ID: 1152582674

View in Genome Browser
Species Human (GRCh38)
Location 17:81173548-81173570
Sequence TATAGGAAAGCACTGAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152582672_1152582674 -4 Left 1152582672 17:81173529-81173551 CCTATATCATATCTTGCTCTATA No data
Right 1152582674 17:81173548-81173570 TATAGGAAAGCACTGAGAATTGG No data
1152582668_1152582674 22 Left 1152582668 17:81173503-81173525 CCCAAGCTCACAGCTGGAAAGCC No data
Right 1152582674 17:81173548-81173570 TATAGGAAAGCACTGAGAATTGG No data
1152582669_1152582674 21 Left 1152582669 17:81173504-81173526 CCAAGCTCACAGCTGGAAAGCCA No data
Right 1152582674 17:81173548-81173570 TATAGGAAAGCACTGAGAATTGG No data
1152582671_1152582674 1 Left 1152582671 17:81173524-81173546 CCAGGCCTATATCATATCTTGCT No data
Right 1152582674 17:81173548-81173570 TATAGGAAAGCACTGAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152582674 Original CRISPR TATAGGAAAGCACTGAGAAT TGG Intergenic