ID: 1152587279

View in Genome Browser
Species Human (GRCh38)
Location 17:81194682-81194704
Sequence TCTGCCGTGACCCGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152587279_1152587288 1 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587288 17:81194706-81194728 GCCGCAGCGGAGGCCGTGACGGG 0: 1
1: 0
2: 0
3: 10
4: 136
1152587279_1152587287 0 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587287 17:81194705-81194727 AGCCGCAGCGGAGGCCGTGACGG 0: 1
1: 0
2: 0
3: 8
4: 170
1152587279_1152587295 12 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587295 17:81194717-81194739 GGCCGTGACGGGGGTGGTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 427
1152587279_1152587292 6 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587292 17:81194711-81194733 AGCGGAGGCCGTGACGGGGGTGG 0: 1
1: 0
2: 4
3: 22
4: 300
1152587279_1152587290 2 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587290 17:81194707-81194729 CCGCAGCGGAGGCCGTGACGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
1152587279_1152587293 10 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587279_1152587286 -9 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587286 17:81194696-81194718 CACGGCAGAAGCCGCAGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 193
1152587279_1152587294 11 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587294 17:81194716-81194738 AGGCCGTGACGGGGGTGGTTGGG 0: 1
1: 0
2: 1
3: 3
4: 144
1152587279_1152587291 3 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587291 17:81194708-81194730 CGCAGCGGAGGCCGTGACGGGGG 0: 1
1: 0
2: 1
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152587279 Original CRISPR TCTGCCGTGACCCGGGGGGC AGG (reversed) Intronic
900206851 1:1435326-1435348 ACTGCCGTGACTCTGGGTGCTGG - Intronic
901242404 1:7703292-7703314 TGCGTGGTGACCCGGGGGGCGGG + Intronic
908195506 1:61742776-61742798 TCCGCGCTGACCCGGGAGGCGGG + Intronic
908620488 1:65974478-65974500 TCTGCCATGACCCAGGGAGAAGG - Intronic
910209490 1:84778630-84778652 TGGTCCGTGACCCGGGGGTCAGG - Intergenic
914689186 1:150010518-150010540 TCGGCAGTGACCCCGGGGTCCGG + Exonic
914911372 1:151790276-151790298 TCTGGCGTGCCCCGGGGCGAGGG - Intronic
920234680 1:204494803-204494825 TCCGCCGCGAGCCGGAGGGCGGG + Intergenic
920657232 1:207886109-207886131 TCTACTCTGACCTGGGGGGCTGG + Intronic
1063223594 10:3993493-3993515 TCTGCCGTGTCCTGAGAGGCAGG - Intergenic
1066661554 10:37741792-37741814 TGTGCCGGGACCCCGGGGACTGG + Intergenic
1070539427 10:77405805-77405827 TCTGCAGTGACAAAGGGGGCGGG + Intronic
1070565260 10:77599102-77599124 TCTGCCTTGCCCCAGTGGGCTGG + Intronic
1074144951 10:110709446-110709468 TCTGCCCTGACCCTGGGAGGAGG + Intronic
1075958524 10:126546364-126546386 TCTGCACTGAACCTGGGGGCAGG - Intronic
1076320821 10:129580205-129580227 CCTGCTGTGCCCGGGGGGGCGGG + Intronic
1076746784 10:132518465-132518487 ACTGCAGAGACCCTGGGGGCAGG + Intergenic
1083048041 11:59754229-59754251 ACGGCCGAGACCCGCGGGGCCGG + Intronic
1083159952 11:60848673-60848695 ACTGCCCTGCCCTGGGGGGCAGG - Intronic
1083652550 11:64211630-64211652 TCTGCCGCGGCCCAGGTGGCTGG + Exonic
1084572257 11:69966734-69966756 TCTGCAGGGTCCCAGGGGGCAGG - Intergenic
1084746061 11:71170699-71170721 TCTGCCGTGACCTTGGAGGTCGG - Intronic
1085119389 11:73957465-73957487 TCGGCAGTGACCCGGGGTGGGGG - Intronic
1085444491 11:76591472-76591494 TCTCCCGGCACCCGGGAGGCAGG - Intergenic
1089345166 11:117786439-117786461 TCAGCGGTGACCCTGGGGGCAGG - Intronic
1091037185 11:132244808-132244830 TGTGCAGTGAGCCGGTGGGCTGG - Intronic
1091223213 11:133943040-133943062 TCTGCCCTGCCTGGGGGGGCTGG - Intronic
1092187689 12:6493306-6493328 CCTGCCGGAACCCGGGGGGCGGG - Exonic
1096134554 12:49188663-49188685 TCTGCCGCGACCGAGGGGTCTGG - Intronic
1097988327 12:65807693-65807715 CATGCTGTGACCTGGGGGGCCGG - Intergenic
1100671082 12:96813725-96813747 TCTGCTGTGGCCTGGAGGGCAGG - Intronic
1100874857 12:98951155-98951177 TCTGCCCTGACCCCTGGAGCTGG + Intronic
1104909900 12:132235656-132235678 CCTGCCCTGTCCCGAGGGGCTGG - Intronic
1112261876 13:97884613-97884635 TCTGCTCTCACCCAGGGGGCTGG - Intergenic
1113494509 13:110715920-110715942 CCTCCCGCGACCCGCGGGGCCGG + Exonic
1113887504 13:113668549-113668571 CCTGGCGTGACGCCGGGGGCAGG + Intronic
1116973756 14:51094538-51094560 GCTGCGGTGACACTGGGGGCAGG + Exonic
1122393626 14:101407499-101407521 GCTGCCGTGAGCGTGGGGGCAGG - Intergenic
1122878117 14:104678108-104678130 TCTGCCGTCGCCGGGTGGGCGGG - Intergenic
1122923510 14:104889670-104889692 TCGTCCGTGTCCCGGGGGCCGGG - Exonic
1129895177 15:79099930-79099952 TCTGCTGTGTCCCAGGAGGCTGG + Intergenic
1132679888 16:1135368-1135390 TCTGCCCTGACCCCGGGGCCTGG + Intergenic
1134057825 16:11181403-11181425 TCTGCAGGGACTTGGGGGGCGGG - Exonic
1134441454 16:14301912-14301934 TCAGCCTCGACCCTGGGGGCGGG - Intergenic
1138325373 16:56161496-56161518 TCTGCTGTGATTCTGGGGGCTGG + Intergenic
1140044533 16:71431881-71431903 TGTGCCCTGACCTGGGGGGTGGG + Intergenic
1141665566 16:85463527-85463549 CCTGCAGTGACCCGGGAGGTGGG + Intergenic
1142358528 16:89615432-89615454 TCTCCCATGAGCCAGGGGGCTGG + Intronic
1142374897 16:89701723-89701745 GCGGCCGTGACGCTGGGGGCGGG + Intergenic
1146790761 17:35749281-35749303 TCAGGGGTGACCTGGGGGGCAGG - Intronic
1152587279 17:81194682-81194704 TCTGCCGTGACCCGGGGGGCAGG - Intronic
1152632561 17:81417106-81417128 TCTGCAGGGACCCGAGGGCCAGG + Intronic
1152742303 17:82023629-82023651 TCCTCCATGACCCGCGGGGCCGG - Exonic
1153219041 18:2846704-2846726 GCGGCCGCGTCCCGGGGGGCCGG + Intergenic
1153480477 18:5543075-5543097 CCTGCCGTGGCCCGGGGGCTCGG - Intronic
1160707402 19:535997-536019 CCTTCCGGGACCCGGGGCGCTGG + Intronic
1160707414 19:536036-536058 TCCTCCGGGACCCGGGGCGCTGG + Intronic
1160707439 19:536116-536138 CCTTCCGGGACCCGGGGCGCTGG + Intronic
1161069383 19:2252738-2252760 TCTGCCTCGGCCCGGGGCGCAGG + Exonic
1163131606 19:15276904-15276926 TCTGCACTGACCCGAGGGACAGG + Intronic
1163312080 19:16520788-16520810 TCTGCAGTGGCCGGGGGGCCAGG - Exonic
1165455429 19:35907883-35907905 TCTGGCGGGACTCAGGGGGCTGG + Intronic
1165903237 19:39178472-39178494 GCTGCCGTGGCCCGCTGGGCAGG - Exonic
1167557019 19:50203220-50203242 TCCCCCGGGACCCGGCGGGCAGG - Intronic
1168111061 19:54191469-54191491 TCTGGCGGGGCCCGCGGGGCAGG - Exonic
927391248 2:22597872-22597894 TCAGCAGTGACCAGGTGGGCAGG + Intergenic
927694554 2:25231109-25231131 TCTGTCCTGACCCTGGGAGCCGG + Exonic
930055178 2:47246355-47246377 TCTGCCTTGACCTGGGGGTCAGG - Intergenic
932463608 2:71898844-71898866 TCAGCCATTACCCGAGGGGCTGG + Intergenic
933847542 2:86337703-86337725 CCCGCCGAGCCCCGGGGGGCTGG - Intronic
934656127 2:96117522-96117544 TCTGTAGTGACCCCGGGGGAAGG + Intergenic
948650908 2:239443124-239443146 GCTGCTGTGACCCAGGAGGCAGG - Intergenic
948908209 2:240989848-240989870 TCTTCCCTCACCCAGGGGGCTGG - Intronic
949032615 2:241804214-241804236 TCCGCCGTCACCGGGGAGGCCGG + Intergenic
1172109304 20:32536190-32536212 GCTGCGGTGCCCCGGGAGGCGGG - Intronic
1172155300 20:32820015-32820037 TCTGCCGAGAGCCGGTGAGCCGG + Exonic
1173605231 20:44326909-44326931 AAGGCCGTGCCCCGGGGGGCTGG - Intergenic
1174479296 20:50819607-50819629 TCTGCTGTGACCCTAGAGGCTGG - Intronic
1175541081 20:59748010-59748032 TCTCCCGTGCCCCTGGGGGCTGG - Intronic
1176053638 20:63133744-63133766 GCTGCCGTGACCCGAGGAGCTGG - Intergenic
1176072694 20:63235260-63235282 TCTGCTGTGACCCTGGCTGCCGG - Intergenic
1180161512 21:46000527-46000549 TGTGCGGGGACCCGGGGGCCTGG - Intronic
1180856485 22:19049102-19049124 TCTGCAGTGACCCTGGAGTCTGG - Intronic
1184796946 22:46738219-46738241 CCTGCAGTGGCCCGGGCGGCGGG + Exonic
1185027571 22:48424515-48424537 TGGGCCGGGACCCCGGGGGCAGG + Intergenic
952945462 3:38475753-38475775 CCTGCCCTGACCCTGGGGGAGGG - Intronic
956687213 3:71841127-71841149 TCTGCTGTGATTCCGGGGGCTGG - Intergenic
968606010 4:1536130-1536152 GCAGGCGTGACCCGAGGGGCAGG - Intergenic
968957867 4:3728285-3728307 CCTGCTGTGTCCCGGGAGGCTGG - Intergenic
971492000 4:27223110-27223132 TTTGCCCTGACCTGGGGTGCAGG + Intergenic
988310947 5:29556492-29556514 TCTGCCTGGACGCTGGGGGCAGG + Intergenic
992186764 5:74251837-74251859 TCAGCCGTGGCCCAGGTGGCTGG - Intergenic
996552413 5:124744445-124744467 TCTGCCGCCACCGCGGGGGCAGG - Exonic
999316602 5:150588275-150588297 TCTGGTGTGCCCCGGGGGTCGGG + Intergenic
1000110015 5:158099378-158099400 TCTGCTGTGCCCCAGGGTGCTGG + Intergenic
1003887508 6:10534622-10534644 TCAGCTGTGACCAGGGTGGCAGG + Intronic
1007680373 6:43629301-43629323 TCTGACGCGACCCGGAGGCCAGG - Intergenic
1017031796 6:150230360-150230382 TCTGCCCTGGGCCTGGGGGCTGG - Intronic
1017233972 6:152100263-152100285 TCTCCCGTGCCCCAGGGTGCTGG - Exonic
1019527452 7:1487156-1487178 TCCGCGGTCACCCGGGGGGCTGG - Intronic
1019544054 7:1564803-1564825 TCAGCCTTGAACCGGGGGCCAGG - Intergenic
1022675413 7:32495265-32495287 GCTTACGTGACCCGGGCGGCTGG - Intronic
1024520795 7:50303504-50303526 TCTGCCGTGAGCAGGTGGGAGGG + Intergenic
1024559093 7:50628506-50628528 TCAGCTGTCACCCGGTGGGCAGG + Intronic
1029189563 7:98762073-98762095 TGTGCTGTGACCAGGGGGGATGG + Intergenic
1037820768 8:22133590-22133612 TCTCCCGGGACCCGCGGGGGTGG + Intergenic
1040110890 8:43566793-43566815 CCTGCCCCGACCCGGGGGGGGGG - Intergenic
1054812490 9:69446091-69446113 TCTGCAGTGGCCCGAGGGGTGGG + Intronic
1055757607 9:79572628-79572650 TCTCGCGTGACACGGGCGGCAGG - Exonic
1055972458 9:81925252-81925274 TCTGCTGTGATTCTGGGGGCTGG - Intergenic
1055974211 9:81940324-81940346 TCTGCTGTGATTCTGGGGGCTGG - Intergenic
1057848927 9:98549589-98549611 GCTGCCATGCCCCTGGGGGCTGG + Intronic
1060451835 9:123750088-123750110 TCTGCAGTGGCCATGGGGGCTGG - Intronic
1061007195 9:127934979-127935001 TCTGCCCTGACCCTGTGCGCTGG - Intergenic
1061152180 9:128835198-128835220 TCTGCCGTCAACCTTGGGGCAGG - Intronic
1061848303 9:133400414-133400436 TCTGCCGTGGCCCCCGGAGCTGG + Exonic
1062057374 9:134475566-134475588 TGGGCCGTGTCCCGGGAGGCGGG + Intergenic
1062175968 9:135163061-135163083 CCTGCTGTGACCCCTGGGGCTGG + Intergenic
1062381934 9:136290849-136290871 TCTGCCCTTGCCCTGGGGGCCGG + Exonic
1186486048 X:9935217-9935239 TCTCCCGGGAGCCGGGGGGGCGG + Intronic
1194121658 X:89970975-89970997 CCAGCCCTGACCAGGGGGGCTGG + Intergenic
1195740920 X:108063734-108063756 TCTAGCGTCACCCTGGGGGCAGG + Intronic
1200474512 Y:3628426-3628448 CCAGCCCTGACCCGGGGGGCTGG + Intergenic