ID: 1152577192

View in Genome Browser
Species Human (GRCh38)
Location 17:81147661-81147683
Sequence TCGGAGGATCGCTTAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131363
Summary {0: 2, 1: 221, 2: 5459, 3: 35010, 4: 90671}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152577186_1152577192 0 Left 1152577186 17:81147638-81147660 CCCAGCTACTCCGGAGGCTGAGG 0: 4636
1: 212588
2: 277873
3: 178664
4: 92980
Right 1152577192 17:81147661-81147683 TCGGAGGATCGCTTAAGCCCAGG 0: 2
1: 221
2: 5459
3: 35010
4: 90671
1152577181_1152577192 27 Left 1152577181 17:81147611-81147633 CCAGGCATAGTGGCACACACCTG 0: 146
1: 2958
2: 22243
3: 77784
4: 165140
Right 1152577192 17:81147661-81147683 TCGGAGGATCGCTTAAGCCCAGG 0: 2
1: 221
2: 5459
3: 35010
4: 90671
1152577191_1152577192 -10 Left 1152577191 17:81147648-81147670 CCGGAGGCTGAGGTCGGAGGATC 0: 2
1: 428
2: 1448
3: 4840
4: 8339
Right 1152577192 17:81147661-81147683 TCGGAGGATCGCTTAAGCCCAGG 0: 2
1: 221
2: 5459
3: 35010
4: 90671
1152577188_1152577192 -1 Left 1152577188 17:81147639-81147661 CCAGCTACTCCGGAGGCTGAGGT 0: 354
1: 25751
2: 240290
3: 278960
4: 165646
Right 1152577192 17:81147661-81147683 TCGGAGGATCGCTTAAGCCCAGG 0: 2
1: 221
2: 5459
3: 35010
4: 90671
1152577184_1152577192 8 Left 1152577184 17:81147630-81147652 CCTGTGGTCCCAGCTACTCCGGA 0: 160
1: 10209
2: 121320
3: 247410
4: 238870
Right 1152577192 17:81147661-81147683 TCGGAGGATCGCTTAAGCCCAGG 0: 2
1: 221
2: 5459
3: 35010
4: 90671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152577192 Original CRISPR TCGGAGGATCGCTTAAGCCC AGG Intronic
Too many off-targets to display for this crispr