ID: 1152587293

View in Genome Browser
Species Human (GRCh38)
Location 17:81194715-81194737
Sequence GAGGCCGTGACGGGGGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 283}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152587278_1152587293 13 Left 1152587278 17:81194679-81194701 CCACCTGCCCCCCGGGTCACGGC 0: 1
1: 0
2: 1
3: 15
4: 249
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587280_1152587293 6 Left 1152587280 17:81194686-81194708 CCCCCCGGGTCACGGCAGAAGCC 0: 1
1: 0
2: 1
3: 3
4: 96
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587276_1152587293 14 Left 1152587276 17:81194678-81194700 CCCACCTGCCCCCCGGGTCACGG 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587284_1152587293 2 Left 1152587284 17:81194690-81194712 CCGGGTCACGGCAGAAGCCGCAG 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587279_1152587293 10 Left 1152587279 17:81194682-81194704 CCTGCCCCCCGGGTCACGGCAGA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587273_1152587293 25 Left 1152587273 17:81194667-81194689 CCTGTGTGGAGCCCACCTGCCCC 0: 1
1: 0
2: 3
3: 22
4: 295
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587282_1152587293 4 Left 1152587282 17:81194688-81194710 CCCCGGGTCACGGCAGAAGCCGC 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587283_1152587293 3 Left 1152587283 17:81194689-81194711 CCCGGGTCACGGCAGAAGCCGCA 0: 1
1: 0
2: 0
3: 11
4: 155
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283
1152587281_1152587293 5 Left 1152587281 17:81194687-81194709 CCCCCGGGTCACGGCAGAAGCCG 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1152587293 17:81194715-81194737 GAGGCCGTGACGGGGGTGGTTGG 0: 1
1: 0
2: 1
3: 21
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152587293 Original CRISPR GAGGCCGTGACGGGGGTGGT TGG Intronic