ID: 1152587279

View in Genome Browser
Species Human (GRCh38)
Location 17:81194682-81194704
Sequence TCTGCCGTGACCCGGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152587279_1152587292 6 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587292 17:81194711-81194733 AGCGGAGGCCGTGACGGGGGTGG 0: 1
1: 0
2: 4
3: 22
4: 300
1152587279_1152587286 -9 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587286 17:81194696-81194718 CACGGCAGAAGCCGCAGCGGAGG 0: 1
1: 0
2: 0
3: 15
4: 193
1152587279_1152587287 0 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587287 17:81194705-81194727 AGCCGCAGCGGAGGCCGTGACGG 0: 1
1: 0
2: 0
3: 8
4: 170
1152587279_1152587290 2 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587290 17:81194707-81194729 CCGCAGCGGAGGCCGTGACGGGG 0: 1
1: 0
2: 0
3: 12
4: 99
1152587279_1152587295 12 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587295 17:81194717-81194739 GGCCGTGACGGGGGTGGTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 427
1152587279_1152587293 10 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587279_1152587294 11 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587294 17:81194716-81194738 AGGCCGTGACGGGGGTGGTTGGG 0: 1
1: 0
2: 1
3: 3
4: 144
1152587279_1152587288 1 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587288 17:81194706-81194728 GCCGCAGCGGAGGCCGTGACGGG 0: 1
1: 0
2: 0
3: 10
4: 136
1152587279_1152587291 3 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587291 17:81194708-81194730 CGCAGCGGAGGCCGTGACGGGGG 0: 1
1: 0
2: 1
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152587279 Original CRISPR TCTGCCGTGACCCGGGGGGC AGG (reversed) Intronic