ID: 1152588126

View in Genome Browser
Species Human (GRCh38)
Location 17:81198135-81198157
Sequence TGCCCCTGTGATGGGTCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152588119_1152588126 -2 Left 1152588119 17:81198114-81198136 CCTCGCTGGCCCAGGCGTATCTG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG 0: 1
1: 0
2: 3
3: 29
4: 315
1152588117_1152588126 7 Left 1152588117 17:81198105-81198127 CCGTGGTCACCTCGCTGGCCCAG 0: 1
1: 0
2: 0
3: 11
4: 211
Right 1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG 0: 1
1: 0
2: 3
3: 29
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152588126 Original CRISPR TGCCCCTGTGATGGGTCCTG GGG Exonic
900024964 1:263969-263991 TGCGCCTGTGATGCCTCCTCAGG - Intergenic
900028567 1:353364-353386 TGCACCTGTGATGCCTCCTCAGG - Intergenic
900140843 1:1139017-1139039 TGCCTCTGTGGGTGGTCCTGGGG - Intergenic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900280134 1:1861789-1861811 TACCCCAGAGATGTGTCCTGGGG - Intronic
900439023 1:2644182-2644204 TGCCCCAGTGGTGGGCCCGGGGG + Intronic
900932501 1:5746077-5746099 AGCCCCTGCGAAGGGTTCTGGGG + Intergenic
900969769 1:5985058-5985080 TGCCACTGTGGTAGGTACTGTGG - Intronic
900970352 1:5989202-5989224 TCTCCCTGTGGTGGCTCCTGGGG - Intronic
901461145 1:9392610-9392632 TGCCTCTGGGAGGGGTCCTTCGG - Intergenic
902728364 1:18352140-18352162 TGCCCCTCTGCTGAGGCCTGGGG + Intronic
902991122 1:20187511-20187533 TCCCTGTGTGATGGGTGCTGGGG + Intronic
903179998 1:21600404-21600426 TGCCTCTGTGTTGGGCTCTGTGG - Intronic
903632948 1:24790690-24790712 TGCCCCTGGGATGGGGTCAGAGG - Intronic
904947911 1:34212836-34212858 TGACTTTGTGATGGGCCCTGCGG + Intronic
905338846 1:37264539-37264561 TAGGCCTGTGCTGGGTCCTGGGG - Intergenic
905534380 1:38708858-38708880 TGCTCCTGTGCTGCGGCCTGTGG + Intergenic
906033374 1:42736793-42736815 AGGCCCTGTGCTGGGTCCTGGGG - Intronic
906727020 1:48051565-48051587 TGCCTCTGTGCTGGACCCTGAGG - Intergenic
907149194 1:52266782-52266804 TCCCACTGTGATGGTACCTGTGG + Exonic
907224000 1:52927822-52927844 TGTCTCTGTGAGGGCTCCTGTGG - Intronic
907274721 1:53310838-53310860 GGGCCCTGTGATGGGCACTGGGG + Intronic
907318464 1:53587781-53587803 TGCCCCCTGGCTGGGTCCTGGGG - Intronic
907422709 1:54357882-54357904 TCCACCTTTGATGGGTCCTCTGG - Intronic
912486536 1:110033629-110033651 GGCCCCTGTGATGGGACTGGTGG - Intronic
913256145 1:116955795-116955817 TGGCCCTGGGAAGAGTCCTGTGG + Intronic
915087987 1:153401317-153401339 TGCACCTGTGCTAGGTGCTGTGG + Intergenic
915622982 1:157097545-157097567 TGCCCCAGTGTTGTGTCCTCTGG + Intronic
915738701 1:158101560-158101582 TGGCCCTGTGCTGGGGTCTGGGG - Intergenic
916074997 1:161195531-161195553 GGCCCCTGTGATGGCTCATGTGG - Exonic
916091328 1:161309893-161309915 TGCCCCAGCTATGGCTCCTGGGG - Exonic
917534387 1:175863841-175863863 GGCCCCATTGATGGGTCCGGGGG - Intergenic
919159600 1:193811071-193811093 TGTCCCTGAGTTGAGTCCTGGGG - Intergenic
920388913 1:205586646-205586668 TGCCTCTGGGCTGGGGCCTGGGG + Intronic
922787722 1:228291408-228291430 TCCCCATCTCATGGGTCCTGTGG + Intronic
924831710 1:247602877-247602899 AGGCCCTTTGATAGGTCCTGAGG + Intergenic
1064002267 10:11673541-11673563 TGGCCCTGTGCTGTGTGCTGAGG + Intergenic
1065978041 10:30860896-30860918 TGGCCCTGTGATGGGGGATGGGG + Intronic
1066054203 10:31665135-31665157 TGCCCCTGTGAAGGGAGTTGTGG - Intergenic
1066522576 10:36238701-36238723 TGCCACTGAGATGTGTGCTGGGG - Intergenic
1066611194 10:37250180-37250202 TACCAATGTGATGAGTCCTGGGG + Intronic
1067015300 10:42753675-42753697 GGCCACTGTCACGGGTCCTGTGG - Intergenic
1067766533 10:49091504-49091526 GTCCCCTTTGATGGGACCTGGGG + Intronic
1069885836 10:71623041-71623063 TGCCACTGTGCTAGGTCCTGGGG + Intronic
1070097976 10:73356920-73356942 TGGCACTGTGATGGGTGCTGAGG + Intronic
1070512144 10:77171175-77171197 TACACCTGGGATGGGGCCTGAGG - Intronic
1071518516 10:86314875-86314897 TGGCTCTGTGATGGATCCTGGGG - Intronic
1072414801 10:95238216-95238238 TTCCCCTGTGATGGGTTCCTGGG - Intronic
1072816663 10:98516301-98516323 AGACCCTGTGCTGGGTGCTGAGG - Intronic
1074288009 10:112116483-112116505 AGCCACTGCGCTGGGTCCTGAGG + Intergenic
1075087604 10:119423944-119423966 TGGCACTGTGCTGGGTGCTGGGG + Intronic
1075853980 10:125612377-125612399 TGGCACTTTGATGGGTGCTGGGG - Intronic
1076033727 10:127181426-127181448 TGACCCTGTGATGGGATTTGTGG + Intronic
1076698086 10:132256725-132256747 TGCCCCTGTGGGTGGTCCTGGGG - Intronic
1076759800 10:132597725-132597747 TGGGCCTGTGGTGCGTCCTGCGG + Intronic
1076759835 10:132597909-132597931 TGGGCCTGTGGTGCGTCCTGCGG + Intronic
1077144873 11:1040354-1040376 TGACCCTGTGCCAGGTCCTGGGG + Intergenic
1077228386 11:1448153-1448175 AGCCCCTGTGCTGTGTCCGGTGG + Intronic
1077268907 11:1666029-1666051 GGCCCCAGTCATGGGGCCTGCGG - Intergenic
1077271845 11:1685151-1685173 GGCCCCAGTCATGGGGCCTGCGG + Intergenic
1077317184 11:1924840-1924862 GGCCCCTGAGAGGGGTTCTGAGG - Intronic
1077488013 11:2847983-2848005 GGCCCCGATGAGGGGTCCTGAGG + Exonic
1077544767 11:3164620-3164642 TGCCCCAGAGATGGGGGCTGTGG + Intronic
1077889332 11:6407387-6407409 TGCCCCTGGGATGGTCACTGTGG - Intronic
1078570865 11:12456851-12456873 AGGCCCTGTGCTGTGTCCTGGGG - Intronic
1080333621 11:31171195-31171217 TGTTCCAGTGATGGATCCTGTGG - Intronic
1080396878 11:31898324-31898346 CGGCCCTGTGCTGGGTGCTGTGG - Intronic
1081750770 11:45509440-45509462 AGCCCCTGTCCTAGGTCCTGGGG + Intergenic
1082986640 11:59174948-59174970 AGGCCCTGTGCTGGGTGCTGCGG + Intronic
1083174730 11:60942414-60942436 TTACCCTGTGCTGGGCCCTGGGG - Intronic
1083306063 11:61762584-61762606 TGCCCCTGTCCTGGGTTCTTGGG + Intronic
1084104320 11:66971211-66971233 TGGCCCTGTCATAGGTCCTCTGG + Intergenic
1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG + Intergenic
1084961840 11:72720983-72721005 TGGCCCTGTGCTGGCTCCTGAGG + Intronic
1087021744 11:93610185-93610207 AGCCTCTGTGATAGGTCCTCAGG - Intergenic
1088668629 11:112119608-112119630 AGGCACTGTGCTGGGTCCTGGGG + Intronic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1089786420 11:120910615-120910637 GGCCCCTGGGATTAGTCCTGGGG - Intronic
1091281270 11:134383153-134383175 AACCCATGGGATGGGTCCTGGGG - Intronic
1091847568 12:3669196-3669218 TGCCCCTGGGGTGGGACCTCTGG + Intronic
1094831937 12:34304291-34304313 AGCCCCTGCGGTGGGCCCTGGGG + Intergenic
1094832892 12:34308514-34308536 AGCCCCTGTGCTGGGCCCCGGGG + Intergenic
1094834141 12:34314366-34314388 AGCCCCTGTGCAGGGCCCTGGGG - Intergenic
1094837020 12:34326846-34326868 AGCCCCTGCGCTGTGTCCTGGGG - Intergenic
1094841009 12:34342710-34342732 TGCTCATGTGCGGGGTCCTGGGG + Intergenic
1095096454 12:38151998-38152020 AGCCCCTGTGTTCGGTCCAGGGG + Intergenic
1096601779 12:52734748-52734770 TGGCCCTGTGCTTGGTGCTGGGG - Intergenic
1096613162 12:52816205-52816227 TTCTCCTGTGATGGGGCCTGGGG - Intergenic
1096830493 12:54310143-54310165 TGCCCCTAAGATGGGTGCGGTGG + Intronic
1097151181 12:56981041-56981063 TGCCCCAGGGAAGGGACCTGGGG + Intergenic
1101375569 12:104168442-104168464 TGCACCAGTGATCGGTTCTGTGG - Intergenic
1101606277 12:106248912-106248934 AGCCTCTGGGATGGGTGCTGCGG + Intronic
1102058856 12:109916935-109916957 TGTACCTGTGATGGGGCGTGTGG + Exonic
1102470779 12:113158774-113158796 TGGCCCTGTGCTGGGCACTGGGG - Exonic
1103341172 12:120221895-120221917 TGACCCAGTGATGGGTCCCCAGG - Intronic
1103722970 12:122984325-122984347 AGCCCCTGTCAGGGGCCCTGTGG - Exonic
1104428613 12:128698105-128698127 TGGCCCTGTGATGGTCACTGGGG - Intronic
1104456190 12:128914362-128914384 TGGGCCTGTCATGGATCCTGGGG + Intronic
1104844624 12:131840586-131840608 TGCCCCAGTGGTGAGTCCCGTGG - Exonic
1106201047 13:27537640-27537662 TGCCATTGTGATGGGCTCTGGGG - Intergenic
1106299874 13:28453828-28453850 ATACCCTGTGCTGGGTCCTGGGG + Intronic
1107065955 13:36214533-36214555 TGCGCACGTGCTGGGTCCTGGGG + Exonic
1108712413 13:53046609-53046631 TGGCCCTGTTCTGGGTACTGGGG + Intronic
1112548095 13:100391337-100391359 TTCACCTGTGATGGCTGCTGTGG + Intronic
1114266272 14:21074426-21074448 TGCCCCTGTGGAAGGACCTGAGG + Exonic
1117247751 14:53902552-53902574 TGACCCTGGGGTGTGTCCTGAGG - Intergenic
1118730038 14:68659593-68659615 TGCCCCGGTGCAGTGTCCTGAGG - Intronic
1118966691 14:70593876-70593898 TGCCCCAGTGCTGGGTCCTAAGG + Intronic
1119695251 14:76708392-76708414 AGGCCCTGTGCTGGGTGCTGGGG - Intergenic
1120513825 14:85446664-85446686 TGCCTCTGTCTTGGGTGCTGGGG - Intergenic
1122055239 14:99093662-99093684 TGGCCCTGTGGTGGGTGCTGGGG + Intergenic
1122203403 14:100136168-100136190 AGCCACTGTGATGGGTCCCCAGG + Intronic
1122274130 14:100582599-100582621 GGCACCTGTGTTGGGTGCTGGGG - Intronic
1202898526 14_GL000194v1_random:23224-23246 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1202899519 14_GL000194v1_random:27325-27347 AGCCCCTGTGCTGGGTACCGGGG - Intergenic
1124339964 15:28884716-28884738 TGCCCCTTTGTTTGGCCCTGTGG + Intronic
1125887194 15:43237918-43237940 TGCCCCAGAAATGGATCCTGAGG - Intronic
1126428008 15:48550363-48550385 TGGCCCTGTGATGTGGGCTGTGG - Intronic
1127053642 15:55110621-55110643 TTCCCCTGTGCTGCCTCCTGTGG - Intergenic
1128178589 15:65580050-65580072 TGCCACTGTGGTGGGGCCTCAGG + Intronic
1129601605 15:77002166-77002188 TGACTCTGTGATGGGACCTAAGG + Intronic
1131265600 15:90913464-90913486 TGCCCCTGTCACAGGCCCTGGGG + Intronic
1131616411 15:94021160-94021182 TTTCTCTGTGCTGGGTCCTGAGG - Intergenic
1132347405 15:101116551-101116573 AGGCCCTGTGATGTGTGCTGGGG - Intergenic
1132847427 16:2006964-2006986 TGTCCCTGTGGGGGGTCTTGGGG - Intronic
1132956740 16:2598309-2598331 TCTCCCTGTGATGGGCCCTTAGG + Exonic
1134146901 16:11772362-11772384 TGCAGCTTTGATGGGGCCTGGGG - Intronic
1134562248 16:15220607-15220629 TGGCTCTGTTATAGGTCCTGAGG + Intergenic
1134922785 16:18132233-18132255 TGGCTCTGTTATAGGTCCTGAGG + Intergenic
1135401421 16:22168985-22169007 GGCCGCTGTGAGGGCTCCTGTGG - Intronic
1135658376 16:24271654-24271676 AGACCCTGTGTTGGGTCCTGAGG + Intronic
1135859038 16:26038212-26038234 TGCCCCTGTGGTGAGTTCTCAGG + Intronic
1135876079 16:26201236-26201258 AGGCACTGTGCTGGGTCCTGGGG - Intergenic
1136990271 16:35147647-35147669 TGCTCCTGGGATGGCTCCTCAGG + Intergenic
1137435195 16:48448959-48448981 TGCCCCTCTGATGCTGCCTGAGG + Intergenic
1137805077 16:51297330-51297352 TGGCCATGTGATGACTCCTGAGG - Intergenic
1138460126 16:57143125-57143147 TTCCCCTTTGATCTGTCCTGGGG + Intronic
1139201300 16:64980390-64980412 TGTCCCTGTGATGTAGCCTGGGG + Intronic
1139311219 16:66029884-66029906 TGCCACTCTGCTGGGCCCTGGGG + Intergenic
1139738836 16:69017307-69017329 TGCCACTGTGCTGGGCCCTGGGG - Intronic
1140248200 16:73270478-73270500 TGACCCTGGGCTGGGTGCTGTGG - Intergenic
1140715604 16:77722903-77722925 TGCCACTGTCGGGGGTCCTGGGG - Intronic
1140766600 16:78165286-78165308 CACCTCTGTGATGGGTGCTGGGG + Intronic
1141500557 16:84441446-84441468 TGTTGCTGTGATGAGTCCTGCGG + Intronic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1142056743 16:88002405-88002427 TGGCCCTGCGCTGGCTCCTGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142456191 16:90225408-90225430 TGCGCCTGTGATGCCTCCTCAGG + Intergenic
1143119751 17:4599458-4599480 TGCCGCTGGGGTGGGTGCTGGGG - Intronic
1143859846 17:9881137-9881159 TGCTTCTGTGATGCCTCCTGGGG + Intronic
1145290756 17:21543930-21543952 TGCCCCTGTGCTTGTTACTGGGG + Intronic
1147671608 17:42180069-42180091 TGCCCCGGTGATGGGCGCTATGG + Intronic
1147863741 17:43539561-43539583 TAACCCTGTGCTGGGTGCTGGGG - Intronic
1148145962 17:45365011-45365033 TGGCCCTGTGCTTGGTGCTGTGG + Intergenic
1148340277 17:46869289-46869311 TGCCTCTGGGGTGGGGCCTGAGG + Intronic
1148864806 17:50622936-50622958 AGGCCCTGTGCTGGGACCTGGGG + Intronic
1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG + Intronic
1152002260 17:77654272-77654294 TGCCCTTGGGATGGGACCTATGG - Intergenic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1152716700 17:81903725-81903747 AGCTCCTGTGCTGGGTCGTGAGG + Intronic
1152951193 17:83233193-83233215 TGCACCTGTGATGCCTCCTCAGG + Intergenic
1154085625 18:11302943-11302965 AGCCCCTGTGCTGGGCCCCGGGG - Intergenic
1154208723 18:12360652-12360674 TGTCCCTGTGCTGGGCCCTCTGG - Intronic
1159900247 18:74038643-74038665 TGGCCCTGTGCTGCATCCTGTGG - Intergenic
1160541604 18:79627023-79627045 TGGCCCGGTGATGTGTCCGGCGG - Intergenic
1160553630 18:79712203-79712225 GGCCCCAGTGGTGGGTACTGTGG + Intronic
1161318863 19:3631942-3631964 AGCCCCTCTCAGGGGTCCTGGGG + Exonic
1162418998 19:10555197-10555219 TGCCCCTGTGTTGGGTGCTCTGG + Intronic
1162439442 19:10683502-10683524 TCCCCCTCTGACGGGTACTGGGG - Exonic
1162873255 19:13601511-13601533 TGGCCCTGTGCTAGGTCCTGGGG + Intronic
1164720793 19:30430368-30430390 TGGCTCTGTGTTGGGTGCTGGGG + Intronic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1164832548 19:31333653-31333675 GGCCCCAGTGATGGGGCCCGGGG + Intronic
1165047139 19:33114123-33114145 TGGCACTGTGTAGGGTCCTGGGG - Intronic
1165444240 19:35848195-35848217 TTTCTCTGTGCTGGGTCCTGAGG + Intronic
1166903655 19:46087416-46087438 GGCCCCTTTGATGGGTGCTCAGG + Intergenic
1167774219 19:51544390-51544412 TGCCCTTGTTATGGGGCCAGTGG + Intergenic
1168712875 19:58511842-58511864 TGACCCTGCGCTGGCTCCTGGGG - Exonic
925283585 2:2701658-2701680 TGCCCCTGTGCTTGCCCCTGAGG - Intergenic
927976448 2:27342160-27342182 TGCCCCTGTGTCCTGTCCTGAGG - Exonic
928072520 2:28231594-28231616 TGCCCCTGAATTGGGTTCTGAGG - Intronic
928127321 2:28625675-28625697 TGCCCCTGGGATGAGTTCTTAGG - Intronic
929556936 2:42931517-42931539 TGTCCCTGGGCTGGGCCCTGTGG - Intergenic
929997972 2:46840879-46840901 TGTCCCAGTGATGGGTTGTGAGG + Intronic
930604265 2:53476433-53476455 TGCCACTGTGCTTGGTGCTGGGG - Intergenic
930626114 2:53699197-53699219 TGCCCCAGTGATGGGACTGGTGG - Intronic
931706139 2:64947929-64947951 TGCCCCTCTACTGGGGCCTGAGG - Intergenic
934739147 2:96706660-96706682 TGCCTCTCTGTTGGGGCCTGGGG - Exonic
934767663 2:96889057-96889079 TGCACCTGTTATGGTCCCTGCGG - Intronic
934847617 2:97672364-97672386 GGCCTCTGTGATGGCTCCCGTGG - Intergenic
934849381 2:97687780-97687802 GGCCTCTGTGATGGCTCCCGTGG - Intergenic
936105396 2:109619580-109619602 TCCCACTGTGATGGCTGCTGGGG + Intergenic
936151260 2:110023523-110023545 TGTCCCAGTCAGGGGTCCTGGGG + Intergenic
936193415 2:110347846-110347868 TGTCCCAGTCAGGGGTCCTGGGG - Intergenic
937067108 2:119025848-119025870 TGCCACTGTGAGGGGTCCAGAGG + Intergenic
937355140 2:121193563-121193585 TGGCCCTGTGCTGGGCACTGGGG + Intergenic
938489551 2:131754604-131754626 AGCCCCTGCGCTGGGCCCTGGGG + Intronic
939502295 2:143003061-143003083 TGGCCCTGTGCTGAGTACTGAGG - Intronic
940460543 2:153958565-153958587 TACCCCAGTGGTGGGTCCTCTGG + Intronic
941568819 2:167143167-167143189 TGCCCCTGTGCTTGGCACTGGGG + Intronic
942247886 2:174024115-174024137 GGCCACGGTGATGGTTCCTGCGG + Intergenic
942321330 2:174739142-174739164 TGGGCCTATGAGGGGTCCTGGGG - Intergenic
946185674 2:217979093-217979115 TGCCCCTGGCAGGGGTCCAGTGG - Intronic
947353766 2:229271762-229271784 AGCCCCTATGCTGGGTTCTGAGG + Intergenic
947437510 2:230085229-230085251 GGCCACTGAGATGGGGCCTGGGG - Intergenic
948300160 2:236900080-236900102 TGTGCCTCTGCTGGGTCCTGTGG + Intergenic
948465615 2:238150351-238150373 TGCCCCTGGGAGGGGTTGTGGGG - Intronic
948654486 2:239468415-239468437 GGTCCCTGGGAAGGGTCCTGAGG + Intergenic
948744740 2:240080377-240080399 TGTCCCTCTGCTGGGTCCTCAGG - Intergenic
949087684 2:242170206-242170228 TGCGCCTGTGATGCCTCCTCAGG + Intergenic
1168968425 20:1914141-1914163 TAGCCCTGAGATGGGCCCTGAGG - Intronic
1169875591 20:10293804-10293826 TGCCTCTGTGTTGGGTGCAGTGG - Intronic
1170456762 20:16541009-16541031 TGCCACTTTGCTGGGTACTGAGG - Intronic
1170868494 20:20182546-20182568 TGCCCGTGTTTTGGGTGCTGGGG - Intronic
1171025587 20:21627485-21627507 AGCCCCTCTGAAGGCTCCTGGGG + Intergenic
1171391183 20:24802666-24802688 TGCCCCTGGGACATGTCCTGGGG - Intergenic
1172123118 20:32610013-32610035 AGGCCCTGTGCTGGGCCCTGAGG - Intergenic
1172942276 20:38662457-38662479 CAGCCCTGTGATGGGACCTGGGG + Intergenic
1173173014 20:40742360-40742382 AGCCCCTGTGCTGGGTCCCAAGG - Intergenic
1174600990 20:51724683-51724705 AGGCCCTGTGCTGGGTTCTGGGG - Intronic
1174767592 20:53268569-53268591 TTTCCCTGTGATGAGTCTTGGGG + Intronic
1176618208 21:9039214-9039236 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1176618895 21:9042097-9042119 AGCCCCTGTGCTGGGTACCGGGG - Intergenic
1176706633 21:10123244-10123266 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1176707202 21:10125497-10125519 TGCCCTTGTGCTGGGCCCCGGGG + Intergenic
1179049394 21:37875715-37875737 TGACCCTGAGATGGCTGCTGTGG - Intronic
1179249167 21:39658344-39658366 GAGCCCTGTGAAGGGTCCTGAGG + Intronic
1179717917 21:43299486-43299508 TGCCCCTGTGCCTGGTTCTGAGG - Intergenic
1179885575 21:44312919-44312941 TGGCCCTGTGGTGGGGCCAGTGG + Intronic
1181166713 22:20987842-20987864 TGCCTCTGTGCTGGGCTCTGGGG - Intronic
1181541189 22:23574107-23574129 AGCCGATGTGAAGGGTCCTGTGG - Intronic
1181551090 22:23639464-23639486 AGCCGATGTGAAGGGTCCTGTGG - Intergenic
1181797190 22:25319223-25319245 AGCCGATGTGAAGGGTCCTGTGG + Intergenic
1184007327 22:41719994-41720016 TGGCCCTGTGCTGGGCTCTGAGG + Intronic
1184100981 22:42341708-42341730 TGGCCCTGTGCTGGACCCTGGGG + Intronic
1184210941 22:43035297-43035319 TGCCCCAGTGGAGGGCCCTGGGG - Intergenic
1184992464 22:48180185-48180207 TGTCCCTCTGAAGGGTCCCGTGG - Intergenic
1185140561 22:49098595-49098617 TGCTTCTGTGATGGGCCCGGAGG - Intergenic
949977117 3:9470903-9470925 TTCCTCTGTGGTGGGTTCTGGGG - Exonic
950432365 3:12958225-12958247 TGCCCCTGTGCTGGGTGCTGTGG - Intronic
954448650 3:50560017-50560039 AGCCCCTGTGCTAGGGCCTGGGG - Intronic
957643086 3:82884495-82884517 TGTTTCTGTGATGGGTCATGTGG + Intergenic
961926277 3:130484493-130484515 TGCCCATGTCATCGGTTCTGGGG + Exonic
962755270 3:138461381-138461403 TGCTCCTCTCATGGGGCCTGGGG - Intronic
967195054 3:187018777-187018799 TGCCCCTGTGATGGCTAATACGG - Intronic
969045588 4:4334253-4334275 TGCCTCTGTGCTGGGTCTTTGGG + Intergenic
973343616 4:49031060-49031082 TGCCCCAGTGATGCTTCTTGGGG + Intronic
974915847 4:68177278-68177300 CGCCCCTGAGATGAGTCCTGTGG - Intergenic
975633697 4:76424771-76424793 AGACCCTGTGCTGGGTACTGGGG + Intergenic
976591762 4:86856193-86856215 AGACCCTGTGATAGGTCCTCAGG - Intergenic
981427787 4:144623625-144623647 AGGCCCTGTGCTGGGTACTGAGG + Intergenic
982778867 4:159469360-159469382 TGCCTCTGAGCTGTGTCCTGGGG + Intergenic
984844416 4:184097820-184097842 TGCTACTGAGAGGGGTCCTGGGG + Intronic
984920989 4:184764321-184764343 AGCCTCTGTGATGGGTGCTTAGG - Intronic
985151279 4:186949283-186949305 TGGACCTGTGATGGGAGCTGAGG + Intergenic
985493678 5:193142-193164 GTGCCCAGTGATGGGTCCTGGGG + Intronic
990178007 5:53128750-53128772 TGCACCTGGTATGTGTCCTGTGG - Intergenic
997196916 5:131986336-131986358 TGCCCCCGGGATGGGCCATGTGG - Intronic
997356741 5:133267329-133267351 AGGCCCTCTCATGGGTCCTGGGG - Intronic
998397377 5:141827417-141827439 AGCCGCTGTGATGGGGCCCGAGG - Intergenic
999342335 5:150782859-150782881 AGGCCCTGTGATAGGTGCTGAGG + Intronic
1000509146 5:162160489-162160511 TGCCCTTCTGGTGAGTCCTGTGG + Intergenic
1002047860 5:176552141-176552163 TGCCCCTGGGCTGGGACTTGCGG - Intronic
1002065640 5:176650420-176650442 TGCCCCGGGGATTGGTCCAGAGG - Intronic
1002745423 5:181467007-181467029 TGCACCTGTGATGCCTCCTCAGG + Intergenic
1002944286 6:1746112-1746134 TGGCCATGTCATGGGTCATGTGG - Intronic
1003542686 6:7032173-7032195 GGGCCCTGGGATGGGCCCTGTGG - Intergenic
1003617472 6:7668637-7668659 TGGCCTTGTGATAGCTCCTGTGG + Intergenic
1005752557 6:28896887-28896909 TGCCCATGTGGTGGTCCCTGTGG - Intergenic
1006446813 6:34084345-34084367 TGCCCCACTGATGGCTCCTGAGG - Intronic
1006835723 6:36997781-36997803 AGCCCCTGTGCTGGGACCTTGGG - Intergenic
1007302975 6:40882328-40882350 AACCCCTGTGATGTGTGCTGAGG - Intergenic
1007386510 6:41523701-41523723 TGCCCCTCTGATAGGGTCTGGGG - Intergenic
1007413554 6:41678995-41679017 TGGCCCTGTGCTGGGTGCTGGGG - Intergenic
1008014310 6:46501251-46501273 GGCCCCTGTGGCGGGACCTGTGG - Intergenic
1013113668 6:107084198-107084220 TGCCCTAGTGCTGGTTCCTGTGG - Intronic
1014760737 6:125354113-125354135 TGCCTCTGTGGTGGGGACTGGGG - Intergenic
1015142368 6:129949668-129949690 TGCCCCTGTGATGCTTGCTTTGG + Intergenic
1016821263 6:148348519-148348541 TGCTCCTGTGTAGAGTCCTGGGG + Intronic
1017011188 6:150064838-150064860 AGCCGCTGTGACAGGTCCTGGGG + Intronic
1017842406 6:158232394-158232416 TGCCCCTGCGGTGGGCCCCGGGG + Intronic
1018033342 6:159861714-159861736 TAACTCTGAGATGGGTCCTGAGG - Intergenic
1018724845 6:166603851-166603873 TGCCCGTTTGGTGGGTGCTGAGG - Intronic
1019250337 6:170740550-170740572 TGCACCTGTGATGCCTCCTCAGG + Intergenic
1019390373 7:783459-783481 AGACCCTCTGAAGGGTCCTGGGG + Intronic
1021018929 7:15572198-15572220 AGTCCCTGTGATGAGTCCTTAGG - Intergenic
1022923759 7:35040129-35040151 TGCCCATCTCATGGGTCCTTAGG + Intergenic
1022965494 7:35467785-35467807 TTGCCCTGTGCTAGGTCCTGGGG + Intergenic
1023912899 7:44568025-44568047 AGCCCCTGTGCTTGGTGCTGGGG - Intronic
1026671976 7:72398708-72398730 TGCTCCTCTTAGGGGTCCTGGGG + Intronic
1026804868 7:73423576-73423598 TGCCCCAGTGATGTGTGCCGGGG - Intergenic
1030371096 7:108700093-108700115 TTCCATTGTGATGGGGCCTGGGG + Intergenic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034478341 7:151301657-151301679 TTCCCCTGAGATGTGGCCTGGGG + Intergenic
1035118395 7:156544457-156544479 TGGCCGTGTGCTGGTTCCTGGGG - Intergenic
1035370470 7:158376410-158376432 TGGCCCTGTCATACGTCCTGAGG + Intronic
1036586707 8:10131133-10131155 TGATCATGTGCTGGGTCCTGTGG + Intronic
1036645897 8:10611377-10611399 TGCCCCTGAATTGGGGCCTGGGG + Exonic
1037821124 8:22135023-22135045 TGGCCCTGTGCTGGGCGCTGGGG + Intergenic
1038612567 8:29069607-29069629 TGCCCAGGTGGAGGGTCCTGGGG - Exonic
1040278570 8:46026202-46026224 AGCCCCTGTGCTGGGTCAGGGGG - Intergenic
1041325483 8:56659080-56659102 TGCCCTGGTCATGGGTGCTGAGG + Intergenic
1041638408 8:60170219-60170241 TGCCTCTGTCATGGATCCTGAGG + Intergenic
1041864055 8:62548413-62548435 TGCCCCTGTCCAGGGGCCTGGGG + Intronic
1045749666 8:105468213-105468235 TACCCCTGGGAAGAGTCCTGAGG - Intronic
1048326666 8:133444316-133444338 TGCCTCACTGATGGGGCCTGTGG + Intergenic
1048933761 8:139338640-139338662 TGCACCTGTGCTGGGCCCTGTGG + Intergenic
1049344442 8:142130874-142130896 GGGCCCTGTGAGGAGTCCTGCGG - Intergenic
1049470214 8:142771929-142771951 TGACCCTGGGGTGGGACCTGGGG - Intronic
1049705490 8:144040249-144040271 AGCCCCTGTGATGGGCACGGTGG + Exonic
1049749291 8:144275811-144275833 TGCCCCTGTCGTGTGTGCTGTGG - Intronic
1049749517 8:144276673-144276695 GGCCCCTGGGAGGAGTCCTGTGG - Intronic
1049830974 8:144700520-144700542 TGCTCCTGAGAAGGGTCCTCGGG + Intergenic
1050094547 9:2050425-2050447 TGCCAATGTGATGATTCCTGAGG - Intronic
1052262526 9:26534146-26534168 GGCCCCTATGATGGGACCTGTGG + Intergenic
1053643928 9:40110364-40110386 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1053762224 9:41355125-41355147 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1054350418 9:64014373-64014395 AGCCCCTGTGCTGGGCCCTGGGG - Intergenic
1054350473 9:64014571-64014593 AGCCCCTGAGCTGGGCCCTGTGG - Intergenic
1054540821 9:66266245-66266267 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1057798889 9:98177278-98177300 AGCCCCTGTGCTGGGCTCTGTGG + Intronic
1059312427 9:113397473-113397495 TGCCCCTGTGTTAGGTGATGGGG - Intronic
1059454496 9:114390978-114391000 GGCCTGTGTGCTGGGTCCTGGGG - Intronic
1060153758 9:121304821-121304843 AGGCCCTGTGATGGGTGCTGGGG + Intronic
1060246896 9:121954054-121954076 TGGGGCTGTGTTGGGTCCTGTGG - Intronic
1060774638 9:126364012-126364034 AGGCCCTGTGCTGGGTACTGGGG - Intronic
1060959235 9:127667630-127667652 TTCCCATGTGATTGGTGCTGAGG + Intronic
1061152620 9:128837521-128837543 TGCCCCTGTCCTGGGACCTCTGG + Intronic
1061449023 9:130658913-130658935 TGCCCCTCTGGTGGGTCTAGGGG - Intergenic
1061905458 9:133694438-133694460 TGCCCCTGTGAGCGGCCCTGGGG - Intronic
1202791950 9_KI270719v1_random:94372-94394 TGCCCTTGTGCTGGGCCCCGGGG + Intergenic
1203697768 Un_GL000214v1:113980-114002 AGCCCCTTTGCTGGGCCCTGGGG + Intergenic
1203579892 Un_KI270745v1:33150-33172 TGCGCCTGTGATGCCTCCTCAGG + Intergenic
1185736895 X:2501613-2501635 TGCCCCAGTGGGGGGGCCTGTGG - Intronic
1189752068 X:44232306-44232328 GGCCTCTGTGATGGGACATGTGG + Intronic
1190931035 X:54949967-54949989 TGGCCCTGTGCTGGGTGCTGGGG + Intronic
1191249959 X:58255543-58255565 AGCCCCTGTGCTGGGCCCTCTGG - Intergenic
1192181131 X:68916470-68916492 AGCCCCTGCACTGGGTCCTGGGG - Intergenic
1192578781 X:72263755-72263777 TGCCCATGTGAGGGGTACTGAGG + Intronic
1192588396 X:72339291-72339313 AGGCCCTGTGCTGGGTGCTGGGG + Intronic
1193997350 X:88383069-88383091 TGCCCTTATGAAGAGTCCTGAGG - Intergenic
1194195984 X:90893462-90893484 TGTCACTGTTGTGGGTCCTGAGG - Intergenic
1195570218 X:106392285-106392307 TGACACTGTGATGGATGCTGGGG - Intergenic
1195894565 X:109732898-109732920 TGCTCCTGTGATGGACTCTGGGG - Intronic
1198333973 X:135649507-135649529 TGCACCCGTGATGTGTCCTATGG + Intergenic
1198446047 X:136715616-136715638 TGCCCTAGTGCTGGTTCCTGTGG - Intronic
1200541832 Y:4467643-4467665 TGTCACTGTTGTGGGTCCTGAGG - Intergenic
1201151597 Y:11098051-11098073 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic