ID: 1152587162

View in Genome Browser
Species Human (GRCh38)
Location 17:81194252-81194274
Sequence GACTCAGCTGTGCTTCGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 3, 3: 138, 4: 404}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152587162_1152587171 13 Left 1152587162 17:81194252-81194274 CCAACCCGAAGCACAGCTGAGTC 0: 1
1: 0
2: 3
3: 138
4: 404
Right 1152587171 17:81194288-81194310 GGTGGGGAAGAGACCCCCACAGG 0: 1
1: 0
2: 5
3: 24
4: 223
1152587162_1152587173 20 Left 1152587162 17:81194252-81194274 CCAACCCGAAGCACAGCTGAGTC 0: 1
1: 0
2: 3
3: 138
4: 404
Right 1152587173 17:81194295-81194317 AAGAGACCCCCACAGGGCCACGG 0: 1
1: 0
2: 1
3: 20
4: 286
1152587162_1152587165 -8 Left 1152587162 17:81194252-81194274 CCAACCCGAAGCACAGCTGAGTC 0: 1
1: 0
2: 3
3: 138
4: 404
Right 1152587165 17:81194267-81194289 GCTGAGTCTTGACGCCCACGAGG 0: 1
1: 0
2: 1
3: 3
4: 45
1152587162_1152587168 -3 Left 1152587162 17:81194252-81194274 CCAACCCGAAGCACAGCTGAGTC 0: 1
1: 0
2: 3
3: 138
4: 404
Right 1152587168 17:81194272-81194294 GTCTTGACGCCCACGAGGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1152587162_1152587167 -4 Left 1152587162 17:81194252-81194274 CCAACCCGAAGCACAGCTGAGTC 0: 1
1: 0
2: 3
3: 138
4: 404
Right 1152587167 17:81194271-81194293 AGTCTTGACGCCCACGAGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1152587162_1152587166 -5 Left 1152587162 17:81194252-81194274 CCAACCCGAAGCACAGCTGAGTC 0: 1
1: 0
2: 3
3: 138
4: 404
Right 1152587166 17:81194270-81194292 GAGTCTTGACGCCCACGAGGTGG 0: 1
1: 0
2: 0
3: 2
4: 34
1152587162_1152587172 14 Left 1152587162 17:81194252-81194274 CCAACCCGAAGCACAGCTGAGTC 0: 1
1: 0
2: 3
3: 138
4: 404
Right 1152587172 17:81194289-81194311 GTGGGGAAGAGACCCCCACAGGG 0: 1
1: 0
2: 4
3: 13
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152587162 Original CRISPR GACTCAGCTGTGCTTCGGGT TGG (reversed) Intronic
900840685 1:5046450-5046472 GACTCAGCGACGCTTGGGGTTGG - Intergenic
900847362 1:5114721-5114743 GACTCAGCGACGCTTGGGGTTGG - Intergenic
902551596 1:17222909-17222931 GACTCGTCTGAGCTTCGGGCAGG - Intronic
902906723 1:19563790-19563812 AACTCAGCTCTGTTTTGGGTGGG + Intergenic
904996572 1:34636052-34636074 GACTCAGCAATGCTTGGGGTTGG + Intergenic
905060620 1:35136435-35136457 GACTCAGCAATGCTTGGGGTTGG + Intergenic
905499677 1:38426680-38426702 GACTCAGCGATGCTTGGGGTTGG - Intergenic
907292532 1:53425872-53425894 GACTCAGCGACGCTTGGGGTTGG - Intergenic
907503667 1:54901976-54901998 GACTCAGAGGCGCTTGGGGTTGG + Intergenic
907521157 1:55024202-55024224 GACTCAGCGACGCTTGGGGTTGG - Intergenic
908522124 1:64954448-64954470 GATTAAGGTGTGCTTGGGGTAGG - Intronic
908592053 1:65645992-65646014 GACTCAGTGATGCTTGGGGTTGG + Intergenic
909035373 1:70589911-70589933 GACTCAGCGATGCTTGGGGTTGG - Intergenic
909223747 1:72991880-72991902 GACTCAGCGAAGCTTGGGGTTGG + Intergenic
909793073 1:79700436-79700458 GACTCAGTGATGCTTGGGGTTGG + Intergenic
909978548 1:82071607-82071629 GACTCAGCGATGCTTGGGGTTGG + Intergenic
911570306 1:99511239-99511261 GACTCAGCGATGCTTGGGGTTGG - Intergenic
911759889 1:101602182-101602204 GACTCAGCGATGCTTGGGGTTGG + Intergenic
911983751 1:104597565-104597587 GACTCAGCGATGCTTGGGGTTGG - Intergenic
912815421 1:112824639-112824661 GACTCAGCGATGCTTGGGGTTGG + Intergenic
913539244 1:119803131-119803153 GACCCAGCTGTGCTCCTGGATGG - Exonic
918347014 1:183615250-183615272 GACTCAGCGATGCTTGGGGTTGG - Intergenic
918567775 1:185952408-185952430 GACTCAGCGACGCTTGGGGTTGG + Intronic
918714504 1:187769590-187769612 GACTCAGCAACGCTTGGGGTTGG + Intergenic
918975340 1:191476736-191476758 GACTTAGCAGTGCTACTGGTGGG - Intergenic
919476300 1:198036395-198036417 GACTCAGCGATGCTTGGGGTTGG - Intergenic
920829302 1:209450538-209450560 GACTCAGCGACGCTTGGGGTTGG - Intergenic
920901636 1:210114930-210114952 GACTTAGCAATGCTTAGGGTTGG + Intronic
921212318 1:212911107-212911129 GACTCAGCGATGCTTGGGGTTGG - Intergenic
921520031 1:216147149-216147171 GACTCAGCGATGCTTGGGGTTGG - Intronic
921733071 1:218597900-218597922 GACTCAGCGAAGCTTGGGGTTGG + Intergenic
922048318 1:221967573-221967595 GACTCAGCGACGCTTGGGGTTGG - Intergenic
922049636 1:221977214-221977236 GACTCAGCGATGCTTGGGGTTGG + Intergenic
923075109 1:230602846-230602868 GACTCAGTGATGCTTGGGGTTGG - Intergenic
923244653 1:232119780-232119802 GACTCAGCGATGCTTGGGGTTGG - Intergenic
923257373 1:232233311-232233333 GACTCAGCGATGCTTGGGGTTGG + Intergenic
923408722 1:233687541-233687563 GACTCAGCGACGCTTGGGGTTGG + Intergenic
923770834 1:236936348-236936370 GACTCAGCCACGCTTGGGGTTGG + Intergenic
923841833 1:237681097-237681119 GACTCAGTTGTGATTCTGCTGGG + Intronic
924180559 1:241435576-241435598 GACTCGGCGATGCTTGGGGTTGG - Intergenic
924468236 1:244316862-244316884 GAGTCACCTGTGTTTCTGGTTGG - Intergenic
1063363015 10:5472380-5472402 GACTCAGCAATGCTTGGGGTTGG - Intergenic
1064095464 10:12421393-12421415 GACTCAGCTATACTGCGGCTAGG - Intronic
1064211837 10:13366416-13366438 ATCTGAGCTGTGCTTCGGGATGG - Intergenic
1064663910 10:17630921-17630943 GACTCAGCGCCGCTTGGGGTTGG + Intergenic
1065437533 10:25718007-25718029 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1065443290 10:25773316-25773338 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1065610434 10:27466686-27466708 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1068058446 10:52037872-52037894 GACTCAGCGATGCTTGGGGTTGG + Intronic
1068179753 10:53503143-53503165 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1068230874 10:54168357-54168379 GACTCAGCGATGCTTGGGGTTGG - Intronic
1068360682 10:55972780-55972802 GACTCAGCGATGCTTGAGGTTGG - Intergenic
1070474835 10:76820186-76820208 GACTCAGCGAAGCTTGGGGTTGG - Intergenic
1071897829 10:90085149-90085171 GACTCATCGATGCTTGGGGTTGG + Intergenic
1071916111 10:90296621-90296643 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1071961023 10:90809045-90809067 GACTCAGTGATGCTTGGGGTTGG - Intronic
1072580164 10:96733826-96733848 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1073394477 10:103206778-103206800 GACTCAGCAATGCTTGGGGTTGG - Intergenic
1074018921 10:109563923-109563945 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1074740674 10:116482248-116482270 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1075248602 10:120846468-120846490 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1077142373 11:1030247-1030269 GGAGCAGCTGTGCTGCGGGTTGG + Exonic
1077679221 11:4223730-4223752 GACTCAACTATGCTTGGGATTGG + Intergenic
1077688657 11:4320372-4320394 GACTCAACTATGCTTGGGATTGG + Intergenic
1077850891 11:6073947-6073969 GACTCAGAGATGCTTGGGGTTGG + Intergenic
1077883251 11:6367383-6367405 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1078062220 11:8055617-8055639 GACTCAGCTCTGCTGCTGATGGG + Intronic
1079727172 11:23891298-23891320 GACTCAGATACGCTTGGGGTTGG + Intergenic
1080745589 11:35105838-35105860 GCCTCAGCTATGCTTCTGGCAGG + Intergenic
1081356716 11:42122193-42122215 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1082197863 11:49325565-49325587 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1084232203 11:67761286-67761308 GACTCAGCAATGCTTGGGTTTGG - Intergenic
1084353954 11:68624461-68624483 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1084386403 11:68845367-68845389 GACTCAGCTGTGCTCTTGGCAGG - Intergenic
1084581104 11:70024059-70024081 GGCTCTGCTGTTCTTTGGGTTGG + Intergenic
1085934166 11:81123417-81123439 GACTCAGTGATGCTTAGGGTTGG - Intergenic
1086125402 11:83344217-83344239 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1086134934 11:83435704-83435726 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1086953084 11:92910408-92910430 GCTTCAGCTGGCCTTCGGGTGGG - Intergenic
1087314581 11:96589528-96589550 GACTCAGCCACGCTTGGGGTTGG - Intergenic
1088849768 11:113695292-113695314 GACTCTGCTGGGCCTGGGGTAGG - Intronic
1089349003 11:117810899-117810921 GACTCAGCGACGCTTGGGGTTGG - Intronic
1089472190 11:118730273-118730295 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1089741336 11:120586621-120586643 GACTCAGCGGTGCTTGGGATGGG + Intronic
1089953157 11:122548163-122548185 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1089987339 11:122826222-122826244 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1090526903 11:127546848-127546870 GACTTAGCTATGCTTGAGGTTGG + Intergenic
1090872050 11:130757601-130757623 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1091878902 12:3960489-3960511 GACTCAGCTGTGGTCTGGCTGGG + Intergenic
1092416271 12:8292661-8292683 GAGTCAGCGATGCTTGGGGTTGG + Intergenic
1092592845 12:9967189-9967211 GACTCAGCGATGCTTGGGGTTGG + Intronic
1092626845 12:10337038-10337060 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1092739423 12:11613805-11613827 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1093071261 12:14708979-14709001 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1093322078 12:17724395-17724417 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1093584614 12:20821096-20821118 GACTCAGCGACGCTTGGGGTTGG + Intronic
1094316158 12:29139146-29139168 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1094825663 12:34267244-34267266 GACTCAGCAATGCTTGGGGTTGG - Intergenic
1095637559 12:44451387-44451409 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1095999188 12:48114615-48114637 GACTCAGCAACGCTTGGGGTTGG + Intronic
1096590079 12:52652198-52652220 GACTCAACTGTGCTGCTGGGAGG + Intergenic
1097398489 12:59103456-59103478 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1097417150 12:59327324-59327346 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1097542292 12:60956105-60956127 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1097592287 12:61588462-61588484 GACTCAGCGATGCTTGAGGTTGG - Intergenic
1098173736 12:67770742-67770764 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1098402150 12:70087017-70087039 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1098628965 12:72704952-72704974 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1098630132 12:72713014-72713036 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1099188612 12:79541470-79541492 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1099292196 12:80787187-80787209 GACTCAGTGATGCTTTGGGTTGG + Intergenic
1099836199 12:87911519-87911541 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1099872643 12:88368906-88368928 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1100561246 12:95750691-95750713 GACTCAGCGACGCTTGGGGTTGG - Intronic
1100940199 12:99716777-99716799 GACTCAGCGACGCTTGGGGTTGG - Intronic
1102116909 12:110409797-110409819 GACTCAGCAATGCTTGGGGTTGG + Intergenic
1105032067 12:132890918-132890940 GACTCAGCGACGCTTGGGGTTGG - Intronic
1106943348 13:34800262-34800284 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1107608212 13:42083608-42083630 GGCTGAACTGGGCTTCGGGTTGG + Intronic
1107770700 13:43786138-43786160 GACTCCGCTCTGCTGCGGGCCGG - Intronic
1108202600 13:48057981-48058003 GACTCAGCGATGCTTGGGGTTGG - Intronic
1108512892 13:51171469-51171491 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1108574502 13:51779688-51779710 GACACAGCTGGGCTTTGGGAGGG - Intronic
1108913514 13:55582355-55582377 GACTCAGCAATGCTTGGGGTTGG + Intergenic
1108919644 13:55659084-55659106 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1108953046 13:56116528-56116550 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1109499197 13:63214725-63214747 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1109709757 13:66145447-66145469 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1109716847 13:66230484-66230506 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1111301948 13:86360010-86360032 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1111458938 13:88516918-88516940 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1112143333 13:96670883-96670905 GACACAGCTGTGCTTCTTGGGGG + Intronic
1112286211 13:98106802-98106824 GATTCAGCTGAACTTCAGGTTGG + Intergenic
1112889419 13:104212181-104212203 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1116490694 14:45499525-45499547 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1116613412 14:47105775-47105797 GACTCAGCGATGCTTGGGGTTGG - Intronic
1116702503 14:48259505-48259527 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1116952820 14:50894788-50894810 GACTCAGCGACGCTTGGGGTTGG - Intronic
1117958018 14:61137553-61137575 GACTCAGTAATGCTTGGGGTTGG + Intergenic
1119022327 14:71125896-71125918 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1119317100 14:73705094-73705116 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1119547193 14:75480455-75480477 GACCCTGCTCTGCTTCAGGTGGG + Intergenic
1121703551 14:95974547-95974569 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1122976042 14:105171164-105171186 GAGTAAGCTGTGCTTCCGCTGGG + Intergenic
1125045679 15:35240387-35240409 GACTCAGTGATGCTTGGGGTTGG - Intronic
1125131613 15:36289750-36289772 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1125213323 15:37240331-37240353 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1126530257 15:49703255-49703277 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1126843647 15:52740190-52740212 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1126912498 15:53430929-53430951 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1127115063 15:55718403-55718425 GACTCAGCAACGCTTGGGGTTGG - Intronic
1130855018 15:87832875-87832897 GACTCAGCGATGCTTGGGCTTGG - Intergenic
1130947577 15:88560584-88560606 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1132262918 15:100441874-100441896 GACTCAGCGACGCTTGGGGTTGG - Intronic
1132340308 15:101074143-101074165 GACTCAGCGATGCTTGGGGTTGG - Intronic
1133142144 16:3753874-3753896 GACTCACCTGTGATTACGGTGGG - Intronic
1133766818 16:8843913-8843935 GACTCAGCAACGCTTGGGGTTGG + Intronic
1134342281 16:13356675-13356697 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1137055489 16:35744425-35744447 GACTCAGCAGTGCTTGGGGTTGG + Intergenic
1137363329 16:47840099-47840121 GACTCAGCGATGCTTGGGCTTGG - Intergenic
1139039329 16:62983262-62983284 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1141865310 16:86746131-86746153 GACTCAGCAATGCTTGGGGTTGG + Intergenic
1142756360 17:2018674-2018696 GACTCAGCAGTGCGCCGGCTGGG + Intronic
1144104574 17:11973524-11973546 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1146597799 17:34184878-34184900 GACTCAGCTATGCTTGGGGTTGG - Intergenic
1151839856 17:76610046-76610068 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1152303504 17:79508574-79508596 GACTCATCTGGGGTTGGGGTGGG + Intronic
1152561952 17:81083074-81083096 GACTCAGCTGTGCTTTGAGGAGG + Intronic
1152587162 17:81194252-81194274 GACTCAGCTGTGCTTCGGGTTGG - Intronic
1153963210 18:10157726-10157748 GTCTCAGCTGAGCTTCTGGGTGG - Intergenic
1155202114 18:23526474-23526496 GGCTCAGCTCTGCTTTGGTTAGG + Intronic
1155697114 18:28697192-28697214 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1155941446 18:31805379-31805401 GACTCAGTGGCGCTTGGGGTTGG - Intergenic
1156227038 18:35119335-35119357 GACAGAGCTGGGCTGCGGGTGGG - Intronic
1156252031 18:35360442-35360464 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1156958084 18:42992474-42992496 GACTCAGCAACGCTTGGGGTTGG - Intronic
1157156663 18:45274189-45274211 GAATCAGCTGTGATTTGGCTGGG + Intronic
1157906502 18:51574179-51574201 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1158394742 18:57070735-57070757 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1159164367 18:64683234-64683256 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1161661623 19:5550090-5550112 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1161711111 19:5848655-5848677 GACTCAGCAACGCTTGGGGTTGG - Intronic
1163900378 19:20095108-20095130 GACTCAGCGATGCTTGGGGTTGG + Intronic
1163944553 19:20523189-20523211 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1164152874 19:22569844-22569866 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1165497100 19:36159493-36159515 GACTCAGCAATGCTTGGGGTTGG + Intergenic
1165994070 19:39832533-39832555 GACTCTGCTGTGGTTTGGGAGGG - Intronic
1166499036 19:43327594-43327616 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1166927248 19:46277466-46277488 GACTCAGCAATGCTTGGGGTTGG + Intergenic
1167099316 19:47394281-47394303 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1167902049 19:52629374-52629396 GACTCAGCGATGCTTGGGGTTGG - Intronic
1168051490 19:53832882-53832904 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1168212217 19:54899020-54899042 GACTCAGCGATGCTTGGGGTTGG + Intergenic
925507858 2:4588905-4588927 GACTCAGCTGTGGTGGGGGAAGG + Intergenic
925544453 2:5002584-5002606 GACTCAGCGACGCTTGGGGTTGG - Intergenic
925828920 2:7876767-7876789 GACTCAGCGACGCTTGGGGTTGG + Intergenic
926407678 2:12571377-12571399 GACTCAGCGATGCTTGGGGTTGG - Intergenic
926464183 2:13168080-13168102 GACTCAGCAACGCTTGGGGTTGG + Intergenic
927134063 2:20083898-20083920 GACTCAGCAACGCTTGGGGTTGG - Intergenic
928827751 2:35441201-35441223 GACTCAGAGATGCTTGGGGTTGG + Intergenic
928948834 2:36796468-36796490 GACTCAGCTGTGTATGTGGTAGG + Intronic
929004931 2:37385099-37385121 GACCCAGCAATGCTTGGGGTTGG + Intergenic
929955985 2:46459132-46459154 GACTCAGCTGTTTTGAGGGTAGG - Intronic
930099224 2:47590165-47590187 GACTCAGCGATGCTTGGGGTTGG + Intergenic
930217896 2:48715717-48715739 GTCTCAGCTGTGTTGTGGGTTGG - Intronic
930505903 2:52282658-52282680 GACACAGCTGTCCTTCTGCTAGG - Intergenic
930955002 2:57194587-57194609 GACTCAGCTACGCTTGGGGTTGG - Intergenic
930958281 2:57230464-57230486 GACTCAGTGATGCTTGGGGTTGG - Intergenic
931026488 2:58117503-58117525 GACTCAGCGACGCTTGGGGTTGG + Intronic
931166651 2:59756168-59756190 GACTCAGCTTTGGCTAGGGTGGG - Intergenic
931625677 2:64254151-64254173 GACTCAGCGACGCTTGGGGTTGG - Intergenic
931850327 2:66245547-66245569 GACTCAGCGATACTTGGGGTTGG - Intergenic
931948161 2:67333196-67333218 GACTCAGCGATGCTTGGGGTTGG - Intergenic
932295758 2:70622238-70622260 GACTCAGCGATGCTTGGGGTTGG - Intronic
932358913 2:71089135-71089157 GACTCAGCGACGCTTGGGGTTGG + Intergenic
932367743 2:71163775-71163797 GACTCAGCGACGCTTGGGGTTGG + Intergenic
932854308 2:75217896-75217918 GACTCAGCGACGCTTGGGGTTGG + Intergenic
932974049 2:76577958-76577980 GACTCAGCGACGCTTGGGGTTGG + Intergenic
933163634 2:79052991-79053013 GACTCAGTGATGCTTGGGGTTGG - Intergenic
933552496 2:83793022-83793044 GACTCAGCGACGCTTGGGGTTGG + Intergenic
936794392 2:116188356-116188378 GACTCAGCAATGCTTGGGGTTGG + Intergenic
936883243 2:117280360-117280382 GACTCAGCGATGCTTGGGGTTGG - Intergenic
937297538 2:120818602-120818624 GACTCAGGAGTGATTCGTGTTGG - Intronic
939083243 2:137687077-137687099 GACTCAGCAAAGCTTGGGGTTGG + Intergenic
939307309 2:140427736-140427758 GACTCAGTGATGCTTGGGGTTGG - Intronic
940530089 2:154868926-154868948 GACTCAGCGACGCTTGGGGTTGG - Intergenic
940675904 2:156724175-156724197 GACTCAGCGACGCTTGGGGTTGG + Intergenic
941340307 2:164297472-164297494 GACTCAGCGATGCTTGGGGTTGG - Intergenic
941353291 2:164460733-164460755 GACTCAGCGACGCTTGGGGTTGG - Intergenic
941935997 2:170981767-170981789 GACTCAGCGACACTTCGGGTTGG + Intergenic
942096988 2:172543330-172543352 GACTCAGCGATGCTTGGGGTTGG - Intergenic
942730388 2:179055867-179055889 GACTCAGCGACGCTTGGGGTTGG + Intergenic
943161244 2:184254550-184254572 GATGCAGCTGTGCTACTGGTAGG + Intergenic
943413031 2:187564584-187564606 GACTCAGCGATGCTTGGGGTTGG + Intronic
943421677 2:187674564-187674586 GACTCAGCGACGCTTGGGGTTGG + Intergenic
943865258 2:192919654-192919676 GACTCAGTGATGCTTGGGGTTGG - Intergenic
943951397 2:194135015-194135037 GACTCAGCGATGCTTGGGGTTGG + Intergenic
944250925 2:197579691-197579713 GACTCAGTGATGCTTGGGGTTGG - Intronic
944387347 2:199180976-199180998 GACTCAGCGATGCTTGGGGTTGG - Intergenic
944394036 2:199248530-199248552 GACTCAGCGATGCTTGGGGTTGG - Intergenic
945153201 2:206810947-206810969 GACTCAGCGACGCTTGGGGTTGG + Intergenic
945376009 2:209079680-209079702 GACTCAGCGACGCTTGGGGTTGG - Intergenic
945887186 2:215388545-215388567 GACTCAGCTGGATTTCGAGTGGG + Intronic
945938213 2:215923976-215923998 GACTCAGCGACGCTTGGGGTTGG - Intergenic
945975017 2:216263762-216263784 GACACAGCCATGCTTCAGGTAGG + Intronic
946208846 2:218130966-218130988 TGCTCAGCTGTGCTGGGGGTGGG - Intronic
946215130 2:218178122-218178144 GACTCAGCGACGCTTGGGGTTGG + Intergenic
946781143 2:223193959-223193981 GACTCAGCAATGCTTGGGGTTGG + Intronic
948315563 2:237026029-237026051 GCCTCAGCTGTGCTTGGGGGTGG + Intergenic
949021766 2:241744777-241744799 GAAGCAGCTGTTCATCGGGTCGG + Exonic
1168739245 20:174112-174134 GACTCAGCAATGCTTGGGATTGG - Intergenic
1168790797 20:574570-574592 GACTCAGGTGACCTTCAGGTTGG + Intergenic
1168943426 20:1732224-1732246 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1170325583 20:15151952-15151974 GACTCAGCGACGCTTGGGGTTGG + Intronic
1170740309 20:19050101-19050123 GACTCTGGTGTACTTCTGGTGGG + Intergenic
1170820799 20:19755219-19755241 GACTCAGCGCCGCTTGGGGTTGG + Intergenic
1173101813 20:40094961-40094983 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1173118774 20:40270677-40270699 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1173651874 20:44671575-44671597 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1173781577 20:45761018-45761040 GACTCAGCAACGCTTGGGGTTGG - Intronic
1173905634 20:46626590-46626612 GCCTCAGCTGAGCTTCCTGTGGG + Intronic
1174042993 20:47713148-47713170 CACACAGATGTGCTTCAGGTTGG - Intronic
1176111703 20:63413884-63413906 GACTCAGGCGGGTTTCGGGTGGG - Intronic
1177031280 21:15983929-15983951 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1177119467 21:17123071-17123093 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1178001094 21:28162769-28162791 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1179015388 21:37591137-37591159 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1180560804 22:16612864-16612886 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1180609674 22:17086905-17086927 GACTCTGCTGTGCGTGGCGTGGG + Intronic
1182113848 22:27743590-27743612 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1182732178 22:32504394-32504416 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1182998500 22:34835908-34835930 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1183781268 22:40000438-40000460 GACTCAGCTTTGCATATGGTGGG + Intronic
949190486 3:1243885-1243907 GACTCAGCGATGCTTGGGGTTGG + Intronic
951298910 3:20971628-20971650 GACTCAGCAACGCTTGGGGTTGG + Intergenic
951762903 3:26164502-26164524 GACTCAGTGATGCTTGGGGTTGG + Intergenic
952343656 3:32465525-32465547 GACTCAGCGACGCTTGGGGTTGG + Intronic
952663559 3:35878461-35878483 GACTCAGCGACGCTTGGGGTTGG + Intergenic
953825801 3:46250384-46250406 GACTCAGCGATGCTTGGGGTTGG + Intronic
955253262 3:57305273-57305295 GACTCAGCGACGCTTGGGGTTGG - Intronic
956233603 3:67042837-67042859 GACTCAGCGATGCTTGGGGTTGG + Intergenic
956549086 3:70438982-70439004 GACTCAGGGATGCTTGGGGTTGG + Intergenic
957059992 3:75474150-75474172 GACTCAGTGATGCTTGGGGTTGG + Intergenic
957295142 3:78325483-78325505 GACTCAGCGATGCTTGGGGTTGG - Intergenic
957317408 3:78587253-78587275 GACTCAGCGATGCTTGGGGTTGG + Intergenic
958181917 3:90071773-90071795 GACTCAGTGATGCTTGGGGTTGG + Intergenic
958750902 3:98192550-98192572 GACTCAGTGATGCTTGGGGTTGG - Intronic
960282976 3:115797595-115797617 GACTCAGCAATGCTTGGGGTTGG + Intergenic
960310214 3:116109410-116109432 GACTCAGCAACGCTTGGGGTTGG + Intronic
960948521 3:122983227-122983249 GACTTAGATGTACTTCTGGTTGG - Intronic
960974214 3:123159462-123159484 GAGGCAGCTGTCCTTCAGGTAGG - Intronic
961164863 3:124756644-124756666 GACTCAGCGACGCTTGGGGTTGG + Intergenic
961880954 3:130060876-130060898 GACTCAGCAATGCTTGGGTTTGG - Intergenic
962022284 3:131513230-131513252 GACTCAGTGATGCTTGGGGTTGG + Intergenic
962205461 3:133430743-133430765 GACTCAGCGACGCTTGGGGTTGG - Intronic
962524122 3:136222384-136222406 GACTCAGCGACGCTTGGGGTTGG + Intergenic
963111949 3:141695402-141695424 GACTCAGCAATGCTTGGGGTTGG + Intergenic
963425114 3:145114549-145114571 GACTCAGCGATGCTTGGGGTTGG - Intergenic
963468513 3:145711968-145711990 GACTCAGCGATGCTTTGGGTTGG - Intergenic
963520349 3:146355148-146355170 GACTCAGCAACGCTTGGGGTTGG - Intergenic
963521526 3:146363646-146363668 GACTCAGCAACGCTTGGGGTTGG - Intergenic
963663237 3:148153254-148153276 GACTCAGCGATGCTTGGGGTTGG - Intergenic
963684230 3:148415951-148415973 GACTCAGCGATGCTTGGGGTTGG - Intergenic
964067726 3:152598595-152598617 GACTCAGCAATGCTTGGGGTTGG - Intergenic
964125559 3:153230831-153230853 GACTCAGCGACGCTTGGGGTTGG + Intergenic
964300347 3:155279301-155279323 GACTCAGCGATGCTTGGGGTTGG + Intergenic
964941064 3:162158287-162158309 GACTCAGAGATGCTTGGGGTTGG + Intergenic
964983539 3:162713976-162713998 GACTCAGCGACGCTTGGGGTTGG - Intergenic
965262757 3:166504919-166504941 GACTCAGTGATGCTTGGGGTTGG + Intergenic
965286829 3:166828195-166828217 GACTCAGCAATGCTTCGGGTTGG + Intergenic
965334962 3:167423803-167423825 GACTCAGCTACACTTGGGGTTGG - Intergenic
965640148 3:170822094-170822116 GACTCAGCGACGCTTGGGGTTGG + Intronic
965713302 3:171578019-171578041 GACTCAGTGATGCTTGGGGTTGG - Intergenic
966066746 3:175829327-175829349 GACTCAGCGACGCTTGGGGTTGG - Intergenic
966085340 3:176062929-176062951 GACTCAGCAATGCTTGGGGTTGG - Intergenic
966105185 3:176325715-176325737 GACTCAGCAATGCTTGGGGTTGG + Intergenic
966232945 3:177669938-177669960 GACTCAGTGATGCTTGGGGTTGG + Intergenic
967151990 3:186659227-186659249 GACTCAGCAACGCTTGGGGTTGG - Intergenic
967212264 3:187179619-187179641 GACTCAGCGACGCTTGGGGTTGG + Intronic
967244267 3:187470382-187470404 GACTCAGCGACGCTTGGGGTTGG + Intergenic
967496119 3:190146124-190146146 GACTCAGCGACGCTTGGGGTTGG - Intergenic
967658211 3:192075190-192075212 GACTCAGCAATGCTTGGGGTTGG + Intergenic
967740384 3:192997256-192997278 GACTCAGCAATGCCTGGGGTTGG - Intergenic
968502229 4:956110-956132 TCCTCGGCTGTGCTTGGGGTGGG - Intronic
968993288 4:3928980-3929002 GACTCAGCGATGCTTGGGTTTGG - Intergenic
970256522 4:14174622-14174644 GACTCAGCGGCGCTTGGGGTTGG + Intergenic
970854144 4:20634380-20634402 GACTCAGCGACGCTTGGGGTTGG + Intergenic
971123284 4:23726128-23726150 GACTCAGCGACGCTTGGGGTTGG + Intergenic
971180457 4:24324828-24324850 GACTCAGCGACGCTTGGGGTTGG - Intergenic
971418099 4:26452122-26452144 AACTCAGCTGTGTTTTGGGGTGG + Intergenic
972199580 4:36698366-36698388 AACTCAACTCTGCTTCGGGAAGG + Intergenic
972954812 4:44376182-44376204 GACTCTGGTGTGCTTCCTGTGGG - Intronic
974173525 4:58295456-58295478 GACTCAGCGATGCTTGGGATTGG + Intergenic
974428495 4:61768384-61768406 GACTCAGCGACGCTTGGGGTCGG + Intronic
975865188 4:78717968-78717990 GACTCAGCGACGCTTGGGGTTGG + Intergenic
976095087 4:81500109-81500131 AACTCTGCTGTCCTTCTGGTTGG + Intronic
976191761 4:82494007-82494029 GAATCAGCAGTGCTGAGGGTAGG + Intronic
976558473 4:86476163-86476185 GACTCAGCAATGCTTGGGGTTGG - Intronic
977010215 4:91625691-91625713 GACTCAGCGAGGCTTGGGGTTGG - Intergenic
977041921 4:92027445-92027467 GACTCAGCGATGCTTGGGGTTGG - Intergenic
977075311 4:92443070-92443092 GACTCAGCGAGGCTTGGGGTTGG + Intronic
977198528 4:94088719-94088741 GACTCAGCGACGCTTGGGGTTGG + Intergenic
977817566 4:101432627-101432649 GTCTCAGCTGGGTTTAGGGTGGG + Intronic
978001216 4:103557858-103557880 GACTCAGCGATGCTTGGGGTTGG + Intergenic
978438512 4:108710627-108710649 GACTCAGCGACGCTTGGGGTTGG - Intergenic
979054725 4:115979764-115979786 GACTCAGCGACGCTTGGGGTTGG + Intergenic
979379835 4:119995522-119995544 GACTCAGTGATGCTTGGGGTTGG - Intergenic
979850408 4:125565746-125565768 GACTCAGTGATGCTTGGGGTTGG + Intergenic
980003449 4:127515581-127515603 GACTCAGCGATGCTTGGGGTTGG + Intergenic
980284853 4:130768949-130768971 GACTCAGTGATGCTTGGGGTTGG - Intergenic
980388820 4:132119803-132119825 GACTCAGTGATGCTTGGGGTTGG - Intergenic
980472538 4:133267814-133267836 GACTCAGCGACGCTTGGGGTTGG + Intergenic
980611874 4:135171387-135171409 GACTCAGCGAAGCTTGGGGTTGG + Intergenic
980774722 4:137422944-137422966 GACTCAGCTGTCCTACTGGGAGG + Intergenic
980903834 4:138929475-138929497 GACTCAGCGATGCTTGGGGTTGG - Intergenic
981525104 4:145700723-145700745 GACTCAGCGACGCTTGGGGTTGG - Intronic
982180576 4:152745448-152745470 GACTCAGCGACGCTTGGGGTTGG + Intronic
982414295 4:155112558-155112580 GACTCAGCGACGCTTGGGGTTGG + Intergenic
983023766 4:162710702-162710724 GACTCAGCGACGCTTGGGGTTGG - Intergenic
983055388 4:163094705-163094727 GACTCAGCGACGCTTGGGGTTGG - Intergenic
983414813 4:167439915-167439937 GACTCAGCAACGCTTGGGGTTGG + Intergenic
983659480 4:170118055-170118077 GACTCAGCGACGCTTGGGGTTGG - Intergenic
983707580 4:170679080-170679102 GACTCAGCGATGCTTGGGGTTGG - Intergenic
983729200 4:170972167-170972189 TACTGAGCTGTGGTTGGGGTGGG + Intergenic
983883869 4:172960522-172960544 GACTCAGCGACGCTTGGGGTTGG + Intronic
984165458 4:176298973-176298995 GACTCAGTGATGCTTGGGGTTGG + Intergenic
984393711 4:179168985-179169007 GACTCAGCTACGCTTGGGGTTGG + Intergenic
984437163 4:179722032-179722054 GACTCAGTGATGCTTGGGGTTGG - Intergenic
984665945 4:182430087-182430109 GACGCAGCTGTGTTTGTGGTCGG + Intronic
984700564 4:182816122-182816144 GACTCAGCGACGCTTGGGGTTGG - Intergenic
985057495 4:186048328-186048350 GACTCAGCAACGCTTGGGGTTGG + Intergenic
985435627 4:189927436-189927458 GACTCAGCAATGCTTGGGGTTGG - Intergenic
985489969 5:173441-173463 GACTCGGCTGTGCTGAGGGAGGG + Intronic
985912952 5:2897369-2897391 GACACAGGTGTGCTTCAGGGCGG - Intergenic
986388782 5:7265201-7265223 GACTCAGCGACGCTTGGGGTTGG - Intergenic
986769161 5:10956175-10956197 GACTCAGCTGTGTCTCTGCTGGG - Intergenic
987487408 5:18539923-18539945 GACTCAGCGCCGCTTGGGGTTGG - Intergenic
987498225 5:18672953-18672975 GACTCAGCGACGCTTGGGGTTGG + Intergenic
991546955 5:67793140-67793162 GGCTCAGCTGTGGTCAGGGTTGG - Intergenic
992394563 5:76358952-76358974 GACTCAGCGATGCTTGGGGTTGG - Intergenic
992403445 5:76432668-76432690 GACTGAGCTGTGCTCTGGCTGGG + Intronic
992960734 5:81954876-81954898 GACTCAGCAACGCTTGGGGTTGG - Intergenic
993836607 5:92825596-92825618 GACTCAGCGATGCTTGGGGTTGG - Intergenic
994295045 5:98080653-98080675 GACTCAGCGACGCTTGGGGTTGG - Intergenic
994532638 5:100988349-100988371 GACTCAGCGATGCTTGGGGTTGG + Intergenic
994775589 5:104033223-104033245 GACTCAGTGATGCTTGGGGTTGG - Intergenic
994779099 5:104068646-104068668 GACTCAGCAACGCTTGGGGTTGG + Intergenic
996203356 5:120701701-120701723 GACTCAGCAACGCTTGGGGTTGG + Intergenic
997769776 5:136543724-136543746 GACTCAGCGACGCTTGGGGTTGG + Intergenic
997772740 5:136569444-136569466 GACTCAGCGACGCTTGGGGTTGG + Intergenic
997788841 5:136738475-136738497 GACTCAGTGATGCTTAGGGTTGG - Intergenic
998693804 5:144615475-144615497 GACTCAGCGACGCTTGGGGTTGG + Intergenic
998693816 5:144615546-144615568 GACTCAGTGATGCTTGGGGTTGG + Intergenic
999618964 5:153453805-153453827 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1000439626 5:161250081-161250103 GACTCAGGAATGCTTGGGGTTGG - Intergenic
1000519513 5:162279487-162279509 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1001354621 5:171007515-171007537 GACTCAGCGATGCTTGGGGTTGG + Intronic
1002611066 5:180418836-180418858 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1002865055 6:1114564-1114586 GATTCAGCTGTTCATAGGGTTGG - Intergenic
1003430270 6:6031892-6031914 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1004106162 6:12668984-12669006 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1004283625 6:14301061-14301083 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1004508095 6:16263102-16263124 GACTCAGCGACGCTTGGGGTTGG + Intronic
1004836903 6:19540492-19540514 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007348122 6:41248455-41248477 GAGTCAGCTGAGCTTAGGGCAGG + Intergenic
1008397432 6:51025260-51025282 GAATCAGCTGTGCTGCGGAGAGG - Intergenic
1008476416 6:51939747-51939769 GACTCAGTGATGCTTGGGGTTGG - Intronic
1008562937 6:52739794-52739816 GACTCAGCTGGTCTTTGTGTAGG - Intergenic
1009750105 6:67871275-67871297 GACTCAGCAATGCTTGGGATTGG - Intergenic
1009750408 6:67873086-67873108 GACTCAGCAATGCTTGGGATTGG + Intergenic
1010071828 6:71752689-71752711 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1010586797 6:77664647-77664669 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1010827014 6:80486533-80486555 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1010841419 6:80651954-80651976 GACTCAGCAATGCTTGGGGTTGG + Intergenic
1011771045 6:90674322-90674344 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1012014491 6:93834188-93834210 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1012315723 6:97781196-97781218 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1013808240 6:114016813-114016835 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1014370962 6:120606993-120607015 GACTTTTCTGTCCTTCGGGTAGG - Intergenic
1014611980 6:123558208-123558230 GACTCAGTGATGCTTGGGGTTGG - Intronic
1014614769 6:123586388-123586410 GACTCAGTGATGCTTGGGGTTGG + Intronic
1014718795 6:124893651-124893673 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1014734705 6:125078814-125078836 GAGGCAGCTGTGCTTGGGGTGGG - Intronic
1014891447 6:126850367-126850389 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1015288135 6:131508390-131508412 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1015801477 6:137065448-137065470 GACTCAGCAATGCTTGGAGTTGG + Intergenic
1016114247 6:140261518-140261540 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1016248761 6:142017414-142017436 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1016518706 6:144924792-144924814 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1017090222 6:150752789-150752811 CACTCAGTTTTGCTTTGGGTTGG - Intronic
1018084604 6:160290681-160290703 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1018521577 6:164656262-164656284 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1019524477 7:1474536-1474558 GACTGAGCTGGGCCTCAGGTGGG - Intronic
1019978395 7:4603037-4603059 GGCTCAGCTGTGCCTCGTATTGG - Intergenic
1020315946 7:6905389-6905411 GACTCAGCAATGCTTGGGTTTGG - Intergenic
1020541228 7:9462626-9462648 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1021977993 7:26028280-26028302 GACTCAGCGATGCTTGGCGTTGG + Intergenic
1022106543 7:27201084-27201106 GCCCCAGCTGTGCTTCTGGCTGG + Intergenic
1022708961 7:32833962-32833984 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1022854810 7:34303987-34304009 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1023698991 7:42874718-42874740 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1026977441 7:74507122-74507144 GACCCAGCTGGGCTTCAGGTTGG + Intronic
1027851846 7:83461268-83461290 GACTCAGCAATGCTTGGGGTTGG - Intronic
1028690078 7:93641464-93641486 GACTCAGCGACGCTTGGGGTTGG - Intronic
1030751603 7:113237674-113237696 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1031004571 7:116457098-116457120 GACTCAGCGACGCTTGGGGTTGG - Intronic
1031399890 7:121317186-121317208 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1031422561 7:121568125-121568147 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1031525493 7:122818520-122818542 GACTCAGTGATGCTTGGGGTTGG - Intronic
1031685747 7:124730629-124730651 GACTCAGAGATGCTTGGGGTTGG - Intergenic
1031776227 7:125911588-125911610 GACTCAGCGATGCTTTGGGTTGG - Intergenic
1033211414 7:139462848-139462870 GACTCAGCAATGCTTGGGGTTGG - Intronic
1033465147 7:141582933-141582955 GACTCAGCAATACTTGGGGTTGG + Intronic
1033676055 7:143541332-143541354 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1033695780 7:143788107-143788129 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1033909563 7:146247470-146247492 GACTCAGCGAAGCTTGGGGTTGG + Intronic
1034427850 7:151023996-151024018 GACTCTCCTGGGCTGCGGGTAGG - Exonic
1035880766 8:3242338-3242360 GACTCAGCGACGCTTGGGGTTGG + Intronic
1036472437 8:9063568-9063590 GACTCAGCGATGCTTGGGGTTGG + Intronic
1036639388 8:10572861-10572883 GACTTAGCGATGCTTGGGGTTGG - Intergenic
1037159573 8:15751821-15751843 GACTCAGCTGTGCATGGTGTAGG - Intronic
1037966596 8:23138947-23138969 TATTCAGCTGTGCTTAGGGAAGG - Intronic
1040647915 8:49421049-49421071 GACTCAGCAATGCTTGGGGTTGG - Intergenic
1042453451 8:68974772-68974794 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1042707261 8:71676512-71676534 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1043353770 8:79390201-79390223 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1043598739 8:81914998-81915020 GACTCAGCAATGCTTGGGGTTGG - Intergenic
1043717997 8:83509239-83509261 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1043837627 8:85064544-85064566 GACTCAGCAATGCTTGGGTTTGG - Intergenic
1044258716 8:90094301-90094323 GACTCAGCAACGCTTGGGGTTGG + Intronic
1044921888 8:97176695-97176717 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1046443150 8:114283592-114283614 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1046511980 8:115213826-115213848 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1046559175 8:115816204-115816226 GACTCAGCACTGCTTGGGGTTGG - Intergenic
1047699256 8:127433342-127433364 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1047901673 8:129429925-129429947 GAATCAGCTGTGATTCTGGGGGG + Intergenic
1048097514 8:131311787-131311809 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1048135372 8:131742313-131742335 GACTCAGCAATGCTTGGGGTTGG - Intergenic
1048143673 8:131820770-131820792 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1048168542 8:132084348-132084370 GACTCAGCGACGCTTGGGGTTGG + Intronic
1049770474 8:144378281-144378303 GACTCAGATGAGCTTTGGGTGGG - Intronic
1050474056 9:6021549-6021571 GACTCAGCGAAGCTTGGGGTTGG - Intergenic
1051052522 9:12949920-12949942 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1051849388 9:21489797-21489819 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1051953502 9:22662644-22662666 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1052162986 9:25289287-25289309 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1052191731 9:25670515-25670537 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1052653226 9:31327979-31328001 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1053057920 9:35005060-35005082 GACTCAGTGATGCTTGGGGTTGG - Intergenic
1054807587 9:69408875-69408897 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1055626622 9:78182398-78182420 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1055809949 9:80139009-80139031 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1055881654 9:81010595-81010617 GACTCAGCAATGCTTGAGGTTGG - Intergenic
1056044837 9:82704806-82704828 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1056323782 9:85460246-85460268 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1056437337 9:86587406-86587428 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1057234741 9:93349205-93349227 GACTCAGCGATGCTTGGGATTGG - Intergenic
1057377887 9:94541442-94541464 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1057812685 9:98269956-98269978 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1058026311 9:100144814-100144836 GACTCAGCGACGCTTGGGGTTGG + Intronic
1059546267 9:115178765-115178787 GACTCAGCGACGCTTGGGGTTGG + Intronic
1059574523 9:115474977-115474999 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1059606810 9:115843315-115843337 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1059863589 9:118489784-118489806 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1060318568 9:122534709-122534731 GACTCAGCGATGCTTGGGGTTGG + Intergenic
1060737981 9:126078750-126078772 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1062125810 9:134861782-134861804 CACCCAGCTGTGGTTCAGGTGGG + Intergenic
1185990958 X:4893206-4893228 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1186112975 X:6276298-6276320 GACTCAGCAATGCTTGGGGTTGG + Intergenic
1187398449 X:18938275-18938297 AACTCAGCTGTGCTATTGGTGGG - Intronic
1188301165 X:28506543-28506565 GACTCAGCAACGCTTAGGGTTGG + Intergenic
1188419384 X:29976873-29976895 GACTCAGCGATGCTTGGGTTTGG - Intergenic
1188430926 X:30104941-30104963 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1188463477 X:30453191-30453213 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1188552552 X:31379114-31379136 GACTGAGCGATGCTTGGGGTTGG - Intronic
1192706032 X:73529229-73529251 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1193941394 X:87683492-87683514 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1194351188 X:92826102-92826124 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1194367003 X:93024534-93024556 GACTCAGCGATGCTGGGGGTTGG - Intergenic
1194503084 X:94702928-94702950 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1195688294 X:107604259-107604281 GACTTAGCTGTGGATCGGGGAGG + Exonic
1195841380 X:109180008-109180030 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1195908776 X:109869309-109869331 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1196072983 X:111545518-111545540 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1196165443 X:112532217-112532239 GACTCAGCAACGCTTGGGGTTGG - Intergenic
1196330724 X:114468364-114468386 GACTCAGCAATGCTTGGGGTTGG - Intergenic
1196341817 X:114605411-114605433 GACTCAGCAATGCTTGGGGTTGG + Intronic
1196572407 X:117280777-117280799 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1196773953 X:119321859-119321881 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1196992795 X:121347125-121347147 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1197064811 X:122223636-122223658 GACTCAGCGACGCTTGGGGTTGG - Intergenic
1197352162 X:125392960-125392982 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1197470863 X:126864694-126864716 GACTCAGCAATGCTTGGGCTTGG - Intergenic
1197499616 X:127228159-127228181 GACTCAGCTACGCTTGGGGTTGG - Intergenic
1197793538 X:130278629-130278651 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1198564822 X:137893699-137893721 CATTCTGCTGTGCTTCTGGTGGG + Intergenic
1198599494 X:138268403-138268425 GACTCAGTGATGCTTGGGGTTGG + Intergenic
1198965815 X:142228109-142228131 GACTCAGCGACGCTTAGGGTTGG - Intergenic
1198983854 X:142427673-142427695 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1199377728 X:147133244-147133266 GACTCAGCAACGCTTGGGGTTGG + Intergenic
1200532939 Y:4359490-4359512 GACTCAGCGACGCTTGGGGTTGG + Intergenic
1200611238 Y:5328871-5328893 GACTCAGCGACGCTTGGGGTTGG + Intronic
1200675224 Y:6140790-6140812 GACTCAGCGATGCTGGGGGTTGG - Intergenic
1201936987 Y:19420182-19420204 GACTCAGCGATGCTTGGGGTTGG - Intergenic
1202061951 Y:20897804-20897826 GACTCAGTGATGCTTGGGGTTGG - Intergenic