ID: 1152582668

View in Genome Browser
Species Human (GRCh38)
Location 17:81173503-81173525
Sequence GGCTTTCCAGCTGTGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152582668_1152582673 5 Left 1152582668 17:81173503-81173525 CCCAAGCTCACAGCTGGAAAGCC No data
Right 1152582673 17:81173531-81173553 TATATCATATCTTGCTCTATAGG No data
1152582668_1152582674 22 Left 1152582668 17:81173503-81173525 CCCAAGCTCACAGCTGGAAAGCC No data
Right 1152582674 17:81173548-81173570 TATAGGAAAGCACTGAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152582668 Original CRISPR GGCTTTCCAGCTGTGAGCTT GGG (reversed) Intergenic