ID: 1152575632

View in Genome Browser
Species Human (GRCh38)
Location 17:81139629-81139651
Sequence TTGGGCTCTCATAAGGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152575632_1152575634 -6 Left 1152575632 17:81139629-81139651 CCGCAGGCCTTATGAGAGCCCAA 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1152575634 17:81139646-81139668 GCCCAAGTAGCTGCACTGAAAGG 0: 1
1: 0
2: 0
3: 12
4: 368
1152575632_1152575637 23 Left 1152575632 17:81139629-81139651 CCGCAGGCCTTATGAGAGCCCAA 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1152575637 17:81139675-81139697 CAAAGCACACCCTCCAACCCTGG 0: 1
1: 0
2: 1
3: 21
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152575632 Original CRISPR TTGGGCTCTCATAAGGCCTG CGG (reversed) Intronic
909248977 1:73327563-73327585 TTGGACTCTCAGAAGGGCTCTGG + Intergenic
909756978 1:79239390-79239412 TTGGACTTGCATGAGGCCTGTGG - Intergenic
912549812 1:110477936-110477958 TTGGGTTCTCATATGGGCTTAGG + Intergenic
913408863 1:118528072-118528094 TTGGCTTCTAATAAGGCCTCAGG + Intergenic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
915605601 1:156948212-156948234 TTGGGTTCTCAAGAGACCTGTGG + Exonic
918046493 1:180944714-180944736 TTGGGCTCTGAGAAGGCCTGGGG + Intronic
918393666 1:184092522-184092544 AGGGGCTCTCAAAAGGACTGGGG + Intergenic
919425261 1:197421922-197421944 TGGGGCCTTCATAGGGCCTGTGG - Exonic
1065943665 10:30587742-30587764 TTGGCTTCTCTTAGGGCCTGTGG + Intergenic
1066813956 10:39378440-39378462 TTGGGATCTCTTTAGGCCTAAGG - Intergenic
1069390843 10:67932685-67932707 GCGGGCTTTCATAAGGTCTGTGG - Exonic
1071268575 10:83986092-83986114 TTGGGATCCAATTAGGCCTGAGG - Intergenic
1071354889 10:84784327-84784349 CTGGGCTTTCAGAAGGGCTGTGG + Intergenic
1071976655 10:90962566-90962588 TAGTGCTCACATAAGGCCTGTGG - Intergenic
1072775508 10:98187993-98188015 TTGGCCTCCCAGAAGTCCTGGGG + Intronic
1073328009 10:102653629-102653651 TTGAGGTCTCCTAAGACCTGAGG - Intronic
1076443125 10:130493897-130493919 TTGGCCTCACATAAGCCGTGAGG - Intergenic
1077577912 11:3398388-3398410 CTGGGCTCTGAGAAGGTCTGAGG + Intergenic
1079657574 11:23001898-23001920 TTGGCCACTCATGAGGTCTGCGG - Intergenic
1079721860 11:23825725-23825747 TTGGACTTGCATGAGGCCTGCGG - Intergenic
1083812339 11:65112776-65112798 GGGGGCTCTGATAAGGCCCGGGG - Intronic
1084231857 11:67759289-67759311 CTGGGCTCTGAGAAGGTCTGAGG + Intergenic
1085871781 11:80358673-80358695 TTGGGCTTTCATCAGCCTTGGGG + Intergenic
1090273873 11:125406112-125406134 TTGGAGTCTGATAAGCCCTGAGG + Intronic
1090534885 11:127630189-127630211 TTCTGCTCTCATAAAGCCTTTGG + Intergenic
1090756215 11:129794238-129794260 ATGAGCTCTCATGAGGCCTCTGG - Intergenic
1093393991 12:18657400-18657422 TTGTGCTTTCATAGAGCCTGAGG - Intergenic
1094809689 12:34125187-34125209 TTGGGCTTTCATCAGGCTTTTGG + Intergenic
1094850623 12:34380764-34380786 TTGTGCTCTCATAGTGCCTTGGG - Intergenic
1095395330 12:41756525-41756547 TTGAGCTTGCATAGGGCCTGTGG - Intergenic
1100336219 12:93632872-93632894 TTGGACTTGCATAGGGCCTGTGG + Intergenic
1101750298 12:107577808-107577830 TTTGGCTCCCATAAGTCTTGGGG - Intronic
1102266713 12:111492076-111492098 TTGGTCTCACCCAAGGCCTGTGG - Intronic
1103132459 12:118481102-118481124 TTGGACTCTTATAAGGCTTTAGG + Intergenic
1111566892 13:90028222-90028244 TTGGACTTGCATAAGGCCAGTGG + Intergenic
1112216725 13:97438386-97438408 CTGGGCTCTCCTTTGGCCTGTGG + Intronic
1112612837 13:100972939-100972961 TTGGGGTCTGATGGGGCCTGAGG - Intergenic
1116119624 14:40705883-40705905 TTGGACTGGCATAAGGCCTGTGG - Intergenic
1118691162 14:68341689-68341711 TTAGGATCTCATAAGGCATAAGG + Intronic
1118727533 14:68639716-68639738 TTTGGCTGCCATAAGGCCTGTGG + Intronic
1122127989 14:99589564-99589586 TTGGGCTCTGATTAGAGCTGCGG + Intronic
1128786443 15:70400938-70400960 TTTGGCTTTAATGAGGCCTGCGG - Intergenic
1131820975 15:96273273-96273295 TTGGGCTCACATAAGACATGGGG - Intergenic
1136742239 16:32546258-32546280 TTGGGAGCTCATGAGGCCTATGG + Intergenic
1136744381 16:32571659-32571681 TTGGGAGCCCATAAGGCCTATGG + Intergenic
1141554774 16:84829726-84829748 GTGGTCACACATAAGGCCTGAGG - Intronic
1142238691 16:88935339-88935361 GGGGGCTCTCACCAGGCCTGGGG - Intronic
1203025217 16_KI270728v1_random:503573-503595 TTGGGAGCCCATAAGGCCTATGG - Intergenic
1203027359 16_KI270728v1_random:528971-528993 TTGGGAGCTCATGAGGCCTATGG - Intergenic
1203044362 16_KI270728v1_random:805460-805482 TTGGGAGCTCATGAGGCCTATGG + Intergenic
1203046504 16_KI270728v1_random:830858-830880 TTGGGAGCCCATAAGGCCTATGG + Intergenic
1143026946 17:3946670-3946692 ATGGGCTCCCAGAAGGCCTTAGG + Intronic
1143302615 17:5922147-5922169 CTGGGCTCTCATAAGCCCTCGGG + Intronic
1147191924 17:38742907-38742929 CTGAGCTCTGATAATGCCTGGGG + Intronic
1151599990 17:75100218-75100240 CGGGGCCATCATAAGGCCTGTGG + Exonic
1152040560 17:77899981-77900003 TTGGGCCCTCATGAGGTCCGTGG - Intergenic
1152575632 17:81139629-81139651 TTGGGCTCTCATAAGGCCTGCGG - Intronic
1158225882 18:55200474-55200496 TTGGGCTCTCATAATACCCTAGG + Intergenic
1158761354 18:60391712-60391734 TTGGACCCTCATCTGGCCTGAGG + Intergenic
1163795264 19:19334298-19334320 TTGGGCTGGCAGAGGGCCTGTGG + Intronic
1164011182 19:21204653-21204675 TTGGGCTTTCATCAGGCTTTTGG + Intergenic
1164483309 19:28632893-28632915 CTGGGCTCTCAGAAGAGCTGTGG - Intergenic
1164705631 19:30317353-30317375 AGGGGCTCTCCTAATGCCTGGGG - Intronic
1165635342 19:37335229-37335251 TTTGGCTCTCAGGAGCCCTGTGG - Exonic
1168126429 19:54286005-54286027 CTGGGCTCTCAGAAGGGCTGGGG - Intergenic
1168175465 19:54624859-54624881 CTGGGCTCTCAGAAGGGCTGGGG + Intronic
927616157 2:24598585-24598607 CAAGCCTCTCATAAGGCCTGTGG - Intronic
928231227 2:29500406-29500428 TTGGCTTCTCAGGAGGCCTGAGG - Intronic
929258422 2:39838904-39838926 TTGGGCTCTCAGAAGGGCCCTGG + Intergenic
931908110 2:66864840-66864862 TTGGGCTCTCAGAAGACATTTGG - Intergenic
939666838 2:144963263-144963285 TTGGGCTCTCAAAGGGGCTGGGG - Intergenic
940054003 2:149494212-149494234 TGGGGGTCTAAAAAGGCCTGAGG - Intergenic
940911608 2:159214713-159214735 TGGTGCTCAGATAAGGCCTGGGG + Intronic
941468655 2:165858856-165858878 TTGGGCTCACATATATCCTGGGG - Intronic
944120371 2:196234244-196234266 TTGTGTTCTGATAAGGCGTGGGG - Intronic
945000956 2:205349990-205350012 TTTGGCTGACATAAGGCCTCTGG + Intronic
946326692 2:218988252-218988274 TGGGGCTCTGCTGAGGCCTGTGG + Intergenic
948474198 2:238206161-238206183 TTGGACTCTTATAAGGCTTTGGG + Intergenic
1171078442 20:22152758-22152780 TTGGGCTTTCTTAAACCCTGAGG - Intergenic
1179220269 21:39400580-39400602 CTGCTCTCTTATAAGGCCTGCGG + Intronic
1182423715 22:30260941-30260963 TTTGGCTCCCAAAATGCCTGGGG - Intergenic
1183578616 22:38708651-38708673 TTTGGCTCATATAAGGCCTGAGG + Intronic
952548587 3:34450147-34450169 TTGGGCTCTCCAAAGGCCGCAGG + Intergenic
953537991 3:43790357-43790379 CAGGGCTCTCATGAGGGCTGTGG + Intergenic
954792241 3:53142065-53142087 TTGGGGTCACAAAAGCCCTGAGG - Intergenic
955061606 3:55497229-55497251 ATGGGCTGTCGTTAGGCCTGTGG + Intergenic
957048489 3:75394592-75394614 CTGGGCTCTGAGAAGGTCTGAGG + Intergenic
960250147 3:115442864-115442886 TTGGCTTCTGATAAGGCCTCAGG + Intergenic
960949565 3:122990402-122990424 TTGGGCTCTCATGTGGCCTTTGG - Intronic
960949690 3:122991326-122991348 TTGGGCCCTCATGTGGCCTTTGG - Intronic
961094913 3:124146025-124146047 TTGGGCCCTCATGAGGCATCTGG + Intronic
961474518 3:127138373-127138395 TGGGCCTCTCAGGAGGCCTGGGG + Intergenic
961525602 3:127495235-127495257 TTGGCTTCTGATAAGGCCTCAGG + Intergenic
961880570 3:130058705-130058727 CTGGGCTCTGAGAAGGTCTGAGG + Intergenic
963642013 3:147872624-147872646 TTGGCCCCTGAAAAGGCCTGAGG - Intergenic
967148490 3:186626778-186626800 TTGGGCCCCGATAAGGCATGTGG - Intergenic
968992963 4:3927049-3927071 CTGGGCTCTGAGAAGGTCTGAGG + Intergenic
969822512 4:9731312-9731334 CTGGGCTCTGAGAAGGTCTGAGG - Intergenic
969881228 4:10175796-10175818 CTCGGCTGTCATAAGGCCTCAGG + Intergenic
971735572 4:30445274-30445296 CAGGGCTCTCAAAAGCCCTGTGG + Intergenic
973850924 4:54960852-54960874 GTGGGATATCAGAAGGCCTGGGG + Intergenic
973910153 4:55571898-55571920 TAGGGCTCCCATAAGAACTGTGG - Intronic
976268493 4:83207199-83207221 TTGGACTCTTATAAGGCTTCAGG - Intergenic
980741054 4:136949956-136949978 GTGGGCACTCTTAAGGCCTGGGG - Intergenic
982597754 4:157406845-157406867 CTGGGCTCAAATAAGTCCTGAGG - Intergenic
983110052 4:163738372-163738394 TTGGGATTTAATAAGGCATGAGG - Intronic
983291522 4:165813085-165813107 TTTGTCTCTCATAAGGTCTATGG - Intergenic
984847575 4:184120773-184120795 TGGGGCCATCCTAAGGCCTGGGG - Intronic
985853018 5:2402540-2402562 TTGGACTTTCATAGGGCCTGTGG + Intergenic
988227151 5:28426937-28426959 TTGAACTTTCATGAGGCCTGTGG + Intergenic
991355668 5:65766843-65766865 TTGGACTTGCATAGGGCCTGTGG - Intronic
992599241 5:78381168-78381190 TGGAGCTCTCATAAGTGCTGTGG + Intronic
994742273 5:103635098-103635120 TTGGGCTCTAACAAGCTCTGTGG - Intergenic
995040446 5:107581809-107581831 TTGGGTTCTCATGAGGCTTCAGG - Intronic
997428615 5:133821915-133821937 TTGGGCTCCCATAAGACCCTTGG - Intergenic
1001439889 5:171734565-171734587 ATTGGCTCTCAGCAGGCCTGTGG - Intergenic
1003330391 6:5124106-5124128 TGGGGCTGTCTTAGGGCCTGGGG + Intronic
1003347879 6:5287529-5287551 TTGGGCTCGCACCAGGCCAGGGG - Intronic
1003861077 6:10322211-10322233 CTGAGCTCTCCTAAGTCCTGGGG + Intergenic
1004011398 6:11691427-11691449 TAGGGCTCACATAAGTTCTGTGG + Intergenic
1006390436 6:33755098-33755120 TGGGGCTCTCTTGAGCCCTGAGG + Intergenic
1006640075 6:35485346-35485368 TTGGGCCCTCAGAGGGTCTGTGG - Intronic
1007111504 6:39315671-39315693 ATGGGCTCTCATCAACCCTGGGG + Intronic
1007415352 6:41688290-41688312 TAGGGCTTCCATAATGCCTGGGG - Intronic
1008011841 6:46476112-46476134 TGGTGATCTCATAAGGCTTGTGG - Intronic
1011901432 6:92302741-92302763 TGGGTCTCTCACAAGGTCTGCGG - Intergenic
1012827324 6:104162844-104162866 TTGGGCTCACATAAGGCCCATGG - Intergenic
1014211233 6:118710344-118710366 TTGAGCTGTCATAAGGCCTATGG - Intergenic
1014525329 6:122495369-122495391 TTGGGCTTTCAGAAGGGCTCTGG - Intronic
1016284889 6:142462310-142462332 TTGGCCTCACATAGGGCCTGTGG - Intergenic
1016690722 6:146934666-146934688 TGGGTCTCTCAGAAGGCATGGGG - Intergenic
1017674176 6:156796816-156796838 GTGGGCTCTGCTAAGCCCTGGGG + Intronic
1019143021 6:169960163-169960185 TTGGGCTCCCATGTGGCCTCAGG - Intergenic
1021807450 7:24371373-24371395 TTGGGCTCTGATTTGGCCTTTGG - Intergenic
1022048685 7:26644136-26644158 CTGGGCGCTCCTAAGGCCTGGGG + Intronic
1025532100 7:61900825-61900847 TTGGGAGCTCATGAGGCCTATGG + Intergenic
1031071094 7:117162766-117162788 GTTGGCACTCTTAAGGCCTGTGG + Intronic
1032258185 7:130313521-130313543 TTGGGCTTTTATAAGGCTTCGGG + Intronic
1032469471 7:132167946-132167968 TTGGACTCAGATAAGGCCAGAGG + Intronic
1033409992 7:141108684-141108706 TTGGGCTCACTTGAGGGCTGTGG + Intronic
1038110430 8:24491053-24491075 TTGGGCTGTGCTATGGCCTGGGG + Intronic
1038489691 8:27961409-27961431 TTGGTCTCTGGTAAGGCCTCAGG - Intronic
1040102634 8:43519028-43519050 TTGGGCTTGCATTGGGCCTGTGG + Intergenic
1041017875 8:53609466-53609488 TTGGGCTCTCCCCAGGCCTCTGG - Intergenic
1042980353 8:74519357-74519379 TGGGCCTCACCTAAGGCCTGTGG - Intergenic
1043336470 8:79182328-79182350 TTGGACTTTCATGGGGCCTGCGG + Intergenic
1045227392 8:100262586-100262608 TTGGGCTATGATAAGGACTTTGG + Intronic
1045298067 8:100889469-100889491 TTGGGCCCTCATAGTGCCTGTGG - Intergenic
1045394663 8:101748885-101748907 TTAGGCTCTCTCAAGGCCAGGGG + Intronic
1046495562 8:115009863-115009885 TTGGACTTGCATGAGGCCTGTGG - Intergenic
1048761793 8:137803679-137803701 TTGTCCTCTCATAAGGACTATGG - Intergenic
1048780737 8:137997258-137997280 TTAGGTTCTCATAAGGAGTGTGG - Intergenic
1051057784 9:13008319-13008341 ATCAGCTCTCATCAGGCCTGAGG + Intergenic
1053255512 9:36613870-36613892 GTAGGCTCTCATAAGGACTTTGG + Intronic
1053665457 9:40314443-40314465 TTGGACTTGCATTAGGCCTGTGG + Intronic
1054376610 9:64454473-64454495 TTGGACTTGCATTAGGCCTGTGG + Intergenic
1054519158 9:66061841-66061863 TTGGACTTCCATTAGGCCTGTGG - Intergenic
1054916410 9:70498811-70498833 TTGGGCTTCTCTAAGGCCTGTGG + Intergenic
1059554409 9:115264814-115264836 TTGGGCTATGACATGGCCTGGGG - Intronic
1060197090 9:121630946-121630968 TTGGGCTCTAGTAAGGTCTAAGG - Intronic
1060397611 9:123327006-123327028 TAGGGATCTCACAAGGCCAGCGG + Intergenic
1186374859 X:8988280-8988302 TTGGGTTTTCATAAGGGCTCTGG + Intergenic
1188871867 X:35382649-35382671 TTGGGCTGTCAGAAGGACTCTGG + Intergenic
1189098066 X:38160791-38160813 TTAGTCTCTAATAAGGCTTGGGG - Intronic
1192574198 X:72229882-72229904 TTGGACTTTTATAAGGCTTGGGG - Intronic
1193274542 X:79570469-79570491 TTGGACTCTCCTAAGCCCTCAGG + Intergenic
1193455382 X:81725255-81725277 CTGGACTCACATGAGGCCTGGGG + Intergenic
1193463471 X:81817995-81818017 GTGGGCTCTCCTCTGGCCTGGGG + Intergenic
1195870476 X:109480339-109480361 TTGTTCTCTCTTAAGGGCTGGGG + Intronic
1197308813 X:124878617-124878639 TTGGCTTCTCATGAGGCCTCAGG - Intronic
1199394786 X:147323077-147323099 ATTGGCTCTCCTAAGGCGTGAGG - Intergenic
1199529135 X:148827186-148827208 TTGGTCTCTCATTATTCCTGAGG - Intronic