ID: 1152582673

View in Genome Browser
Species Human (GRCh38)
Location 17:81173531-81173553
Sequence TATATCATATCTTGCTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152582668_1152582673 5 Left 1152582668 17:81173503-81173525 CCCAAGCTCACAGCTGGAAAGCC No data
Right 1152582673 17:81173531-81173553 TATATCATATCTTGCTCTATAGG No data
1152582665_1152582673 30 Left 1152582665 17:81173478-81173500 CCGAGAGAACCGACTATGTGGCT No data
Right 1152582673 17:81173531-81173553 TATATCATATCTTGCTCTATAGG No data
1152582669_1152582673 4 Left 1152582669 17:81173504-81173526 CCAAGCTCACAGCTGGAAAGCCA No data
Right 1152582673 17:81173531-81173553 TATATCATATCTTGCTCTATAGG No data
1152582666_1152582673 21 Left 1152582666 17:81173487-81173509 CCGACTATGTGGCTTGCCCAAGC No data
Right 1152582673 17:81173531-81173553 TATATCATATCTTGCTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152582673 Original CRISPR TATATCATATCTTGCTCTAT AGG Intergenic