626603 7:42121140-42121162 AGGGGAACACTGAGGCAGGTGGG - Intronic
1023795437 7:43788245-43788267 ACTGGAAGACAGAGGCAGGAGGG + Intronic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1024689487 7:51783561-51783583 CTGGGAAGACAGAGGCACTGAGG - Intergenic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1025194940 7:56925351-56925373 GTGGGAATACAGTGGCATGAGGG - Intergenic
1025677012 7:63651592-63651614 GTGGGAATACAGTGGCATGAGGG + Intergenic
1025908292 7:65806901-65806923 ATGGGAACACAGGGGGATGAGGG - Intergenic
1025942872 7:66086719-66086741 GTGGGAAGCCAGGGGCAGGAGGG - Intronic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1026875607 7:73877373-73877395 ATGGGGAGACTGAGGCAGGAAGG + Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1027374347 7:77536363-77536385 CTGCGAACCTAAAGGCAGGAAGG + Intergenic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028519910 7:91718284-91718306 CTAGCATCACACAGGCAGGAAGG + Intronic
1028669551 7:93385980-93386002 GTGGAAACACAGAGGATGGAGGG + Intergenic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1029610707 7:101625207-101625229 CTGACATCACAGAGGCAGGAAGG - Intronic
1029673219 7:102048287-102048309 GTGGGAATACAGTGGCACGAGGG - Intronic
1030505553 7:110417356-110417378 CAAGGAACTCAGAGTCAGGAGGG - Intergenic
1030621291 7:111794074-111794096 GTGGGGACACAGATGCTGGAGGG + Intronic
1033150893 7:138914073-138914095 CGGGGGAAACAGAGGCAGAATGG + Intronic
1033443194 7:141398328-141398350 CTGGGAACATTGAGGATGGAGGG + Intronic
1033568823 7:142606931-142606953 CTCGGGAAACTGAGGCAGGAGGG + Intergenic
1033767948 7:144515199-144515221 CTGGGCACACAGAGAAAGAAAGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034559493 7:151871005-151871027 TTGGGGACACTGAGGCAGGCTGG - Intronic
1034674498 7:152882838-152882860 ATGGGCACACAGAGGCAAGACGG - Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035289035 7:157825374-157825396 CTGGGACCTCAGAGGCTGCAAGG + Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035457939 7:159021391-159021413 TTGGGAATACAGAGGCAGACTGG - Intergenic
1036428910 8:8671471-8671493 CTGGGAACACAGGGGCAAGAGGG + Intergenic
1036458939 8:8934787-8934809 CTTGGGACACTGAGGCAGGAGGG + Intergenic
1036544326 8:9751723-9751745 CTGGCAGCCGAGAGGCAGGAGGG - Exonic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036710977 8:11078432-11078454 TGGGGAACACACAGGCAGAATGG - Intronic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1036849748 8:12193545-12193567 ATGAGAACACTGAGGCACGAGGG + Intronic
1036871112 8:12435818-12435840 ATGAGAACACTGAGGCACGAGGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037314924 8:17591804-17591826 CTCGGAAGGCTGAGGCAGGAGGG + Intronic
1037707591 8:21328248-21328270 CTTGGGAGACTGAGGCAGGAGGG + Intergenic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038025888 8:23590417-23590439 TTTGGAAGACTGAGGCAGGAGGG + Intergenic
1038681610 8:29673639-29673661 CTGGGAACACAGAGACAAATGGG - Intergenic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039746390 8:40431722-40431744 CTGGGACTACAGAGGCACGCCGG - Intergenic
1040316257 8:46262466-46262488 ATGGGAACATCGAGGCAGGCAGG + Intergenic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041977388 8:63815748-63815770 CAGGGACCACAGAGCCAGCATGG - Intergenic
1042029428 8:64459651-64459673 CTCGGAAGACTGAGGAAGGAGGG - Intergenic
1042704626 8:71653128-71653150 TTGGTAACACCGAGTCAGGAAGG - Intergenic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1045459654 8:102414467-102414489 CTGGGAGCCCTGAGGAAGGAAGG + Intergenic
1047503295 8:125458913-125458935 GTGGGAACACAGAGGAGGGGAGG + Intergenic
1047756455 8:127922680-127922702 CTGCCAACACAGTGGTAGGAAGG + Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048773242 8:137918483-137918505 CTTCGAAGACAGAGGCAGGAGGG + Intergenic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1049250667 8:141587254-141587276 CTGGGGACACAGAGGTTGGCAGG + Intergenic
1049806707 8:144544284-144544306 GTGGGCACACAGAGGCAGGGTGG - Intronic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050374910 9:4960650-4960672 CTGGGGAAACTGAAGCAGGAGGG - Intergenic
1051142030 9:13988127-13988149 CTGGGAGCACAGAATCAGGCTGG - Intergenic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1051894731 9:21975194-21975216 CTGGGAGCAGGGAGGCCGGAGGG - Intronic
1052016646 9:23476079-23476101 CCAGGAACCCAGAGGCAGGAAGG - Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1052376260 9:27721157-27721179 CCAGGAACACAGATGTAGGAGGG + Intergenic
1052831040 9:33216055-33216077 CTGGGAAGGCTGAGGCAGAAGGG - Intergenic
1053005461 9:34601269-34601291 CTGGGAATACAGAGCCAGAGAGG + Intergenic
1053014440 9:34653986-34654008 CTGGGATCACCGAGGTAGGGTGG + Intronic
1053178713 9:35949234-35949256 CTGGGAAGCTAGAGACAGGAAGG - Intergenic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1053491360 9:38506660-38506682 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1053514770 9:38721578-38721600 TTGGGAAGACAGAGGCCGCATGG + Intergenic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056178927 9:84062663-84062685 CTGGGAAAAAGGAGGCAGGCAGG + Intergenic
1056877063 9:90343646-90343668 CTAAGAACAAAGAGGCAGAAAGG - Intergenic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057227877 9:93302042-93302064 CCAGGGGCACAGAGGCAGGAGGG - Intronic
1057479290 9:95431991-95432013 CTAGAAATTCAGAGGCAGGAAGG - Intergenic
1057671663 9:97095849-97095871 CTAGGAAGGCTGAGGCAGGAGGG + Intergenic
1057718780 9:97516285-97516307 CTGGGAACACAGAGAGATGTGGG + Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058352627 9:104043966-104043988 ATGGGAAAAGAGAGGCAGGAGGG + Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1058887907 9:109336690-109336712 CTGAGAAGACAGAGGCAGAGAGG - Intergenic
1059395722 9:114032876-114032898 GGGAGACCACAGAGGCAGGAGGG + Intronic
1060051766 9:120383255-120383277 CCGGCAACAGAGAGGCAGGGTGG - Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060555336 9:124504887-124504909 GGGGGAACAGGGAGGCAGGATGG - Intronic
1061024939 9:128042422-128042444 CTGGAACCAGAGAGGTAGGAAGG + Intergenic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061278024 9:129580773-129580795 CTTGTAACAGAGAGGCAGGAAGG - Intergenic
1061312165 9:129770908-129770930 CTGGGAAAATAGCCGCAGGATGG + Intergenic
1061315947 9:129795856-129795878 CTGGGAGGTCAGAGGAAGGAGGG + Intergenic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1061626833 9:131845482-131845504 CGGGGAACACAGTGGCAGGGAGG + Intergenic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1061955851 9:133960947-133960969 TGGTGAGCACAGAGGCAGGAGGG + Intronic
1062024534 9:134334186-134334208 CTGGGAAAAAAGAGGCTGGATGG - Intronic
1062278518 9:135741749-135741771 CTGAGGCCACACAGGCAGGAAGG - Intronic
1062482645 9:136759544-136759566 CTGGGGAGACTGAGGCAGGGAGG - Intergenic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1186205107 X:7192201-7192223 CTGGGAACACACTGCCAGCATGG - Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186526078 X:10249519-10249541 CTTAGAAGAAAGAGGCAGGAGGG + Intergenic
1187241970 X:17522084-17522106 CTTGGAAGACAGAGACAGGTAGG + Intronic
1188245479 X:27831758-27831780 CTGGGATCACAGAGAGATGAGGG + Intergenic
1188397428 X:29702496-29702518 TTAGGAACACAGAGGCAGGGAGG - Intronic
1189380280 X:40497848-40497870 CCGAGAACACAGAGCCAGGCGGG + Intergenic
1190232062 X:48589979-48590001 CTCGGAACACAGAGCACGGAAGG + Intergenic
1190717069 X:53114004-53114026 CTTGGAAGGCTGAGGCAGGAGGG - Intergenic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1191783704 X:64895018-64895040 CTGGGCACACAGGTGCAGTAAGG + Intergenic
1192788583 X:74357577-74357599 CTTGGGAGACTGAGGCAGGAGGG + Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1193659373 X:84238338-84238360 CTGGGGACTCAGGGGAAGGATGG + Intergenic
1194672859 X:96755969-96755991 CTTGGGAGACTGAGGCAGGAGGG - Intronic
1196122523 X:112066182-112066204 ATAGGAACACAGAAGCAGAAGGG - Intronic
1197112109 X:122788809-122788831 CTCGGGAGGCAGAGGCAGGAGGG - Intergenic
1197666394 X:129228708-129228730 CTGGGAAGCCAGAGGTGGGATGG - Intergenic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198013360 X:132583169-132583191 CTGGGAACCAAGAAGCAAGAAGG + Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198218100 X:134575038-134575060 TTGGGAAATCAGAGGCAAGATGG + Intronic
1198414805 X:136409288-136409310 CTAGGAAAACACAGGCATGAGGG - Intronic
1198962305 X:142195541-142195563 ATGGGATCCCAGAGGCATGAGGG + Intergenic
1199714351 X:150495669-150495691 CTGGGGACACAGAGTCAGAGAGG + Intronic
1200135740 X:153873771-153873793 ATGGAAACTCAGAGGCAGCAGGG - Intronic
1200687280 Y:6267760-6267782 CTGGGAAGACTGAGGCTAGAGGG + Intergenic
1200757804 Y:7007556-7007578 CTTGGGAGACTGAGGCAGGAAGG - Intronic
1200835101 Y:7725265-7725287 CTGGGGACTCAGACACAGGATGG + Intergenic
1200943963 Y:8813336-8813358 CTGTGAACATTGAGGCAGAAAGG + Intergenic
1201047993 Y:9906950-9906972 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201063343 Y:10067943-10067965 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic