ID: 1152574783

View in Genome Browser
Species Human (GRCh38)
Location 17:81135231-81135253
Sequence GGTGTCCTGATTTGGAAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152574783_1152574789 7 Left 1152574783 17:81135231-81135253 CCCGGCTTCCAAATCAGGACACC 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1152574789 17:81135261-81135283 AGCCAGGCTTTGAGGAAGCTCGG 0: 1
1: 0
2: 1
3: 27
4: 286
1152574783_1152574788 -1 Left 1152574783 17:81135231-81135253 CCCGGCTTCCAAATCAGGACACC 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1152574788 17:81135253-81135275 CTGAGCTGAGCCAGGCTTTGAGG 0: 1
1: 1
2: 0
3: 55
4: 394
1152574783_1152574792 30 Left 1152574783 17:81135231-81135253 CCCGGCTTCCAAATCAGGACACC 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1152574792 17:81135284-81135306 TCCATCTGCTGCCCACAGGATGG 0: 1
1: 0
2: 2
3: 18
4: 248
1152574783_1152574786 -9 Left 1152574783 17:81135231-81135253 CCCGGCTTCCAAATCAGGACACC 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1152574786 17:81135245-81135267 CAGGACACCTGAGCTGAGCCAGG 0: 1
1: 0
2: 4
3: 36
4: 336
1152574783_1152574791 26 Left 1152574783 17:81135231-81135253 CCCGGCTTCCAAATCAGGACACC 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1152574791 17:81135280-81135302 TCGGTCCATCTGCTGCCCACAGG 0: 1
1: 0
2: 1
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152574783 Original CRISPR GGTGTCCTGATTTGGAAGCC GGG (reversed) Intronic
900479298 1:2890325-2890347 GATGTCCCCATTTGGAAGTCAGG + Intergenic
900991885 1:6101931-6101953 CGGGTCCAGCTTTGGAAGCCAGG - Exonic
902337964 1:15764783-15764805 GGTGTCCTGCTGGGGAAGACAGG - Intronic
902651319 1:17839452-17839474 GGTGTCCTCACTTGGTAGCTGGG - Intergenic
903538986 1:24086228-24086250 GGTGTCCTGCCTGGTAAGCCAGG + Intronic
904348477 1:29889666-29889688 GGTGAGATGAGTTGGAAGCCTGG - Intergenic
910524683 1:88164473-88164495 GTTGTCCTGATTGTGAATCCAGG - Intergenic
911110217 1:94175930-94175952 GGTGTGCGGATCTTGAAGCCAGG - Intronic
914689470 1:150012654-150012676 GGTCTCCAGATTTGAAAGCTGGG + Intergenic
915127782 1:153678298-153678320 GGTGTGCTGGTTTGGGATCCTGG - Intergenic
916288676 1:163139398-163139420 GGTGTTCTGATTGAGAAGACTGG - Intronic
918523621 1:185441794-185441816 GGTGATCTGATATGGAACCCAGG + Intergenic
920822364 1:209392880-209392902 AGAGCCCTGGTTTGGAAGCCAGG - Intergenic
921747600 1:218754984-218755006 GGTTTCCTGACCAGGAAGCCAGG - Intergenic
922613864 1:226949215-226949237 GGGGGCCTGATTTCGATGCCTGG + Intronic
924469094 1:244324038-244324060 TGTGACCTTATTTGAAAGCCAGG + Intergenic
1064164687 10:12975884-12975906 TGTGTCCTGAATTTGCAGCCTGG - Intronic
1066142014 10:32514250-32514272 GGTGACCTTATTTGGAAACAGGG + Intronic
1070048851 10:72866818-72866840 GGTCTCCTGATTTCTAGGCCTGG - Intronic
1070827221 10:79398307-79398329 GGTTTCCTCATCTGGAAACCAGG + Intronic
1071661132 10:87504488-87504510 GCTGTGCTGTTTTGGCAGCCTGG + Intergenic
1075214030 10:120516314-120516336 GGGATCCAGGTTTGGAAGCCTGG - Intronic
1075578550 10:123598539-123598561 TGTGTCCTTATTTGGAAGTCAGG + Intergenic
1075926929 10:126258792-126258814 GGTGTCTTGGTGTGGCAGCCAGG - Intronic
1077451708 11:2652182-2652204 GATGTCTGGATTTGGTAGCCAGG + Intronic
1078172878 11:8942769-8942791 GGAGTTTTGATTTGGAAGTCGGG - Intergenic
1079967167 11:26994029-26994051 GGTTTCGTCACTTGGAAGCCAGG - Intergenic
1080231890 11:30025639-30025661 GGTGTCCTGATTTGTAAATGTGG + Intergenic
1083260434 11:61519569-61519591 GGTGTCCTGGATTGGATGCTGGG + Intronic
1083639772 11:64139258-64139280 GGTGTCAGGAGATGGAAGCCAGG - Intronic
1083952409 11:65964345-65964367 TGTTTCCTGCTTTGGAGGCCAGG + Intronic
1084055657 11:66630768-66630790 GGTTTCCTGAATTTGAATCCTGG + Intronic
1084672159 11:70613638-70613660 GGTGACCTTATTTGGAAGGAGGG + Intronic
1086514533 11:87596549-87596571 GGTGTCCAGATGGGGAAACCAGG - Intergenic
1086878449 11:92126287-92126309 TGTGACCTTATTTGGAAGCAGGG + Intergenic
1087123534 11:94599730-94599752 GGTCTCCTGACATGGCAGCCAGG - Intronic
1089756378 11:120690565-120690587 CCTGTCATGAATTGGAAGCCGGG + Intronic
1090053648 11:123402717-123402739 GCTTTCCAGATTTGGAATCCCGG + Intergenic
1091453225 12:586647-586669 TGTGTCCTGATTTGTAAAACGGG - Intronic
1091841947 12:3627753-3627775 TGTTTCCTGATTTGGAAGTGAGG - Intronic
1092922190 12:13242444-13242466 AGTGTCCTTATTTGGAGGTCAGG - Intergenic
1096227578 12:49876404-49876426 GATGACCAGATTTTGAAGCCAGG + Intronic
1097777379 12:63664416-63664438 TCTGTTCTGATTTGGAGGCCTGG - Intronic
1099854285 12:88143735-88143757 GGTGTTCTGATCTGGACCCCAGG + Intronic
1100616793 12:96237130-96237152 TGTGATCTGATTTGGAAGCAGGG - Intronic
1100947211 12:99799598-99799620 GGTATCCTCATAGGGAAGCCAGG + Intronic
1102077970 12:110074976-110074998 AGTCTCCTGAACTGGAAGCCAGG - Intergenic
1102926246 12:116828622-116828644 GGTGTCCAGAAATGGAAGCAAGG + Intronic
1103412829 12:120725015-120725037 GGTGTCCTGATGAGGATGCTAGG + Intergenic
1103960516 12:124606403-124606425 TGTGACCTGATTTGGAAACAGGG + Intergenic
1104150035 12:126073410-126073432 TGTGACCTGATTTGGAAGTACGG - Intergenic
1104965083 12:132505368-132505390 AGTGTCCTCATTTGTAAGCTAGG - Intronic
1104978325 12:132561901-132561923 GGGGCCCAGATTTGGGAGCCTGG + Intronic
1107682360 13:42865062-42865084 GGTCTCCTGATGTTGAATCCAGG + Intergenic
1109596586 13:64563966-64563988 GGTATACTGATTGGGAAGCAAGG - Intergenic
1110451642 13:75643079-75643101 GGTGTCCTGGATTGGACCCCAGG + Intronic
1115790298 14:36870620-36870642 GGTGACTTTATTTGGAAGCAGGG - Intronic
1117700557 14:58409051-58409073 GGAGTCCTGCTTTGGCTGCCAGG + Exonic
1121349439 14:93161700-93161722 TGTGACCTTATTTGGAAGCAGGG + Intergenic
1121547309 14:94771503-94771525 AGTGGCCTGAGTTGCAAGCCGGG - Intergenic
1122284202 14:100641143-100641165 CTTGTCCTGCTCTGGAAGCCTGG + Intergenic
1122284210 14:100641183-100641205 CTTGTCCTGCTCTGGAAGCCTGG + Intergenic
1122284218 14:100641223-100641245 CTTGTCCTGCTCTGGAAGCCTGG + Intergenic
1122284226 14:100641263-100641285 CTTGTCCTGCTCTGGAAGCCTGG + Intergenic
1122284400 14:100642200-100642222 GGTGTCATTATTTAGAAGCCGGG + Intergenic
1124209147 15:27747934-27747956 GGTGAACTGGTTTGGAATCCAGG + Intergenic
1125826375 15:42679977-42679999 GATGTCATGACTTGGAAGCTTGG - Intronic
1126262613 15:46712044-46712066 TGTGTCCTGCCTTGGAAACCAGG + Intergenic
1126786345 15:52180215-52180237 GGAGTCCCGAGTTGGAATCCCGG - Intronic
1129595865 15:76963727-76963749 GGTGTGCTGAGCTGGGAGCCTGG + Intergenic
1129875524 15:78973175-78973197 GGTGCCCCCATTTGGGAGCCTGG - Intronic
1132422919 15:101689419-101689441 TGTGTCCTTATTTGGAAGTAGGG + Intronic
1134183345 16:12064664-12064686 GGTAGCCTGATTGGGACGCCAGG + Intronic
1134815571 16:17203004-17203026 GGTTTCCTCATTTGGAAAGCGGG - Intronic
1136413590 16:30090982-30091004 GGTGTCCAGTTCTGGAAGCCGGG + Exonic
1137432613 16:48430610-48430632 GGTGACATGGTTTGGTAGCCAGG - Intronic
1137914716 16:52416719-52416741 AGTGTTCTGATTTGGAATCTTGG - Intergenic
1138807884 16:60112700-60112722 GCTGTCCTGATTTCAAATCCTGG - Intergenic
1139137082 16:64217636-64217658 GGTGTCCTCATTTGTAAGGTAGG - Intergenic
1140527479 16:75635506-75635528 CTTGTCCTGATTAGGAAGGCAGG - Intronic
1142157606 16:88539745-88539767 GGTGTCCTGGTGTGGGAGACAGG - Intergenic
1142266580 16:89066754-89066776 GGTGTCCTGACTGAGCAGCCGGG + Intergenic
1142425714 16:90001268-90001290 GGTGCCCTGATGGGGAACCCAGG - Intergenic
1142667025 17:1469068-1469090 GGTGACCTCAGTTGGATGCCAGG - Intronic
1142930795 17:3282525-3282547 GGAGACCTCATTTGGAAGGCTGG - Intergenic
1142944607 17:3413948-3413970 GGAGACCTCATTTGGAAGGCTGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144419990 17:15087786-15087808 GGTATTCTGATGTGGATGCCAGG - Intergenic
1145103918 17:20099002-20099024 GCTGGCCTGAGTTGGAATCCTGG + Intronic
1146914095 17:36667012-36667034 GGTTTCCTGACCTGAAAGCCTGG - Intergenic
1147267224 17:39242120-39242142 GGGGTCCTGATTAGGGAGGCAGG + Intergenic
1147319359 17:39636675-39636697 GGCGTCCTGATAGGGAAGGCCGG + Intergenic
1148987120 17:51632704-51632726 GGTGTCCTGATTTCCAGTCCAGG + Intronic
1149320202 17:55474240-55474262 GGTTCCCTGATTGGGAAGCAAGG + Intergenic
1149424706 17:56543994-56544016 TGTGTCCTCATTTGGAAACAAGG - Intergenic
1150978338 17:70113750-70113772 CCTGTCCTGATTTGGAAGGTTGG - Intronic
1151427674 17:74041578-74041600 GGCGTCCTGGTTCAGAAGCCTGG - Intergenic
1152175983 17:78787781-78787803 GGTGACCTTATTTGGAAGTGGGG + Intronic
1152574783 17:81135231-81135253 GGTGTCCTGATTTGGAAGCCGGG - Intronic
1153008359 18:515529-515551 AGTGTCATGATTTTGAAGCGAGG - Intergenic
1160239490 18:77112828-77112850 GGTGGCCTGATTTGGAAGGAAGG + Intronic
1160535732 18:79590334-79590356 GGTGTCTGGATGTGGAGGCCAGG - Intergenic
1160954616 19:1684864-1684886 GGATTCCTGATTTGAAAGCCTGG - Intergenic
1161651676 19:5489618-5489640 GGTGCCCTGATTTGGAACTGGGG - Intergenic
1162901156 19:13796038-13796060 AGTGTCCTGATTTGGGATCTGGG - Intronic
1162928599 19:13943870-13943892 TGTGACCTGATTTGGAAAACAGG - Intronic
1163657743 19:18557525-18557547 GGTGTCCTGCTTTCCAAGCAGGG - Intergenic
1167942235 19:52957211-52957233 GGTTCCCTGACTTGGAAGCGAGG + Intronic
1168612996 19:57815730-57815752 GGTTCCCTGACTGGGAAGCCAGG + Intronic
1168646609 19:58063141-58063163 GTTGTCCTGGTTTGGCTGCCAGG + Intronic
1168711236 19:58501072-58501094 AGTGTCCTCATTTGGAAAACAGG - Intronic
925351593 2:3204780-3204802 GGTGGCTTGATTTGGAGGACAGG + Intronic
925743354 2:7024934-7024956 GGAGTCCTGATCAGGAACCCCGG - Intronic
926008924 2:9393421-9393443 GGAGGCCTGAGTGGGAAGCCTGG + Intronic
926216402 2:10908227-10908249 TGTGACCTGATTTGGAAGTTGGG - Intergenic
926312353 2:11683822-11683844 GGTGCCCTGGCTTGGAATCCTGG + Intronic
926978225 2:18536129-18536151 GGTGACCTGTATTGCAAGCCAGG - Intergenic
927233111 2:20844707-20844729 AGTGTCCTGATCTGGAAGTCTGG + Intergenic
929863781 2:45700718-45700740 TGTGACCTTATTTGGAAGCAGGG + Intronic
935648746 2:105363955-105363977 GGAGTCCTTACTTAGAAGCCTGG + Intronic
938710979 2:133976089-133976111 GCTGGCCTGATTGGCAAGCCAGG - Intergenic
940164713 2:150757629-150757651 AGTGTCCTGATTTGGGAGACAGG + Intergenic
941201503 2:162516821-162516843 GCAGTCCTGAGTTTGAAGCCGGG + Intronic
944631342 2:201628541-201628563 TGTGACCTTATTTGGAAGCAGGG + Intronic
945024557 2:205607500-205607522 GGTTTCCTCATCTGAAAGCCAGG + Intronic
947090837 2:226509816-226509838 GGTGGCCTGTGTTGGAAGCCAGG + Intergenic
947810159 2:232999005-232999027 GGTCTCCTGGTTTGGGACCCCGG + Intronic
948110709 2:235453388-235453410 AGTGACCTGATTGGGAAGTCAGG + Intergenic
1168839839 20:903001-903023 TGTCTACTGATTTGGAAGGCTGG + Intronic
1170158560 20:13290192-13290214 GATGAGCTGAGTTGGAAGCCTGG + Intronic
1172111690 20:32549839-32549861 GATGTACTGATTTGGAAAACAGG + Intronic
1172206290 20:33165004-33165026 AGTGTCCAGATGTGGAATCCGGG + Intronic
1175186870 20:57184633-57184655 TGTGACCTCATTTGGAAGCAGGG + Intronic
1176120757 20:63453557-63453579 GGGCTCCTGACTGGGAAGCCAGG - Intronic
1179470383 21:41606181-41606203 GGTGACCTTATTTGGGAGCAGGG + Intergenic
1179876785 21:44272731-44272753 GGTGTCCTCAGCTGGAGGCCCGG - Intergenic
1180141799 21:45897718-45897740 GGTGGCATGTTCTGGAAGCCAGG + Intronic
1180784614 22:18539824-18539846 TGTGTCCTTATTTGGAAACAGGG + Intergenic
1181128192 22:20713877-20713899 TGTGTCCTTATTTGGAAACAGGG + Intronic
1181241517 22:21479181-21479203 TGTGTCCTTATTTGGAAACAGGG + Intergenic
1181408488 22:22701818-22701840 GGTGTCCTGAGTTCTGAGCCTGG - Intergenic
1182108536 22:27706308-27706330 GGTGGCCTGATTGGGGTGCCAGG - Intergenic
1182956045 22:34427553-34427575 CATCTCCTGATTTGGAAACCAGG - Intergenic
1184205558 22:43000224-43000246 GGGGTCCTGACCTGGAACCCGGG - Intronic
1184370257 22:44077428-44077450 TGTGGCCTTATTTGGAAGCAGGG - Intronic
1184486962 22:44785579-44785601 TGTGACCTTATTTGGAAGTCGGG - Intronic
1184683637 22:46086105-46086127 TGTGGCCGCATTTGGAAGCCTGG + Intronic
1184922783 22:47617042-47617064 TGTGGCCTGATTTGGAAGCAGGG - Intergenic
949102820 3:166312-166334 CTAGTCCTTATTTGGAAGCCTGG + Intergenic
949284551 3:2385805-2385827 TGTGACCTTATTTGGAAGCAGGG - Intronic
949908164 3:8876629-8876651 GGTGTCCCGTTTTGAAAACCTGG + Intronic
950458651 3:13107810-13107832 GCTGGCCTGATTTTGAAGCAAGG - Intergenic
950464690 3:13146395-13146417 TCTGTCCTGATTTAGAAGCCAGG + Intergenic
952690601 3:36200772-36200794 GGTGTTCTGTTATGGAAGCTGGG - Intergenic
954033632 3:47838046-47838068 GCTGTCCTGCTGGGGAAGCCAGG + Intronic
955442980 3:58977037-58977059 GGGGTCTTTATTTAGAAGCCTGG + Intronic
957440130 3:80234741-80234763 GCTTTACTCATTTGGAAGCCTGG - Intergenic
958559414 3:95725659-95725681 GGTGTCCTTCTTTGTAAGCTAGG - Intergenic
958988264 3:100809163-100809185 GATGACCTGGTTTAGAAGCCTGG + Intronic
960687819 3:120311922-120311944 GGTTCCCTGATCTGGAAGCAAGG + Intergenic
960723105 3:120643812-120643834 TGTGTCCTGAATTGCCAGCCTGG + Intronic
962882054 3:139587492-139587514 GCTGCCCTGTTTTGGAAGCCAGG + Intronic
963315124 3:143751099-143751121 GCAGTTCTGTTTTGGAAGCCAGG + Intronic
964170079 3:153759408-153759430 GGTGTCCTTATTAGGAAGTTTGG + Intergenic
964186371 3:153949619-153949641 GGTTGCCTGAATTTGAAGCCTGG + Intergenic
965291816 3:166890330-166890352 AGTGTGCTGATTTGGCTGCCTGG - Intergenic
968451196 4:676795-676817 GGTGACCAGATGTGGAACCCTGG - Intronic
968729660 4:2263649-2263671 CATGTCCTGATCTGCAAGCCGGG - Intergenic
969855001 4:9991897-9991919 GGTATTCTGATATGGCAGCCTGG + Intronic
972599819 4:40562259-40562281 GTGGTCCTCTTTTGGAAGCCTGG + Intronic
984012579 4:174388345-174388367 GGTGTCCTCACATGGAAACCAGG - Intergenic
984296035 4:177855731-177855753 ACTTTCCTGCTTTGGAAGCCTGG + Intronic
986428837 5:7661621-7661643 AATATCGTGATTTGGAAGCCAGG - Intronic
988220128 5:28333845-28333867 GCTGTCCTGGATTTGAAGCCTGG - Intergenic
995212911 5:109560888-109560910 TGTGACCTTATTTGGAAACCAGG - Intergenic
996272833 5:121629110-121629132 TGTGACCTGATTTGGAAACTGGG - Intergenic
999075754 5:148793602-148793624 GATGTCCTGCCTTGGATGCCAGG - Intergenic
1001440266 5:171737463-171737485 AGTGTCCTCATTTGGAAAACAGG + Intergenic
1001590252 5:172859813-172859835 GGCTTCAGGATTTGGAAGCCCGG + Intronic
1004476974 6:15982219-15982241 CGTGACCTCATTTGGAAGCAGGG - Intergenic
1004519568 6:16348889-16348911 GGCCACCTGATTTGGAATCCTGG + Intronic
1006245475 6:32730884-32730906 AGTGTCCTCATCTGGAAGCCTGG + Intergenic
1007318399 6:41008540-41008562 GGTCTCTGGATTTGGAAGCAAGG + Intergenic
1007737447 6:43990492-43990514 GCTGCCCTGATTAGGAAGCAAGG - Intergenic
1008005869 6:46408376-46408398 TTTGTCCTGCTTTGGATGCCGGG + Intronic
1008075348 6:47139737-47139759 GGTGTCCTCATTTGTAAAACTGG + Intergenic
1012126180 6:95430444-95430466 TGTGTCCTCATTTTGAACCCAGG - Intergenic
1013883424 6:114933205-114933227 GGTGGACTGTTTTGGAAGCAAGG + Intergenic
1017234318 6:152103804-152103826 GGAGTCCTGAAATGGAAACCTGG - Intronic
1018124662 6:160670051-160670073 GGAGACCTGAATTGGAACCCTGG - Intergenic
1018239732 6:161761612-161761634 GGTTTTCTTACTTGGAAGCCAGG - Intronic
1018411724 6:163555991-163556013 GGTATTCTGGGTTGGAAGCCAGG + Intronic
1019218228 6:170457188-170457210 GGTGTGCTGCTTTGGAGCCCCGG - Intergenic
1019315012 7:380283-380305 TGTGGCCATATTTGGAAGCCGGG - Intergenic
1024934611 7:54699685-54699707 GGTGACCTTATTTGGAAACTGGG - Intergenic
1026182778 7:68056620-68056642 GGTGTAGTGGTTTGGAAACCAGG + Intergenic
1026891557 7:73985651-73985673 GGTGCCCTGAGCTGGGAGCCTGG - Intergenic
1027150937 7:75733199-75733221 GGAGTCCTGGTTTTGAATCCTGG + Intronic
1027192025 7:76002174-76002196 GGTGTCCTCATCTGGAAAACGGG + Intronic
1031961849 7:127997103-127997125 GGTGTCCTGAACTGTAAGACAGG - Intronic
1031987264 7:128171262-128171284 GGAGTCCTGATTTGGAATCAGGG - Intergenic
1034566106 7:151917042-151917064 TGTGACCTTATTTGGAAGCAGGG - Intergenic
1034997598 7:155587892-155587914 GGTGACCTTATTTGGAAACCGGG - Intergenic
1037323403 8:17664978-17665000 CGTGTCCTGATATGGAAGGTAGG + Intronic
1037454167 8:19047210-19047232 GCACTCCTGATTTGCAAGCCTGG + Intronic
1038215521 8:25558516-25558538 GGTGGCCTGAATTAGAAGCTGGG - Intergenic
1038665721 8:29535822-29535844 TGTGACCTGAGTTGGAAGTCAGG - Intergenic
1044199875 8:89421706-89421728 GGTGTCCTGACTTGGAATTTAGG - Intergenic
1044739874 8:95315164-95315186 AGTTTCCTGATTTGCAAGCAAGG - Intergenic
1045269978 8:100653356-100653378 AGTGTCCTGATTTGGAAATAGGG + Intronic
1045578593 8:103453277-103453299 GGGGTCATGATTTGGAATCCAGG - Intergenic
1047826099 8:128577490-128577512 GGTGTTCTGATTGTGAAACCAGG + Intergenic
1049183276 8:141234535-141234557 GGAGTCCTGTTGGGGAAGCCAGG - Intronic
1053491102 9:38503748-38503770 GGTATCCTGATATGGAATCCTGG - Intergenic
1056268723 9:84925408-84925430 GGTGTCCTGAATGGGAAGTGAGG - Intronic
1057214360 9:93219881-93219903 GGTGCCCTGCCCTGGAAGCCTGG + Intronic
1057671417 9:97092952-97092974 GGTATCCTGATATGGAATCCTGG - Intergenic
1061245212 9:129398155-129398177 GGTGGCCTGAGTTGGAAGGGAGG + Intergenic
1062105932 9:134754797-134754819 TGTGTCCTCTTTTAGAAGCCAGG - Intronic
1062172633 9:135144000-135144022 GGTGGCCTTATTTGGAAACTGGG - Intergenic
1191603174 X:63032652-63032674 TGTGTCCTGAGTTTGAAGCCAGG - Intergenic
1196289312 X:113920166-113920188 GGTGATCTGATTTGGGAGCTGGG + Intergenic
1196712006 X:118772018-118772040 GGTGTACAGATTTGTAGGCCAGG + Intronic
1198112122 X:133510878-133510900 GGTCACATGATGTGGAAGCCAGG + Intergenic
1200703395 Y:6421185-6421207 GGGGTGGTGATTTGGATGCCGGG + Intergenic
1201030715 Y:9743522-9743544 GGGGTGGTGATTTGGATGCCGGG - Intergenic
1201517747 Y:14835871-14835893 GGTGACATGATTTGTAAGCAAGG - Intronic
1201963557 Y:19707815-19707837 GGTCTCCTGGTTTGGGAGCTGGG - Intronic