ID: 1152579363

View in Genome Browser
Species Human (GRCh38)
Location 17:81159331-81159353
Sequence GCCGGCGGCCTGCGAGTGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152579356_1152579363 3 Left 1152579356 17:81159305-81159327 CCCCAACATGGGGCAGCTGGGAG 0: 1
1: 0
2: 6
3: 26
4: 260
Right 1152579363 17:81159331-81159353 GCCGGCGGCCTGCGAGTGACCGG 0: 1
1: 0
2: 0
3: 4
4: 59
1152579357_1152579363 2 Left 1152579357 17:81159306-81159328 CCCAACATGGGGCAGCTGGGAGG 0: 1
1: 1
2: 3
3: 28
4: 279
Right 1152579363 17:81159331-81159353 GCCGGCGGCCTGCGAGTGACCGG 0: 1
1: 0
2: 0
3: 4
4: 59
1152579359_1152579363 1 Left 1152579359 17:81159307-81159329 CCAACATGGGGCAGCTGGGAGGG 0: 1
1: 0
2: 3
3: 54
4: 568
Right 1152579363 17:81159331-81159353 GCCGGCGGCCTGCGAGTGACCGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152579363 Original CRISPR GCCGGCGGCCTGCGAGTGAC CGG Intronic
900156878 1:1206724-1206746 GCCGGCGACCTGCGGGGGACCGG - Intergenic
903212973 1:21828980-21829002 GACGGCAGCCTGCGGGTGAATGG - Exonic
906027244 1:42683307-42683329 GCGGCCGGCGTGCGAGGGACCGG + Intronic
906635910 1:47410412-47410434 GCCTGAGCCCTGAGAGTGACAGG + Intergenic
911027198 1:93448192-93448214 CCCGCCGGCCAGCGAGTGAGAGG + Exonic
911079000 1:93909545-93909567 GACGCCGGCCCGCAAGTGACTGG + Intergenic
916040509 1:160957171-160957193 GCCGGAGGCCTGGGAGTGAGAGG - Intergenic
916120179 1:161522571-161522593 GCCAACGGCCTGCAAGAGACGGG - Intronic
916129942 1:161604221-161604243 GCCGACGGCCTGCAAGAGATGGG - Intronic
1065778467 10:29144287-29144309 GCCGGCAGCCTGTGTGGGACTGG + Intergenic
1067741260 10:48897598-48897620 GCCTGGGGCCTGCGAGAGGCAGG + Intronic
1074829669 10:117240236-117240258 GCCAGGGGCCTGCGTGTGGCTGG - Intergenic
1078771873 11:14358951-14358973 GCCGGCGGGCTGCGGGCGAGCGG + Exonic
1079767799 11:24416299-24416321 GCCGGCTGGCTGCGAGTGCAGGG + Intergenic
1084401564 11:68946888-68946910 GCCGGGGGCATGCGACTCACTGG - Intergenic
1091226166 11:133957418-133957440 GCCGGCGGCCCGGGAGAGCCGGG + Intergenic
1092133990 12:6132862-6132884 GCCGGCGCACTGCGCGGGACTGG + Intergenic
1111441974 13:88292201-88292223 GCGGGCGCACTGCGAGGGACTGG + Intergenic
1113440104 13:110322227-110322249 GCAGGCCGCCTCCGAGAGACAGG - Intronic
1114065810 14:19059270-19059292 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1121030852 14:90657436-90657458 GCCTGCGGCTTCTGAGTGACTGG + Intronic
1122545098 14:102517490-102517512 GCCCGCGGACTGCGGGTGACAGG + Intergenic
1132657346 16:1046805-1046827 GCCGGCGGGCAGCGGGTGGCGGG + Intergenic
1132687194 16:1167280-1167302 GCCGGCCGCCCGCGAATGTCAGG + Intronic
1132807784 16:1783026-1783048 GGCGGCGGCCGGTGAGTGGCGGG + Exonic
1137027506 16:35492533-35492555 GGCGGTGGCCAGGGAGTGACTGG + Intergenic
1139361674 16:66403430-66403452 GACGGCGGTCTGTGGGTGACAGG - Exonic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1148895216 17:50835592-50835614 GCCAGCAGCCTGCCTGTGACAGG + Exonic
1152265583 17:79292446-79292468 GCCGGGGACATGCTAGTGACTGG - Intronic
1152277922 17:79368981-79369003 GGCGGCGGTGAGCGAGTGACTGG - Intronic
1152579363 17:81159331-81159353 GCCGGCGGCCTGCGAGTGACCGG + Intronic
1154446736 18:14440828-14440850 GCTGGAGGCCTGAGAGTCACAGG - Intergenic
1161357816 19:3828834-3828856 GCCGGTGGCCTGCAGGTGACGGG - Intronic
1162398350 19:10430767-10430789 GCAGGCGGCCTGCGTGGGCCTGG + Intronic
1166790571 19:45396399-45396421 GCCGGCGGCCTCCGAAAGCCTGG - Exonic
925785846 2:7430963-7430985 GCTGCAGGCCTGCGAGTGGCAGG + Intergenic
934921434 2:98347635-98347657 GCCGGCGGACTGCGTGTCAGAGG - Intronic
944170743 2:196773928-196773950 GCCCGTGGCCTGCTAGGGACTGG - Intronic
944457641 2:199911660-199911682 GGCGGCGGCCGGGGAGGGACTGG + Exonic
948835220 2:240623102-240623124 GCCGCGGGGCTGCGAGTGCCGGG - Intronic
1173426406 20:42947184-42947206 GCCAGCTGCCTGTGAGTGGCTGG - Intronic
1175542492 20:59756443-59756465 ACGGGCGGCCTGCGAGTGTGTGG - Intronic
1180484291 22:15781862-15781884 GCTGGAGGCCTGGGAGTCACAGG + Intergenic
1181984374 22:26789404-26789426 GGCGGCTGCCTGCCAGTGTCTGG - Intergenic
1185139803 22:49093857-49093879 GCCTGCGGGCTCCAAGTGACAGG - Intergenic
951411601 3:22372829-22372851 GCCCGCGGCCTGAGGGTGCCGGG + Intronic
954063534 3:48088624-48088646 GCCGCCGGCCTGCGAGACGCGGG - Intronic
954198812 3:49012246-49012268 GTGGGCGACCTGCGAGTGCCTGG + Exonic
968473212 4:791352-791374 GGCGGGGGGCTGCGAGGGACCGG + Intronic
975650280 4:76586165-76586187 GCAGGCGGCCGGCGATTGGCCGG + Intronic
984932194 4:184857866-184857888 GCAGGCGGCCTTCAAGTGCCTGG + Intergenic
985658588 5:1144413-1144435 GGCGGCGGCCTGGGAGCAACTGG - Intergenic
1001649903 5:173308840-173308862 GCAGGAGGCCTGCGAGGGCCAGG + Intergenic
1002001540 5:176199108-176199130 GGCAGCGGGCTGCGTGTGACTGG - Intergenic
1002252800 5:177939871-177939893 GGCAGCGGGCTGCGTGTGACTGG + Intergenic
1004663379 6:17729137-17729159 GCCGGCGCACTGCGGGAGACTGG + Intergenic
1019037369 6:169072782-169072804 GTCTGTGGCCTGGGAGTGACCGG + Intergenic
1029432378 7:100539557-100539579 TCCGGCCTCCTGTGAGTGACCGG + Exonic
1040806771 8:51404801-51404823 GCCGGCGCACTGCGTGGGACTGG - Intronic
1044624520 8:94223770-94223792 GCCAGTGGCCTGGGAGTGAGGGG + Intergenic
1046898087 8:119494822-119494844 GCCAGGGGTCTGCTAGTGACTGG - Intergenic
1200161789 X:154013365-154013387 GCTGGCGGCCTCCGAATGCCCGG + Exonic
1201178244 Y:11322568-11322590 CCCGGAGGCCTCCGAGTGGCAGG + Intergenic