ID: 1152589906

View in Genome Browser
Species Human (GRCh38)
Location 17:81206484-81206506
Sequence GAGGCTCACATGGGGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 961}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152589906_1152589917 13 Left 1152589906 17:81206484-81206506 CCTCTCAGCCCCATGTGAGCCTC 0: 1
1: 0
2: 2
3: 67
4: 961
Right 1152589917 17:81206520-81206542 ACTCTTTAAGAGCAAAGCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 212
1152589906_1152589916 12 Left 1152589906 17:81206484-81206506 CCTCTCAGCCCCATGTGAGCCTC 0: 1
1: 0
2: 2
3: 67
4: 961
Right 1152589916 17:81206519-81206541 AACTCTTTAAGAGCAAAGCCTGG 0: 1
1: 0
2: 1
3: 24
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152589906 Original CRISPR GAGGCTCACATGGGGCTGAG AGG (reversed) Intronic
900149431 1:1171668-1171690 GAGGCTCCCAGAGGGCAGAGGGG + Intergenic
900326134 1:2109573-2109595 GGGGGTCACACGGGGCCGAGTGG + Intronic
900342432 1:2195256-2195278 GTGGCTCACTTGGGCCTCAGGGG + Intronic
900439885 1:2649240-2649262 GATGCTCACCTGGGGTTGTGGGG - Intronic
900440114 1:2650657-2650679 GATGCTCACCTGGGGGTGTGGGG - Intronic
900441256 1:2656570-2656592 GATGCTCACCTGGGGGTGTGGGG - Intronic
900442258 1:2661748-2661770 GATGCTCACCTGGGGGTGTGGGG - Intronic
900443151 1:2666364-2666386 GATGCTCACCTGGGGGTGTGGGG - Intronic
900444045 1:2670980-2671002 GATGCTCACCTGGGGGTGTGGGG - Intronic
900444948 1:2675636-2675658 GATGCTCACCTGGGGGTGTGGGG - Intronic
900445657 1:2679370-2679392 GATGCTCACCTGGGGGTGTGGGG - Intronic
900446440 1:2683425-2683447 GATGCTCACCTGGGGGTGAAGGG - Intronic
900447112 1:2686836-2686858 GATGCTCACCTGGGGGTGTGGGG - Intronic
900447423 1:2688322-2688344 GATGCTCACCTGGGGGTGTGGGG - Intronic
900448609 1:2694262-2694284 GATGCTCACCTGGGGGTGTGGGG - Intronic
900449062 1:2696512-2696534 GATGCTCACCTGGGGGTGTGGGG - Intronic
900449469 1:2698520-2698542 GATGCTCACCTGGGGGTGTGGGG - Intronic
900452080 1:2755214-2755236 GATGCTCACCTGGGGGTGTGAGG - Intronic
900452529 1:2757463-2757485 GATGCTCACCTGGGGGTGTGGGG - Intronic
900452938 1:2759471-2759493 GATGCTCACCTGGGGGTGTGGGG - Intronic
900454083 1:2765382-2765404 GATGCTCACCTGGGGGTGTGGGG - Intronic
900454827 1:2769176-2769198 GATGCTCACCTGGGGGTGTGGGG - Intronic
900454876 1:2769379-2769401 GATGCTCACCTGGGGGTGTGGGG - Intronic
900455530 1:2772644-2772666 GATGCTCACCTGGGGGTGTGGGG - Intronic
900456365 1:2776920-2776942 GATGCTCACCTGGGGGTGTGGGG - Intronic
900456414 1:2777123-2777145 GATGCTCACCTGGGGGTGTGGGG - Intronic
900830244 1:4960410-4960432 GTGGCTCGCAGGGGGCTGTGTGG - Intergenic
901310124 1:8262952-8262974 GAGGATCACTTGAGCCTGAGAGG - Intergenic
901403376 1:9029960-9029982 GAGGATCACTTGAGCCTGAGTGG + Intergenic
901459622 1:9383728-9383750 GAGGCTCACTTGAGCCTGGGAGG + Intergenic
901588202 1:10316141-10316163 GAGGATCACTTGAGCCTGAGAGG + Intronic
902258273 1:15204961-15204983 CAGACTCACATTGGGCTGACGGG + Intronic
902739629 1:18426962-18426984 GAGGCACAGCTGGGGCAGAGAGG - Intergenic
902740023 1:18431375-18431397 GAGGATCACTTGGGCCTGGGAGG - Intergenic
903066826 1:20704307-20704329 TGCGCTCACATGGGGCTGAGGGG + Intronic
903602516 1:24553234-24553256 GAGGGTCACTTGGGCCTGGGAGG - Intergenic
903793778 1:25913036-25913058 GAGGATCACTTGAGCCTGAGAGG - Intergenic
903863732 1:26382152-26382174 GAGGATCACTTGGGCCTGGGAGG + Intergenic
903944153 1:26951313-26951335 GGGGGCCCCATGGGGCTGAGGGG - Intronic
904008649 1:27377509-27377531 GAGGATCACTTGAGCCTGAGAGG - Intergenic
904223298 1:28991610-28991632 GAGGATCACTTGAGTCTGAGAGG + Intronic
904285443 1:29450645-29450667 GAGGCTCAGATGGGGCATACTGG - Intergenic
904725796 1:32546989-32547011 GAGGATCACTTGAGCCTGAGAGG - Intronic
904726364 1:32551330-32551352 GAGGATCACTTGAGCCTGAGAGG + Intronic
905146534 1:35891652-35891674 GAGGATCACTTGAGCCTGAGAGG - Intronic
905185871 1:36196600-36196622 GAGGATCACTTGAGCCTGAGAGG - Intergenic
905560395 1:38922355-38922377 GAGGCTCACTTGAGCCTGGGAGG - Intronic
905578938 1:39068642-39068664 GAGGATCACTTGGGCCTGGGAGG + Intergenic
905673907 1:39811830-39811852 GAGGATCACATGAGTCTGGGAGG + Intergenic
906244277 1:44262226-44262248 TAGGCTAGCATGGGGCAGAGAGG - Intronic
906272882 1:44495121-44495143 GAGGATCACTTGAGGCTGGGAGG + Intronic
906508917 1:46400222-46400244 GAGGTGCACATGAGTCTGAGAGG + Intronic
907156682 1:52341382-52341404 GAGGCTCACCTGGGAATGAGAGG + Intronic
907220175 1:52901066-52901088 AAGGATCACTTGGGCCTGAGAGG + Intronic
907289726 1:53406030-53406052 GAGGATCACTTGAGGCTGGGAGG - Intergenic
907441336 1:54480490-54480512 GAGGCTCCCATAGGGCTGGGGGG - Intergenic
907516429 1:54996195-54996217 GAGGAACAGATGGGGATGAGGGG - Intergenic
907885401 1:58588232-58588254 GAGGATCACTTAGGCCTGAGAGG + Intergenic
908191699 1:61710334-61710356 GAGGATCACTTGGGCCTGAGAGG + Intronic
909020283 1:70423479-70423501 GAGGATCACTTGGGCCTGAAAGG + Intronic
910173570 1:84403874-84403896 GAGGGTCACCTGGGCCTGGGAGG - Intronic
910485067 1:87703926-87703948 GAGGATCACGTGAGGCTGGGAGG + Intergenic
910834370 1:91493568-91493590 GAGGATCACCTGAGCCTGAGAGG - Intergenic
910840959 1:91560836-91560858 GAGGATCACTTGAGCCTGAGAGG + Intergenic
910899572 1:92105340-92105362 GAGGATCACTTGGGCCTGGGAGG - Intronic
911196522 1:95000444-95000466 GAGGATTACTTGGGCCTGAGAGG + Intronic
911620636 1:100063704-100063726 GAGGATCACTTGGGCCTGAGAGG + Intronic
912521352 1:110247315-110247337 GAGGATCACTTGGGCCTGAGAGG - Intronic
912744818 1:112237334-112237356 GAGGATCACTTGGGCCTGAGAGG - Intergenic
912992476 1:114502594-114502616 GAGGATCACTTGAGGCTGGGAGG - Intronic
913082428 1:115400942-115400964 GAGGGTCACTTGAGCCTGAGAGG + Intergenic
913184439 1:116356167-116356189 GAGGATCACCTGGGCCTGGGAGG + Intergenic
913446481 1:118955802-118955824 GAGGCACACATAGGGAAGAGTGG - Intronic
915394848 1:155575530-155575552 GAGGATCACCTGGGTCTGGGAGG - Intergenic
915550470 1:156630133-156630155 GAGGATCACTTGAGCCTGAGAGG - Intergenic
915587794 1:156853687-156853709 CAGGGTCACATGGGGCTGGGTGG - Intronic
915950406 1:160186529-160186551 GAGGGTCAGATGGAGCAGAGGGG - Intronic
916658602 1:166900231-166900253 GAGGCTGCCATGGGGGTGGGGGG - Intergenic
917412546 1:174774788-174774810 GAGGATCACTTGGGCCTGAGGGG + Intronic
917737818 1:177936647-177936669 GAGGCTCAGATGGAGAGGAGTGG - Intronic
918125308 1:181578475-181578497 GAGGATCACTTGGGCCTGGGAGG + Intronic
918184042 1:182111609-182111631 GAGGCTCACCTGGAGTTGGGCGG + Intergenic
918605444 1:186419481-186419503 GAGCATCACCTGGGGCTGGGAGG + Exonic
919620309 1:199857686-199857708 GAGGATCACCTGAGGCTGAGAGG - Intergenic
919776622 1:201198512-201198534 GAGGATCACTTGGGCCTGGGAGG - Intronic
919949922 1:202353697-202353719 GAGGATCACTTGAGCCTGAGAGG - Intronic
920289092 1:204904185-204904207 GAGGATCACCTGAGGCTGGGAGG - Intronic
920825766 1:209423124-209423146 GAGCCTCTCATGGGGCAGGGGGG + Intergenic
921152918 1:212415822-212415844 GAGGCTCCCAGTGGCCTGAGTGG - Intergenic
921174295 1:212580402-212580424 GAGGGTCACTTGGGCCTGGGAGG - Intronic
921713854 1:218398970-218398992 GAGGATCACTTGAGCCTGAGAGG - Intronic
921900974 1:220450479-220450501 GAGCTTGACAAGGGGCTGAGGGG + Intergenic
921998109 1:221443805-221443827 GAGTCTCCCATGGGGATGATGGG - Intergenic
922162414 1:223088401-223088423 GAGGGAGACATGGGGTTGAGAGG - Intergenic
922201525 1:223405735-223405757 GAGGATCACTTGAGTCTGAGAGG + Intergenic
922298967 1:224278820-224278842 GAGGATCACGTGAGCCTGAGAGG - Intronic
922340862 1:224653989-224654011 GAGGATCACATGAGCCTGAGAGG + Intronic
922501464 1:226099740-226099762 GAGGATCACTTGAGTCTGAGAGG + Intergenic
922876955 1:228947637-228947659 GAGGGTCACAAGGTGCTCAGTGG - Intergenic
923145741 1:231196484-231196506 GAGGATCACTTGAGCCTGAGAGG + Intronic
923176055 1:231466835-231466857 GAGGATCACTTGGGGCTGGGAGG - Intergenic
923305302 1:232682818-232682840 GAGGATCACTTGAGCCTGAGAGG + Intergenic
923305329 1:232682996-232683018 GAGGATCACTTGAGCCTGAGAGG + Intergenic
923337662 1:232984453-232984475 GGGGCTCACATGGCTCGGAGAGG + Exonic
924136538 1:240972957-240972979 GAGGATCACCTGGGCCTGGGAGG + Intronic
924517267 1:244776860-244776882 GAGGATCACTTGAGACTGAGAGG - Intergenic
924660075 1:246007725-246007747 GAGGATCACATGAGCCTGGGAGG + Intronic
1062871012 10:904462-904484 GAGGCTCACTTGAGCCTGGGGGG + Intronic
1062904956 10:1173644-1173666 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1063021993 10:2137999-2138021 GAGGCTCACATGGCGCAGGATGG - Intergenic
1063723515 10:8610456-8610478 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1063939277 10:11110182-11110204 GAGGATCACTTGAGCCTGAGAGG + Intronic
1064376030 10:14796700-14796722 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1064528344 10:16281757-16281779 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1064774116 10:18756488-18756510 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1065315977 10:24464573-24464595 GAGGATCACTTGAGCCTGAGAGG - Intronic
1065328578 10:24571101-24571123 GAGGCTCAGAAAGAGCTGAGGGG + Intergenic
1065531501 10:26674806-26674828 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1065619985 10:27570880-27570902 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1065860270 10:29866826-29866848 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1065920710 10:30390413-30390435 GAGGATCACTTGGGCCCGAGAGG - Intergenic
1066015164 10:31233650-31233672 GTGGCTCACATGGACCTCAGTGG - Intergenic
1066183654 10:32987824-32987846 GAGGATCACTTGAGGCTGGGAGG - Intronic
1066244673 10:33571097-33571119 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1066656266 10:37701812-37701834 GAGGCTCACCTGGGACACAGTGG + Intergenic
1067778532 10:49180016-49180038 GAGGGTCACATGGGGAAGAGAGG + Intronic
1068636747 10:59356565-59356587 CAGGCTTGAATGGGGCTGAGTGG - Intronic
1068762614 10:60730245-60730267 GAGGATCACTTGGGCCTGGGAGG - Intronic
1068995050 10:63192643-63192665 GAGGATCGCCTGGGCCTGAGAGG + Intronic
1069008389 10:63343946-63343968 GAGGATCACTTGGGCCTGGGAGG + Intronic
1069354825 10:67572997-67573019 GAGGATCACTTGAGCCTGAGAGG + Intronic
1069673165 10:70227559-70227581 GAGGATCACTTGTGCCTGAGAGG + Intronic
1069692112 10:70360524-70360546 GAGGATCACTTGAGCCTGAGAGG - Intronic
1069792824 10:71034133-71034155 CAGGCTCAGCTGCGGCTGAGGGG + Intergenic
1069997289 10:72350307-72350329 GAGGATCACTTGGGCCTGGGTGG + Intronic
1070222065 10:74458219-74458241 GAGGATCACTTGGGCCTGTGAGG - Intronic
1070399282 10:76038941-76038963 GAGGCTCAACTGGGGCTGGATGG + Intronic
1070469876 10:76768220-76768242 GAGGATCACATGGGCCTGGGAGG - Intergenic
1070487885 10:76948092-76948114 GAGGATCACTTGAGCCTGAGAGG - Intronic
1070518743 10:77232974-77232996 GAGGATCACTTGAGCCTGAGAGG - Intronic
1070732184 10:78838175-78838197 GAGGCTCACATGGGGGAGCCTGG - Intergenic
1070934648 10:80283817-80283839 GATGCTCCCATCGGGCTGAAAGG + Intronic
1071113874 10:82194312-82194334 GAGGGGCACATGGGTCAGAGAGG + Intronic
1072261456 10:93678742-93678764 GAGGATCACATGGGCCTCCGAGG + Intronic
1072352977 10:94576201-94576223 CAGGCTCACATGAGCCTGGGAGG - Intronic
1072665581 10:97390209-97390231 GAGACTCAGATAGGGCTGACAGG + Intronic
1072932702 10:99680674-99680696 GAGGATCACTTGGGCCTGGGGGG - Intronic
1073162230 10:101408394-101408416 GAGGATCACTTGAGGCTGGGAGG - Intronic
1073390295 10:103170610-103170632 GAGGATCACCTGCGTCTGAGAGG - Intronic
1073436565 10:103520405-103520427 GAGGGTCACAAGGTGCTCAGTGG + Intronic
1073589582 10:104743716-104743738 CAGGTTCACAGGGGGCTTAGGGG - Intronic
1074412405 10:113239715-113239737 GAGGAGCACAGGGGGCTGGGAGG + Intergenic
1074550537 10:114438347-114438369 GAGGGTCACCTGGGCCTGATAGG - Intronic
1074554049 10:114472007-114472029 GAGGACCCCAAGGGGCTGAGAGG + Intronic
1074693290 10:116026268-116026290 GCAGCTCACAGAGGGCTGAGAGG + Intergenic
1075794196 10:125107194-125107216 GAGGCTGAGATGGGGCAGTGGGG - Intronic
1075946368 10:126436749-126436771 GAGGATCACTTGAGCCTGAGAGG - Intronic
1076431934 10:130410159-130410181 GAGGCTCACATGAGCCCGAGGGG - Intergenic
1076666861 10:132098123-132098145 GAGGATCGCTTGGGGCTGGGAGG - Intergenic
1076893451 10:133296565-133296587 GAGGATCACTTGAGCCTGAGAGG - Intronic
1076903510 10:133351285-133351307 GAGGCCCACCTGGGGCTGCATGG - Intronic
1077231622 11:1460328-1460350 GAGGCTGAGATGGGGCCGAGCGG - Intronic
1077284048 11:1758074-1758096 GAGGCTGACACGGGGCGGAGGGG + Intronic
1077453548 11:2664753-2664775 GGGTCTCACAGGGGGCAGAGTGG + Intronic
1077558581 11:3240950-3240972 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1077679454 11:4225059-4225081 GGGGCTCACAAGGTGCTCAGTGG + Intergenic
1077688872 11:4321643-4321665 GGGGCTCACAAGGTGCTCAGTGG + Intergenic
1078233799 11:9465912-9465934 GAGGATCACTTGGGCCTGGGAGG - Intronic
1078381487 11:10846026-10846048 GAGCCTAACATGGTGCTGTGTGG + Intronic
1078593862 11:12669997-12670019 GAGGCTCACTTGAGCCTGGGAGG + Intergenic
1079292658 11:19202160-19202182 GAGGCTCACAGCTGGCTGGGGGG - Intronic
1079418473 11:20263182-20263204 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1079433504 11:20421126-20421148 GAGGATCACTTGGGCCTGGGAGG - Intronic
1079567391 11:21899444-21899466 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1079685485 11:23354165-23354187 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1079924049 11:26470320-26470342 GAGGATCACTTGAGCCTGAGAGG + Intronic
1080313792 11:30925549-30925571 GAGACTCAAATGGGTCTGATGGG - Intronic
1080887915 11:36383372-36383394 GAGACTGGCATGGGACTGAGTGG - Intronic
1081710140 11:45211025-45211047 GAGCCTGCCATGGGGGTGAGCGG - Intronic
1081926268 11:46831616-46831638 GAGGCTCACATGAGGCTGGGAGG - Intronic
1082099325 11:48158860-48158882 GAGGATCACTTGAGCCTGAGAGG + Intronic
1082284465 11:50303756-50303778 GAGGATCACATGAACCTGAGTGG - Intergenic
1083056383 11:59824889-59824911 GAGGATCACTTGGGCCAGAGAGG - Intergenic
1083690895 11:64408245-64408267 GAGGCTCACTTGAGGCTGGGAGG - Intergenic
1083712245 11:64556505-64556527 GTGGCTGACGAGGGGCTGAGAGG - Intronic
1083718411 11:64592085-64592107 GTGGCTGACGAGGGGCTGAGAGG - Intronic
1083749672 11:64754217-64754239 GAGCATCAGATGGGGCAGAGGGG + Intronic
1083809892 11:65097765-65097787 GAGGATCACATGAGCCTGGGAGG + Intronic
1083873888 11:65509695-65509717 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1083919929 11:65777022-65777044 GAGGATCACCTGAGCCTGAGAGG + Exonic
1084034141 11:66497799-66497821 GAGGATCACTTGAGCCTGAGGGG + Intronic
1084332933 11:68440242-68440264 GAGGCTCACAGAGGGCAGACAGG - Intronic
1084653429 11:70502030-70502052 GGTGCACACATGGGGCTGCGGGG + Intronic
1084658121 11:70531280-70531302 GAGGCACTCATGGGGCTGGCAGG - Intronic
1084710801 11:70842751-70842773 GAGGCTCCCAGGGGGGTGGGAGG + Intronic
1084804575 11:71570002-71570024 GGAGCTCACATGGGGCTGTGAGG - Intergenic
1084805880 11:71578626-71578648 GGAGCTCACATGGGGCTGTGAGG + Intergenic
1084877660 11:72145229-72145251 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1085077842 11:73607470-73607492 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1085274839 11:75291816-75291838 CAGGAACACATGAGGCTGAGAGG + Intronic
1085510566 11:77086066-77086088 CAGGCCCACATGAGCCTGAGGGG - Intronic
1085567522 11:77527937-77527959 GAGGATCACTTGAGCCTGAGAGG - Intronic
1085578171 11:77626174-77626196 GAGGATCGCTTGGGCCTGAGAGG - Intronic
1087440124 11:98173428-98173450 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1087829037 11:102798933-102798955 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1087906062 11:103699432-103699454 TAAGCTCCCATGGAGCTGAGAGG + Intergenic
1087986704 11:104691151-104691173 GAGAATCACATGAGCCTGAGAGG + Intergenic
1088216174 11:107512401-107512423 GAGGATCACCTGGGCCTGGGAGG - Intronic
1088874673 11:113924533-113924555 GAGGATCACTTGGGCCTGGGAGG + Intronic
1089158627 11:116421287-116421309 CAGGCTCACCTGTGGCTCAGGGG - Intergenic
1089633740 11:119799193-119799215 GTGGCTCACCTGGGCCTTAGCGG - Intergenic
1089746011 11:120617467-120617489 GAGGATCACTTGGGCCTGCGAGG - Intronic
1089834309 11:121356809-121356831 GAGGCTCACTTGAGCCTGGGAGG - Intergenic
1089842328 11:121428942-121428964 GAGGCACGCAGTGGGCTGAGTGG + Intergenic
1090299360 11:125621943-125621965 GAGGATCACTTGGGCCTGGGAGG + Exonic
1090650799 11:128804221-128804243 GAGGCTCAGAAGGGGCTGAAGGG + Intronic
1090744728 11:129696604-129696626 CAGTCTCTCCTGGGGCTGAGGGG - Intergenic
1090858191 11:130629937-130629959 GAGGATCACTTGGGTCTGGGAGG - Intergenic
1091360837 11:134977531-134977553 GAGGCCCAGGTGGGACTGAGGGG - Intergenic
1091884787 12:4008681-4008703 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1091998195 12:5011679-5011701 GAGGGTCACCTGGGCCTGGGAGG + Intergenic
1092054554 12:5498034-5498056 GAGTCTCACATGTGGCAGAAAGG - Intronic
1092527827 12:9320194-9320216 GAGGCACACATTCTGCTGAGAGG - Intergenic
1092539442 12:9411567-9411589 GAGGCACACATTCTGCTGAGAGG + Intergenic
1092643976 12:10549682-10549704 GAGGCTCACTTGAGTCTAAGAGG - Intergenic
1092654195 12:10667538-10667560 GAGGATCACTTGAGCCTGAGAGG + Intronic
1092780796 12:11984938-11984960 GACGCTCACATGGAGGTGAGTGG + Intergenic
1092849076 12:12611047-12611069 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1093042917 12:14405502-14405524 GAGGATCACTTGAGCCTGAGAGG - Intronic
1093163865 12:15782409-15782431 GAGGATCACCTGGGCCTGGGTGG + Intronic
1093167684 12:15823970-15823992 GAGGATCACTTGGGCCTGGGAGG - Intronic
1093918601 12:24833908-24833930 GAGGATCACTTGGGCCTGGGAGG - Intronic
1094058084 12:26286449-26286471 GAGAATCACATGAGGCTGGGAGG + Intronic
1094264519 12:28540889-28540911 GAGGCTCACATGGGCTAGATTGG + Intronic
1095266869 12:40170812-40170834 GAGGCTCACATGGGGATAAAGGG + Intergenic
1095751166 12:45712870-45712892 GAGGGTCACTTGAGCCTGAGAGG - Intergenic
1095893624 12:47258477-47258499 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1096022578 12:48334335-48334357 GAGGCTCACTTGAGCCTGGGAGG + Intergenic
1096106211 12:48998244-48998266 GAGGCTCACCTGCTGCTGAGAGG - Exonic
1096290565 12:50339102-50339124 GAGGATCCCATGAGCCTGAGAGG - Intronic
1097131607 12:56815216-56815238 GAGGATCACATGAGCCTGGGAGG - Intergenic
1097855829 12:64460989-64461011 GAGGATCACCTGAGCCTGAGAGG + Intronic
1098038819 12:66334068-66334090 GAGGATCACTTGAGACTGAGAGG + Intronic
1098041982 12:66361832-66361854 GAGGCCCACATGGTCCTGAGAGG - Intronic
1098893452 12:76031924-76031946 GACGCTCACAGGGCGCTGCGAGG + Exonic
1099341140 12:81436189-81436211 GAGGATCACCTGAGGCTAAGAGG + Intronic
1099452764 12:82827785-82827807 GAGGATCACTTGAGCCTGAGAGG - Intronic
1099614472 12:84917209-84917231 GAGGTTCACTTGAGCCTGAGAGG - Intergenic
1099959979 12:89387691-89387713 GAGGATCACATGAGCCTGGGAGG - Intergenic
1100191005 12:92191639-92191661 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1100549382 12:95632977-95632999 GAGGATCATTTGGGGCTGGGAGG - Intergenic
1100987401 12:100216243-100216265 GAGGATCACTTGAGCCTGAGAGG - Intronic
1101133189 12:101710254-101710276 GAGGATCACTTGGGCCTGGGAGG + Intronic
1101230579 12:102737201-102737223 GAGGATCACTTGGGCCTGAGAGG - Intergenic
1101267242 12:103101937-103101959 GTTGCTCACATGGGGCTGCATGG + Intergenic
1101439780 12:104694929-104694951 GTGGCTCCCATTTGGCTGAGGGG + Intronic
1101465083 12:104940341-104940363 AAGGCTCACCTGGGGGGGAGGGG + Intronic
1101621683 12:106395140-106395162 GAGGATCACTTGAGCCTGAGAGG + Intronic
1101639855 12:106580238-106580260 GAAGCTTACATGGGAGTGAGGGG - Intronic
1102279961 12:111611043-111611065 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1102285054 12:111649240-111649262 GAGGATCACATGAGTCTGGGAGG - Intronic
1102501056 12:113352674-113352696 GAGGATCACTTGGGCCTGCGAGG - Intronic
1102509882 12:113407694-113407716 GAGGATCACTTGAGCCTGAGTGG + Intronic
1103469531 12:121169053-121169075 GAGGATCACTTGGGCCTGGGAGG - Intronic
1103494519 12:121351281-121351303 GAGGATCACCTGAGCCTGAGAGG + Intronic
1103654626 12:122460347-122460369 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1103657117 12:122480559-122480581 GAGGATCACTTGAGCCTGAGAGG - Intronic
1103687279 12:122742019-122742041 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1103753218 12:123181775-123181797 GAGGCTCACTTGAGCCTGGGAGG + Intronic
1103780542 12:123395933-123395955 GAGGATCACTTGGTCCTGAGAGG - Intronic
1104025543 12:125023634-125023656 GAGGATCACTTGAGGCTGGGAGG - Intronic
1104266380 12:127237003-127237025 GAGGTTTACATGGTGCTGTGTGG - Intergenic
1104462099 12:128964291-128964313 GAGGATCACTTGAGCCTGAGAGG + Intronic
1105028406 12:132865442-132865464 GAGGATCACCTGAGGCTGGGAGG - Intronic
1105269249 13:18855453-18855475 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1105866580 13:24466269-24466291 GAGGATCACTTGAGCCTGAGAGG - Intronic
1105958665 13:25308390-25308412 GAGGATCACTTGGGCCCGAGAGG - Intronic
1107011524 13:35675427-35675449 GAGGGTGACATGAGGCTGTGGGG - Intergenic
1107036431 13:35907250-35907272 GAGGCTCACTTGAGTCCGAGAGG - Intronic
1107076703 13:36329009-36329031 GAGGATCACATGAGCCTGGGAGG + Intronic
1107937645 13:45358462-45358484 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1108182635 13:47855878-47855900 GAGGATCACCTGGGCCTGGGAGG - Intergenic
1108219595 13:48219300-48219322 GAGGATCACCTGAGGCTGGGAGG + Intergenic
1108410212 13:50138220-50138242 GAGGATCACTTGAGCCTGAGAGG + Intronic
1108685155 13:52813153-52813175 GGGGCTCCCATGGGGCTGAATGG + Intergenic
1110364356 13:74664537-74664559 GAGGCTCACTTGAGCCTGGGAGG - Intergenic
1110405307 13:75144293-75144315 GAGGCTTACATGGGCTTCAGAGG + Intergenic
1110565437 13:76953049-76953071 GAGGATCACTTGAGCCTGAGAGG + Intronic
1114063572 14:19040484-19040506 GAGGCTCAGATGGAGTTAAGTGG + Intergenic
1114098684 14:19359512-19359534 GAGGCTCAGATGGAGTTAAGTGG - Intergenic
1114311023 14:21467294-21467316 GAGGATCACTTGGGCCTGTGAGG - Intronic
1115029830 14:28781735-28781757 GAGAAGAACATGGGGCTGAGAGG - Intronic
1115102967 14:29725289-29725311 GAGGCTGAGAGGGGGCTGGGAGG + Intronic
1115517477 14:34200223-34200245 GAGGATCACTTGAGCCTGAGAGG + Intronic
1115553779 14:34527786-34527808 GTGGCTGCCAAGGGGCTGAGGGG + Intronic
1115686565 14:35802769-35802791 GAGGATCACCTGGGCCTGGGAGG - Intronic
1116419701 14:44718869-44718891 GAACCTGATATGGGGCTGAGTGG + Intergenic
1116812911 14:49556417-49556439 GAGGATCACATGAGTCTGGGAGG + Intergenic
1117378223 14:55135062-55135084 GAGGATCACATGAGCCTGGGAGG + Intronic
1117415465 14:55491433-55491455 GAGGTTCACTTGAGCCTGAGAGG - Intergenic
1117836873 14:59816841-59816863 GAGGATCACCTGAGCCTGAGAGG + Intronic
1117842442 14:59873799-59873821 GAGGCTGGCAGGGGCCTGAGGGG - Intergenic
1118274631 14:64374816-64374838 GAGGATCACCTGGGCCTGGGAGG - Intergenic
1118869561 14:69729890-69729912 GAGGCTCACTTGAGCCTGGGAGG - Intronic
1119186036 14:72643324-72643346 GAGGCTTAAAGGGGCCTGAGGGG - Intronic
1119263583 14:73251934-73251956 GAGGCTGGCAGGGGGCTGTGAGG + Intronic
1120212826 14:81651077-81651099 GAGGATCACTTGGGCCTGAGAGG - Intergenic
1120969168 14:90192975-90192997 GAGGCTCACCTGAGGCCGGGAGG + Intergenic
1121096259 14:91219982-91220004 GAGGCCTCCATCGGGCTGAGGGG - Intronic
1121221857 14:92291486-92291508 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1121542139 14:94736281-94736303 GAGGATCGCTTGAGGCTGAGGGG - Intergenic
1121577647 14:95001484-95001506 GAGACTCAAAAGGTGCTGAGGGG + Intergenic
1121667020 14:95680363-95680385 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1121788687 14:96682412-96682434 GAGGCTCACAGGAGGCACAGTGG - Intergenic
1122056408 14:99101103-99101125 GAGGCCCAGAAGGGGGTGAGGGG - Intergenic
1122148236 14:99706817-99706839 GAGGGCCACATGGGGTAGAGGGG + Intronic
1122158064 14:99762707-99762729 GAGGTTCACTTGAGCCTGAGAGG + Intronic
1122204164 14:100140146-100140168 GAGGCTCACTTGAGCCTGGGAGG + Intronic
1122268723 14:100558797-100558819 GAGACTGCCATGGGGCTGTGCGG - Intronic
1122527074 14:102394511-102394533 GAGGATCACTTGAGCCTGAGAGG + Intronic
1122584824 14:102798309-102798331 GAGGATCACTTGAGACTGAGAGG - Intronic
1122599247 14:102913188-102913210 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1122682811 14:103479108-103479130 GAGGATCACTTGGGTCTGGGAGG - Intronic
1123029244 14:105443459-105443481 GAGGATCACTTGGGCCTGGGAGG - Intronic
1123217733 14:106827724-106827746 GAGGTTCACATGGAGGTTAGGGG - Intergenic
1123492971 15:20797689-20797711 GAGGCTCAGATGGAGTTAAGTGG - Intergenic
1123549472 15:21366791-21366813 GAGGCTCAGATGGAGTTAAGTGG - Intergenic
1123739628 15:23224186-23224208 GAGGATCACCTGGGCCTGGGAGG + Intergenic
1124290849 15:28453157-28453179 GAGGATCACCTGGGCCTGGGAGG + Intergenic
1124684406 15:31768567-31768589 GAGGCTCACTTGAGTCTGGGAGG + Intronic
1125103341 15:35941351-35941373 GAGGATCACTTGAGGCTGGGTGG + Intergenic
1125443570 15:39729482-39729504 GAGGATCACTTGAGCCTGAGAGG + Intronic
1125483609 15:40097437-40097459 GAGTATCACATGAGGCAGAGCGG + Intronic
1125634971 15:41179831-41179853 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1125660370 15:41389681-41389703 GAGGATCACCTGAGGCTGGGAGG + Intronic
1125757447 15:42073090-42073112 GAGGATCACTTGGGCCTGGGAGG - Intronic
1125814123 15:42569394-42569416 GAGGATCACTTGAGCCTGAGAGG - Exonic
1126012543 15:44316894-44316916 GAGGATCACATGGGCTTGGGAGG + Intronic
1126821421 15:52507712-52507734 GAGGATCACTTGAGCCTGAGAGG + Intronic
1127246856 15:57186407-57186429 GAGGATCACATGAGCCTGGGAGG + Intronic
1127940914 15:63695123-63695145 GAGGCTCACTTGAGCCTGGGAGG - Intronic
1127975403 15:63993290-63993312 TAGGCACACATGGGGCAAAGTGG + Intronic
1127985888 15:64070047-64070069 GAGGATCACTTGAGCCTGAGAGG + Intronic
1128059468 15:64725623-64725645 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1128102629 15:65015745-65015767 GAGGCTCACTTGAGCCTGGGAGG + Intronic
1128147304 15:65338990-65339012 GAGGATCACCTGAGCCTGAGAGG - Intronic
1128167907 15:65483430-65483452 GAGGATCACTTGAGCCTGAGAGG + Intronic
1128174430 15:65542351-65542373 GAGGTTCACTTGGGCCTGAGAGG - Intronic
1129047068 15:72744972-72744994 GAGGCTCACTTGAGCCTGAGAGG + Intergenic
1129353163 15:74969394-74969416 GAGGATCACCTGAGCCTGAGAGG - Intronic
1129360584 15:75021535-75021557 GAGCCTCACAGCGGGCTGTGGGG + Intergenic
1129446112 15:75619550-75619572 GAGGATCACCTGAGCCTGAGAGG + Intronic
1129794733 15:78367469-78367491 GAGGATCACCTGGGCCTGGGAGG + Intergenic
1130271125 15:82448366-82448388 GAGGCACACATTGGTCTCAGTGG + Intergenic
1130463463 15:84175715-84175737 GAGGCACACATTGGTCTCAGTGG + Intronic
1130489209 15:84419079-84419101 GAGGCACACATTGGTCTCAGTGG - Intergenic
1130500802 15:84497827-84497849 GAGGCACACATTGGTCTCAGTGG - Intergenic
1130559315 15:84945947-84945969 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1130584439 15:85169540-85169562 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1130601659 15:85279101-85279123 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1132221092 15:100106084-100106106 GAGGATCACTTGAGCCTGAGAGG - Intronic
1202957803 15_KI270727v1_random:94009-94031 GAGGCTCAGATGGAGTTAAGTGG - Intergenic
1132538302 16:494811-494833 GAGGATCACATGAGCCTGGGAGG + Intronic
1133043782 16:3074936-3074958 GGGCCTGGCATGGGGCTGAGGGG + Intronic
1134081251 16:11326587-11326609 GAGGATCACTTGAGCCTGAGAGG - Intronic
1134413715 16:14025268-14025290 GAGGATCACTTGAGGCTGACAGG - Intergenic
1134646205 16:15868976-15868998 GAGGATCACCTGGGCCTGTGAGG + Intronic
1134676020 16:16091091-16091113 GAAGCTCAGATGGGTCTGAAGGG - Intronic
1135039447 16:19106803-19106825 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1135187029 16:20323983-20324005 GACGCTCCCATGTGGCTGAATGG - Exonic
1135570624 16:23546643-23546665 GAGGATCACTTGAGCCTGAGAGG - Intronic
1136251748 16:29009738-29009760 GGGGCTGGCAAGGGGCTGAGAGG + Intergenic
1136398361 16:30005050-30005072 GAGGCTCTCGAGGGGCTGAGGGG + Intronic
1136456068 16:30380389-30380411 GAGGATCACCTGAGCCTGAGAGG - Intronic
1136527757 16:30843469-30843491 GAGGGTCACTTGGGCCTGGGAGG + Intronic
1136556795 16:31011625-31011647 CAGGGTCACATGCTGCTGAGAGG - Intergenic
1136707910 16:32204500-32204522 GAGGATCACCTGGGCCTGGGAGG - Intergenic
1136760000 16:32724911-32724933 GAGGATCACCTGGGTCTGGGAGG + Intergenic
1136808104 16:33145475-33145497 GAGGATCACCTGGGTCTGGGAGG - Intergenic
1137428311 16:48398427-48398449 GAGGATCACTTGAGCCTGAGAGG + Intronic
1137695961 16:50462403-50462425 GAGGATCACATGAGCCTGGGAGG - Intergenic
1138153632 16:54682961-54682983 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1138220318 16:55244875-55244897 GAGGATCACCTGGGCCTGGGAGG - Intergenic
1138413882 16:56860225-56860247 GAGGCCCACATAGTGCTGTGGGG - Intergenic
1138919610 16:61511282-61511304 GTAGCTCAAATGGGGTTGAGAGG - Intergenic
1139114256 16:63930124-63930146 GATTCTCTCAGGGGGCTGAGAGG + Intergenic
1139443907 16:66985040-66985062 GATGCTCACATGGGGCACAGGGG - Intergenic
1139607977 16:68033572-68033594 GAGGATCACTTGGGCCTGGGAGG - Intronic
1139736002 16:68988953-68988975 GAGGATCACCTGAGGCTGCGAGG - Intronic
1139868829 16:70086929-70086951 GAGGGTCACTTGAGGCTGGGAGG + Intergenic
1140127698 16:72131933-72131955 GAGGATCACTTGAGCCTGAGAGG - Intronic
1140316527 16:73903295-73903317 GAGGATCACATGGGCCTGGCAGG - Intergenic
1140386565 16:74545268-74545290 GAGGGTCACTTGAGGCTGGGAGG - Intronic
1140517108 16:75551285-75551307 GAGGATCACTTGAGCCTGAGAGG - Intronic
1140843140 16:78860903-78860925 GAGGATCACCTGGGCCTGGGAGG - Intronic
1140892754 16:79298943-79298965 CAGGCGCTCAGGGGGCTGAGAGG - Intergenic
1140939438 16:79707858-79707880 GAGGCTGACTGAGGGCTGAGGGG - Intergenic
1141090357 16:81126063-81126085 GAGGATCACATGAGCCTGGGAGG - Intergenic
1141411140 16:83833955-83833977 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1141413223 16:83850582-83850604 GAGGATCACCTGAGACTGAGAGG + Intergenic
1141602690 16:85136052-85136074 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1141632777 16:85297587-85297609 GAGGATCACATGAGCCTGAGAGG - Intergenic
1142066730 16:88067233-88067255 GCTGGTCTCATGGGGCTGAGGGG + Intronic
1142368806 16:89666260-89666282 GAGGATCACTTGGGCCTGGGAGG + Intronic
1142377777 16:89715609-89715631 GAGGCTCACTTGAGCCTGACAGG - Intronic
1142398001 16:89843787-89843809 GAGGATCACTTGAGCCTGAGGGG - Intronic
1203062155 16_KI270728v1_random:985232-985254 GAGGATCACCTGGGCCTGGGAGG + Intergenic
1142756913 17:2021946-2021968 GAGGATCACTTGAGTCTGAGAGG - Intronic
1143723020 17:8827060-8827082 GAGGGTGAAATGGGGGTGAGAGG - Intronic
1143815693 17:9512550-9512572 GAGGCTCACTTGAGCCTGGGAGG - Intronic
1144656092 17:17037727-17037749 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1144891833 17:18498828-18498850 GAGGTTCACACGAGGCTGACGGG + Intergenic
1145039192 17:19564259-19564281 GAGGATCACTTGAGCCTGAGAGG + Intronic
1145140389 17:20445489-20445511 GAGGTTCACACGAGGCTGACGGG - Intergenic
1145291155 17:21546877-21546899 GAGGATCACTTGAGCCTGAGAGG + Intronic
1145786069 17:27594674-27594696 GGGCCACACATGGTGCTGAGAGG + Intronic
1145809920 17:27758513-27758535 GAGGTTCACACGAGGCTGACGGG + Intronic
1145822517 17:27850253-27850275 GAGGATCACTTGAGCCTGAGAGG + Intronic
1146196936 17:30821248-30821270 GAGGATCACTTGAGCCTGAGAGG + Intronic
1146200121 17:30850049-30850071 GAGGATCACATGAGCCTGGGAGG + Intronic
1146301773 17:31695087-31695109 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1147059493 17:37863461-37863483 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1147122956 17:38346768-38346790 GAGGCTCACTTGAGCCTGGGAGG - Intergenic
1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG + Exonic
1147694228 17:42339164-42339186 GAGGATCGCTTGGGCCTGAGAGG + Intronic
1147777976 17:42917045-42917067 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1147791948 17:43019623-43019645 GAGGCTCTCGTGGGGGTGGGGGG - Intronic
1147908678 17:43841161-43841183 GAGGATCACTTGAGCCTGAGGGG - Intergenic
1148107848 17:45128680-45128702 CAGGCACACACGGGGCTGTGGGG + Intronic
1148173612 17:45545248-45545270 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1148275657 17:46300201-46300223 GAGGATCACTTGGGCCTGGGAGG - Intronic
1148297767 17:46517777-46517799 GAGGATCACTTGGGCCTGGGAGG - Intronic
1148362315 17:47022258-47022280 GAGGATCACTTGGGCCTGGGAGG - Intronic
1148408769 17:47445965-47445987 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1148483613 17:47976447-47976469 GAGGATCGCTTGAGGCTGAGAGG - Intronic
1148527531 17:48355365-48355387 GAGGATCACTTGAGCCTGAGAGG - Intronic
1148741628 17:49896605-49896627 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1148856267 17:50580754-50580776 GAGGGCCCCATGGGGGTGAGCGG + Intronic
1148990430 17:51661385-51661407 GAGTATCACATTGGGCTGCGTGG + Intronic
1149183619 17:53971468-53971490 GAGGCTGACATGGGGAGGAAAGG - Intergenic
1149464989 17:56871054-56871076 GAGGGTCACTTGAGCCTGAGAGG + Intergenic
1149485913 17:57042733-57042755 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1149509896 17:57231690-57231712 GAGGCTCACTTGAGCCTGGGAGG + Intergenic
1149692021 17:58585529-58585551 GAGGATCACTTGGACCTGAGAGG - Intronic
1149748504 17:59122698-59122720 GAGGATCACTTGGGCCTGGGAGG + Intronic
1149751075 17:59145898-59145920 GAGGATCACTTGGGCCCGAGAGG + Intronic
1149766981 17:59287473-59287495 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1149826154 17:59830173-59830195 GAGGATCACTTGGGCCTGGGAGG - Intronic
1150081171 17:62240579-62240601 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1150110557 17:62495502-62495524 GAGGATCACTTGAGGCTGGGAGG - Intronic
1150149401 17:62796901-62796923 GAGGATAACTTGAGGCTGAGAGG + Intronic
1150404819 17:64892163-64892185 GAGGATCACTTGGGCCTGGGAGG + Intronic
1150758224 17:67935335-67935357 GAGGATCACATGGGCCCAAGAGG + Intronic
1150761073 17:67962051-67962073 GAGGATCACATGAGCCTGGGAGG + Intronic
1150883189 17:69054436-69054458 AAGGATCACTTGGGCCTGAGAGG + Intronic
1151151572 17:72092358-72092380 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1151172846 17:72262467-72262489 GAGGATCACATGGGGCAGTTTGG - Intergenic
1151237339 17:72730747-72730769 GAGGATCACTTGAGCCTGAGAGG - Intronic
1151248434 17:72814726-72814748 GAGGATCACCTGGGGCTGGGGGG + Intronic
1151655958 17:75496125-75496147 GAGGATCAGATGGGCCTGCGTGG + Intronic
1152045493 17:77932399-77932421 GAGGATCACTTGAGGCTGAGAGG - Intergenic
1152113624 17:78371429-78371451 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1152256898 17:79245160-79245182 GAGGATCACTTGAGCCTGAGAGG - Intronic
1152379060 17:79933067-79933089 GAGGCCCACAGGTGGCGGAGGGG + Exonic
1152589906 17:81206484-81206506 GAGGCTCACATGGGGCTGAGAGG - Intronic
1152705765 17:81842862-81842884 GAGCATCACATGGGGCTGGGTGG + Intergenic
1152923162 17:83075985-83076007 GGGGCCCTCATGGGGCTGGGTGG - Intergenic
1153316141 18:3724242-3724264 GAGGATCACTTGGGTCTGGGAGG + Intronic
1153342041 18:3985187-3985209 GGGGATCACATGTGGCTCAGAGG - Intronic
1153342772 18:3992586-3992608 GAGGATCACTTGAGCCTGAGAGG + Intronic
1153902723 18:9632821-9632843 GAGGATCACCTGGGCCTGGGAGG - Intergenic
1154450512 18:14472226-14472248 GAGGCTCAGATGGAGTTAAGTGG - Intergenic
1154494467 18:14945426-14945448 GAGGCCCAGGTGGGACTGAGGGG + Intergenic
1154987055 18:21562549-21562571 GAGGATCACTTGAGGCTGGGAGG + Intronic
1155046890 18:22110530-22110552 GTGGCTCACGTGGGGGTGGGGGG + Intergenic
1155049509 18:22134407-22134429 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1155133088 18:22958633-22958655 GAGGATCACTTGGGCCTGGGAGG - Intronic
1155206575 18:23563509-23563531 GAGGATCACTTGAGCCTGAGGGG - Intronic
1155401895 18:25448292-25448314 GGGGCTGACATGGGAGTGAGAGG + Intergenic
1156870411 18:41939022-41939044 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1157622304 18:49023713-49023735 AAGGCTGGAATGGGGCTGAGAGG - Intergenic
1157670061 18:49520701-49520723 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1158353012 18:56583478-56583500 GAGGATCACTTGAGCCTGAGGGG + Intergenic
1158940955 18:62405580-62405602 GAGGCTCATATAGGGCTGCATGG - Intergenic
1159249405 18:65854214-65854236 GAGGATCACTTGAGCCTGAGAGG + Intronic
1160136296 18:76274405-76274427 AAGGTTCTCATGGTGCTGAGAGG - Intergenic
1160507149 18:79433615-79433637 GAAGCTCATACGGGCCTGAGTGG - Exonic
1160753874 19:747821-747843 CAGGCTCACATTGGTCTGGGTGG - Exonic
1160797403 19:952350-952372 GAGGATCACTTGAGCCTGAGAGG + Intronic
1161245043 19:3246621-3246643 GAGGATCACTTGAGCCTGAGAGG + Intronic
1161280289 19:3442040-3442062 GAGGCTCACAGAGGCCTGGGGGG + Intronic
1161485941 19:4535785-4535807 AAGGATCACTTGGGGCTCAGGGG - Intronic
1161692865 19:5747262-5747284 GAGGATCACTTGAGCCTGAGAGG - Intronic
1161947155 19:7444598-7444620 GAGGATCACCTGAGCCTGAGAGG - Intronic
1162152389 19:8655586-8655608 GAGGCTCACGTGGGACTCACCGG + Intergenic
1162282324 19:9709102-9709124 GAGGGACACAAGGGGCTGTGGGG + Intergenic
1162363726 19:10235190-10235212 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1162502363 19:11061096-11061118 GAGGCTCACTTGAGCCTGGGAGG + Intronic
1162580273 19:11525421-11525443 GAGGATCACATGAGCCTGGGAGG + Intronic
1163140348 19:15343717-15343739 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1163169909 19:15523968-15523990 GAGGATCACATGAGGCTGGGAGG + Intronic
1163308902 19:16500465-16500487 GAGGATCACTTGAGCCTGAGAGG + Intronic
1163327498 19:16614605-16614627 CAGGCTCATGTGGGCCTGAGGGG + Intronic
1163354104 19:16798519-16798541 GAGGATCACATGAGCCTGGGAGG + Intronic
1163411075 19:17154870-17154892 GAGGATCACTTGGGCCTGGGAGG + Intronic
1163419204 19:17204742-17204764 GAGGATCACCTGGGCCTGGGAGG + Intronic
1163571830 19:18086839-18086861 GAGGCTCCCCTGGGGCTGTGGGG - Exonic
1163651582 19:18521239-18521261 GAGGGTCACCTGGGGGTAAGGGG + Intronic
1164597501 19:29539853-29539875 CAGGCTCACATGGGCGTGAGGGG - Intronic
1164906410 19:31971909-31971931 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1165046557 19:33109125-33109147 GAGGATCACTTGAGCCTGAGAGG + Intronic
1165461759 19:35948115-35948137 GAGGATCACTTGAGGCTGGGAGG - Intergenic
1165880206 19:39037255-39037277 GAGGATCACTTGAGGCTGGGAGG - Intergenic
1166040216 19:40197919-40197941 GAGGATCACTTGAGGCTGGGAGG - Intronic
1166087402 19:40486199-40486221 GAGGATCACCTGAGGCTGGGAGG + Intronic
1166327044 19:42057459-42057481 GAGGATCACTTGAGCCTGAGAGG - Intronic
1166559545 19:43723043-43723065 GAGGATCACTTGGGCCTCAGAGG + Intergenic
1166993646 19:46708405-46708427 GAGGATCACCTGGGCCTGGGAGG - Intronic
1167444803 19:49531227-49531249 GAGGATCACTTGGGCCTGGGAGG + Intronic
1167620636 19:50558318-50558340 GAGGATCACCTGGGCCTGGGAGG - Intronic
1167692316 19:50993792-50993814 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1168465147 19:56595563-56595585 GAGGCTGACTGGAGGCTGAGGGG + Intronic
1168528832 19:57110064-57110086 GAGGCTCACGTGAGCCTGGGAGG - Intergenic
1168548238 19:57271649-57271671 GAGGATCACATGAGCCTGGGAGG + Intergenic
1168628502 19:57938133-57938155 GAGGATCACTTGAGCCTGAGAGG - Intergenic
925967392 2:9078716-9078738 GAGGATCACCTGGGGTTGGGAGG + Intergenic
925970490 2:9103460-9103482 AAGCCACACATGGGGCTGAGGGG + Intergenic
926028693 2:9566786-9566808 GAGGATCACTTGAGCCTGAGAGG + Intergenic
926228815 2:10987394-10987416 TGGCCTCACTTGGGGCTGAGGGG + Intergenic
926840475 2:17074268-17074290 GATGCTCACAGGGTGCTGAGTGG - Intergenic
926898943 2:17728342-17728364 GAGGATCACTTGAGCCTGAGAGG + Intronic
927533188 2:23829663-23829685 GAGGATCACTTGAGCCTGAGAGG + Intronic
927876673 2:26661002-26661024 GAGGATCACTTGAGCCTGAGAGG - Intergenic
927921369 2:26974499-26974521 GAGAGGCAGATGGGGCTGAGAGG + Intronic
927949217 2:27156021-27156043 GAGGCTTAGATGGGGCTGTGGGG + Exonic
929472981 2:42215147-42215169 GAGGATCACTTGAGACTGAGAGG - Intronic
929525709 2:42701210-42701232 GAGGATCACCTGAGCCTGAGAGG + Intronic
931328591 2:61254933-61254955 GAGGATCACTTGAGGCTGGGAGG - Intronic
931508025 2:62953457-62953479 GAGGATCGCTTGGGCCTGAGAGG + Intronic
931527752 2:63176333-63176355 GAGGATCACTTGAGCCTGAGAGG - Intronic
931656948 2:64518103-64518125 GAGGATCACTTGGGCCTGGGAGG - Intergenic
931668547 2:64627050-64627072 GAGGCTCCCGTGGAGCTGAGGGG - Intergenic
931811285 2:65857291-65857313 GAGGATCACCTGAGCCTGAGAGG + Intergenic
933073853 2:77897417-77897439 GAGGGTCACAAGGTGCTCAGTGG - Intergenic
934498468 2:94832685-94832707 GAGGATCACTTGAGCCTGAGAGG + Intergenic
935695285 2:105766139-105766161 GAGGCGCAGGTGGGGCTGAGTGG + Intronic
936388492 2:112052646-112052668 GAGGATCACTTGGGCCTGGGAGG - Intergenic
936406235 2:112206820-112206842 GAGGATCACTTGAGCCTGAGAGG - Intergenic
936559236 2:113522455-113522477 GAGGATCACTTGGGCCTGGGAGG - Intergenic
936630865 2:114201373-114201395 GAGGGTGAAATGGGGGTGAGAGG - Intergenic
936921694 2:117695776-117695798 GAGGATCACTTGAGCCTGAGAGG - Intergenic
937002458 2:118479899-118479921 GAAGGTCACATGAGGGTGAGTGG + Intergenic
938016038 2:127867960-127867982 GAGGATCACATGAGCCTGGGAGG - Intronic
938377496 2:130818357-130818379 GAGACTCACTTGAGCCTGAGAGG - Intergenic
938423936 2:131168420-131168442 GAGGATCACTTGAGTCTGAGAGG - Intronic
938480898 2:131660511-131660533 GAGGCTCAGATGGAGTTAAGTGG + Intergenic
938841971 2:135172961-135172983 GAGGCCCACATGGTGCGGAATGG + Intronic
939274909 2:139988667-139988689 GAGGATCACTTGAGCCTGAGAGG - Intergenic
939486450 2:142818087-142818109 GAGGATCACTTGAGGCTGGGAGG + Intergenic
939938420 2:148320441-148320463 GAGGATCACCTGAGCCTGAGAGG - Intronic
940294586 2:152109497-152109519 GAGGATCACTTGAGCCTGAGAGG - Intergenic
940691022 2:156921017-156921039 GAGGATCACTTGAGCCTGAGAGG + Intergenic
940719159 2:157262546-157262568 GAGGATCACTTGAGCCTGAGCGG + Intronic
940825425 2:158406710-158406732 GAGGATCACCTGAGTCTGAGAGG - Intronic
940948438 2:159645180-159645202 GAGGATCACTTGGGCCTGGGAGG + Intergenic
941013100 2:160323384-160323406 GAGGATCACTTGGGCCTGGGAGG + Intronic
941290647 2:163669299-163669321 GAGGATCACTTGAGCCTGAGAGG - Intronic
941886877 2:170537257-170537279 GAGGATCACCTGAGCCTGAGAGG + Intronic
942554202 2:177155009-177155031 GAGGATCACTTGAGGCTGGGAGG - Intergenic
943355619 2:186851427-186851449 GAGGATCACTTGAGCCTGAGAGG + Intergenic
943581906 2:189694138-189694160 GAGGATCACTTGAGCCTGAGAGG + Intronic
943834822 2:192506271-192506293 GAGGGTCACAAGGTGCTCAGTGG - Intergenic
944100559 2:196021730-196021752 GAGGATCACTTGGGTCTGGGAGG + Intronic
944137012 2:196411086-196411108 GAGGATCACTTGAGCCTGAGAGG - Intronic
944639361 2:201707517-201707539 GAGGATCACTTGGGCCTGGGAGG - Intronic
944774686 2:202951134-202951156 GAGGATCACTTGAGGCTGGGAGG - Intronic
944806583 2:203287614-203287636 GAGGATCACTTGGGCCTGGGAGG + Intronic
945469468 2:210210854-210210876 GAGGATCACTTGGGCCTGAGAGG + Intronic
945511775 2:210712201-210712223 GAGGATCACTTGGGTCTGGGAGG - Intergenic
946352961 2:219167650-219167672 GAGGATCACCTGGGCCTGGGAGG + Intronic
946529459 2:220556122-220556144 GAGGATCACTTGAGCCTGAGAGG + Intergenic
946835372 2:223767242-223767264 GAGTACCACATGTGGCTGAGAGG - Intronic
946906091 2:224417907-224417929 GAGGATCACTTGAGCCTGAGAGG - Intergenic
947442940 2:230139349-230139371 GAGGATCACTTGAGGCTGGGAGG - Intergenic
948000819 2:234565880-234565902 GAGGCTCACTTGAGCCTGGGAGG - Intergenic
948269271 2:236661748-236661770 GAGGCCCACATGGGTGTGCGTGG - Intergenic
948902883 2:240965124-240965146 GAGGCTCAGGTGGGGCGGGGTGG - Intronic
948951499 2:241255223-241255245 GCTGCTCACCTGGGGCTCAGAGG + Intronic
1168830857 20:844633-844655 GAGGCTCAGCCGCGGCTGAGAGG - Intronic
1168977094 20:1974894-1974916 GAGTCTCACCTGGGGATGTGAGG - Intergenic
1169324023 20:4660771-4660793 GAGGGTCACCTGAGCCTGAGAGG + Intergenic
1170236846 20:14116037-14116059 GAGTATCAGATGGGGCTGATTGG + Intronic
1170816229 20:19716782-19716804 GAGGATCACTTGTGGCTGGGAGG + Intronic
1171116039 20:22525627-22525649 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1171446837 20:25210553-25210575 GAGGATCACTTGGGCCTGGGAGG + Intronic
1171889734 20:30699412-30699434 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1172250232 20:33474326-33474348 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1172625766 20:36345845-36345867 GAGGATCACTTGAGCCTGAGAGG - Intronic
1172704808 20:36875392-36875414 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1172729219 20:37071564-37071586 GAGGATCACTTGAGCCTGAGGGG + Intronic
1173450227 20:43157272-43157294 GAGGATCACTTGAGCCTGAGAGG + Intronic
1173569307 20:44066434-44066456 GAGGTTCACATGGCCCTTAGAGG + Intronic
1173686687 20:44928772-44928794 GAGGATCACTTGAGGCTGAGAGG + Intronic
1173886720 20:46465633-46465655 GAGGATCACGTGAGTCTGAGTGG + Intergenic
1174221587 20:48959697-48959719 GAGGATCACTTGAGCCTGAGAGG - Intronic
1174279162 20:49426081-49426103 GAGGATCACTTGAGGCTGGGAGG + Intronic
1174469468 20:50745587-50745609 GAGGATCACTTGAGCCTGAGAGG - Intronic
1174641350 20:52047216-52047238 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1174685588 20:52451999-52452021 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1175119989 20:56710031-56710053 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1175864621 20:62168592-62168614 GAGGATCACGTGAGCCTGAGAGG + Intronic
1175902276 20:62364694-62364716 GATGCCCACCTGGGGCTGTGAGG + Intronic
1176008185 20:62877431-62877453 GACCCTCTCCTGGGGCTGAGTGG - Intergenic
1176053409 20:63132682-63132704 GAGGCTCAGAGAGGGTTGAGTGG + Intergenic
1176185683 20:63777375-63777397 GAGGATCACTTGAGCCTGAGAGG + Intronic
1176211163 20:63922678-63922700 GAGGATCACTTGAGTCTGAGAGG + Intronic
1176260645 20:64177784-64177806 GCGGGTCCCATGGGGCTGAGGGG - Intronic
1176445679 21:6818157-6818179 GAGGCTCAGATGGAGTTAAGTGG + Intergenic
1176823846 21:13683190-13683212 GAGGCTCAGATGGAGTTAAGTGG + Intergenic
1176854520 21:13954744-13954766 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1177382231 21:20359685-20359707 AAGGATCACTTGAGGCTGAGAGG + Intergenic
1177617923 21:23549043-23549065 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1177828800 21:26113655-26113677 GGGGCTCAGATGGAGTTGAGGGG - Intronic
1178357364 21:31920122-31920144 GAGGCAGACATTGGGGTGAGGGG - Intronic
1178389854 21:32189366-32189388 GAGGATCACCTGAGGCTGGGAGG - Intergenic
1178973935 21:37205952-37205974 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1179059234 21:37964524-37964546 GATGCTCACATGTGGTTTAGGGG + Intronic
1179724667 21:43335451-43335473 GAGGCCCAAGAGGGGCTGAGGGG + Intergenic
1179796987 21:43790675-43790697 GAGGCTCACTTGAGCCTGGGAGG - Intronic
1179959403 21:44759620-44759642 GTGGCTCACAGGGGGCTGGCAGG - Intergenic
1180036802 21:45254244-45254266 GAGGCTAACAAAGGGCTGTGTGG - Intergenic
1180359340 22:11873226-11873248 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1180482066 22:15763118-15763140 GAGGCTCAGATGGAGTTAAGTGG + Intergenic
1182219281 22:28744991-28745013 GAGGATCACTTGAGCCTGAGAGG + Intronic
1182228902 22:28821460-28821482 GAGGATCATATGAGCCTGAGAGG - Intergenic
1182341111 22:29621575-29621597 GAGGATCACATGAGCCTGGGAGG + Intronic
1182438873 22:30349744-30349766 GAGGATCACTTGAGCCTGAGAGG - Intronic
1182486849 22:30644351-30644373 GAGGCTCACAGAGGCCTGGGAGG + Intronic
1182489637 22:30662737-30662759 GAGGATCACTTGAGCCTGAGAGG + Exonic
1182563699 22:31182199-31182221 GAGGATCACTTGGGCCTGGGAGG - Intronic
1183243420 22:36675124-36675146 GAGGATCACCTGAGCCTGAGAGG - Intronic
1183517514 22:38275549-38275571 GAGGATCACTTGAGCCTGAGTGG - Intergenic
1183902169 22:41014552-41014574 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1184121646 22:42454462-42454484 GAGGATGACCTGGGCCTGAGAGG + Intergenic
1184462939 22:44649584-44649606 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1184518334 22:44977028-44977050 GAGGCTGACCTGGGCCCGAGAGG + Intronic
1184896917 22:47414239-47414261 GAGGCTCACCTGGGCCTGGGTGG + Intergenic
1185312421 22:50163430-50163452 GAGGATCACCTGAGGCTGGGAGG - Intergenic
1185414131 22:50700540-50700562 GGGGGTCACATGGCCCTGAGGGG + Intergenic
949370307 3:3327651-3327673 AAGGATCACTTGGGCCTGAGAGG - Intergenic
949869711 3:8577899-8577921 GAGGATCACTTGAGCCTGAGAGG + Intergenic
950315398 3:11997526-11997548 GAGGATCACTTGAGCCTGAGAGG - Intergenic
950407585 3:12814302-12814324 GAGGCACACAGGAGGCTCAGAGG - Intronic
950735972 3:15008430-15008452 GAGGATCACTTGAGGCTGAGAGG + Intronic
950883471 3:16342927-16342949 GAGGCTCACTTGAGCCTGGGAGG - Intronic
950994872 3:17484583-17484605 GAGGCTCACTTGAGCCTGAGTGG - Intronic
951817000 3:26765194-26765216 GAGGCTCACATGGTGTTGCTTGG - Intergenic
951855362 3:27190599-27190621 GTGGCTGATTTGGGGCTGAGTGG - Intronic
952318979 3:32258597-32258619 GAGGCTCACTTGAGCCTGGGAGG - Intronic
952743968 3:36760950-36760972 CAGGATCACATGGGTTTGAGGGG + Intergenic
952886136 3:38012115-38012137 GAGGATCACTTGAGCCTGAGAGG - Intronic
952969157 3:38639975-38639997 CAGGCTCAGATGAGGCTGACAGG - Intronic
953055818 3:39386482-39386504 GAGGATCACCTGAGCCTGAGAGG + Intronic
953090149 3:39716458-39716480 GAGGATCACTTGGGCCTGGGAGG + Intergenic
953599718 3:44350224-44350246 GAGGGTCACAAGGTGCTCAGTGG + Intronic
953740672 3:45536209-45536231 GAGGATCACCTGAGCCTGAGAGG - Intronic
953863022 3:46561461-46561483 GAGGATCACTTGGGCCTGGGAGG + Intronic
954103621 3:48397327-48397349 GAGGATCACATGAGCCTGGGAGG - Intronic
954167251 3:48769865-48769887 GAGGATCACCTGGGCCTAAGAGG - Intronic
954337066 3:49925202-49925224 GAGGATCACTTGGGCCTGGGAGG - Intronic
954364919 3:50140594-50140616 GAGGGTGCCCTGGGGCTGAGAGG - Intergenic
954742747 3:52767351-52767373 GAGGATTTCATGGGTCTGAGAGG - Intronic
955089645 3:55736999-55737021 GAGGCTTCCTTGGGGCTGTGGGG - Intronic
955270656 3:57494917-57494939 GAGGATCACTTGAGCCTGAGAGG + Intronic
955323361 3:57990961-57990983 GAGGCTCACTTGAGCCTGGGAGG - Intergenic
955811203 3:62792291-62792313 GAGGATCACTTGAGCCTGAGAGG - Intronic
955950763 3:64240031-64240053 GAGGATCACTTGAGGCTGGGAGG + Intronic
956136556 3:66105006-66105028 GAGGATCACTTGGGCCTGGGTGG - Intergenic
956142221 3:66157142-66157164 GAGGATCACTTGGGCCTGGGAGG + Intronic
956172623 3:66444532-66444554 GGGGCTCATATGGGGCTGGGGGG - Intronic
957182377 3:76896126-76896148 GAGGCTCATATGTGGGTGAAAGG - Intronic
957822438 3:85395206-85395228 GAGGATCACATGAGCCTGGGAGG + Intronic
959537639 3:107504732-107504754 AAGAATCACATGGGGCAGAGAGG + Intergenic
959707546 3:109352384-109352406 GAGGATCACTTGGGCCTGGGAGG - Intergenic
960122723 3:113963644-113963666 GAGGATCACCTGAGTCTGAGAGG + Intronic
960856894 3:122111073-122111095 GATGGTCAGATTGGGCTGAGTGG + Intronic
960933173 3:122875438-122875460 GAGGATCACTTGAGGCTGGGAGG - Intronic
961689056 3:128655093-128655115 GAGGATCACTTGGGCCTGGGAGG + Intronic
962138059 3:132758402-132758424 GAGGATCACATGGGCCAGGGAGG + Intergenic
962834617 3:139177234-139177256 GAGGATCACTTGAGCCTGAGAGG - Intronic
963232471 3:142922337-142922359 GAGGATCACTTGAGCCTGAGGGG - Intergenic
963478451 3:145836638-145836660 GAGGATCACATGAGCCTGGGAGG - Intergenic
963743296 3:149100820-149100842 GAGGATCACATGAGCCTGGGAGG - Intergenic
963758111 3:149257176-149257198 GAGGATCACTTGAGCCTGAGAGG + Intergenic
964350676 3:155800518-155800540 GAGGATCACTTGAGGCTAAGAGG + Intronic
964558397 3:157965945-157965967 GAGGCTGGCATGGGGTGGAGTGG - Intergenic
964797482 3:160515702-160515724 GAGGATCACTTGAGCCTGAGAGG - Intronic
964965421 3:162486583-162486605 GGGGCTGACATGGGGCTGTCAGG - Intergenic
965171166 3:165265960-165265982 GAGGATCACTTGAGCCTGAGAGG - Intergenic
965377750 3:167947022-167947044 GAGGATCGCATGAGGCTGGGAGG + Intergenic
966716746 3:183020539-183020561 GAGGCTCACTTGAGCCTGGGAGG + Intronic
966943393 3:184760700-184760722 GAGGCCACCTTGGGGCTGAGGGG + Intergenic
967413114 3:189187074-189187096 GAGGATCACTTGGGCCTGAGAGG - Intronic
968113594 3:196070850-196070872 GAGGCTCACTTGAGCCTGGGTGG + Intronic
968158692 3:196406120-196406142 GAGGATCACATGAGCCTGGGAGG - Intronic
969277452 4:6146380-6146402 GAGGATCACATGAGCCCGAGAGG - Intronic
969394884 4:6914048-6914070 GAGGCTCACTTGAGCCTGGGAGG + Intronic
969602207 4:8183041-8183063 GAGGCTGCCCTGGGGGTGAGGGG + Intronic
970725153 4:19034999-19035021 ATCGCACACATGGGGCTGAGAGG + Intergenic
971183410 4:24351305-24351327 GAGGATCACTTGAGCCTGAGAGG + Intergenic
971274909 4:25186739-25186761 GAGGATCACTTGGGCCTGGGAGG - Intronic
972542502 4:40051792-40051814 GAGGATCACCTGGGTCTGGGAGG - Intergenic
973300416 4:48576392-48576414 GAGGATCACTTGAGCCTGAGAGG - Intronic
973906572 4:55537702-55537724 GAGGATCACTTGAGCCTGAGAGG + Intronic
974083371 4:57235039-57235061 GAGGGTCACTTGAGCCTGAGAGG - Intergenic
975180661 4:71340132-71340154 GAGGCTCACTTGAGCCTGTGAGG + Intronic
975700369 4:77060545-77060567 GAGGATCACTTGGGGCTGGGAGG - Intronic
976161680 4:82207733-82207755 CAGGGTAACATGGGGGTGAGGGG + Intergenic
976611680 4:87036919-87036941 GAGGATCACTTGAGCCTGAGAGG - Intronic
976613389 4:87052321-87052343 GAGGATCACTTGAGCCTGAGAGG + Intronic
976740231 4:88348976-88348998 GAGGCTCACAAGGTGCTCAGTGG + Intergenic
976774469 4:88692337-88692359 GACACACACATGGGGCTGGGGGG + Intronic
976816603 4:89155438-89155460 GAGGATCACCTGAGCCTGAGAGG - Intergenic
977053058 4:92154242-92154264 GAGGATCACTTGGGCCTGGGAGG - Intergenic
977224068 4:94373767-94373789 GAGGATCACTTGAGCCTGAGAGG + Intergenic
977526551 4:98152903-98152925 GAGAGCCACAAGGGGCTGAGAGG + Intergenic
977663338 4:99616289-99616311 GAGGCTGAGGTGGGGGTGAGAGG + Intronic
978318308 4:107464774-107464796 GAGGATCACCTGAGCCTGAGAGG + Intergenic
978987954 4:115038888-115038910 GAGGCTCACTTGAGCCTGGGAGG + Intronic
979280328 4:118860331-118860353 GAGGCTCACTGGAGCCTGAGAGG - Intronic
979325738 4:119377541-119377563 GAGGATCACTTGAGCCTGAGAGG - Intergenic
979561440 4:122106339-122106361 GAGGCTCACTTGAGCCTGCGAGG + Intergenic
979689958 4:123549345-123549367 GAGGCTCACATGGGTGGAAGTGG - Intergenic
979731569 4:124029462-124029484 GAGGATCACTTGAGCCTGAGAGG - Intergenic
980708453 4:136531635-136531657 GAGTATCACTTGGGCCTGAGAGG - Intergenic
981195128 4:141910441-141910463 GAGGATCACTTGAGCCTGAGAGG + Intergenic
981830688 4:148997223-148997245 GAGGATCACTTGAGGCTGGGAGG + Intergenic
981993860 4:150955179-150955201 GAGGATCACCTGAGCCTGAGAGG + Intronic
982014071 4:151135515-151135537 GAGGATCACTTGAGGCTGGGAGG - Intronic
982203172 4:152977530-152977552 GAGGATCACTTGGGTCTGGGAGG - Exonic
982291182 4:153784408-153784430 GAGCCACAAATGGGGCTGACGGG - Intronic
982911834 4:161151632-161151654 GAGGATCACTTGAGCCTGAGAGG + Intergenic
983067578 4:163228967-163228989 GAGGATCACCTGAGCCTGAGAGG - Intergenic
983231929 4:165137716-165137738 GAGGATCACTTGAGCCTGAGAGG - Intronic
983243651 4:165262666-165262688 GAGGATCACTTGAGCCTGAGAGG - Intronic
983718304 4:170814438-170814460 GAGGCTAAGATGGGTCTGTGGGG - Intergenic
983961123 4:173756413-173756435 GAGGATCACTTGAGCCTGAGAGG - Intergenic
984399457 4:179243559-179243581 GAGGATCACCTGAGGCTGGGTGG - Intergenic
984559862 4:181255482-181255504 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1202769999 4_GL000008v2_random:195129-195151 GAGGATCACTTGAGCCTGAGAGG + Intergenic
985677596 5:1240256-1240278 TAGGCCCACAGGGAGCTGAGAGG - Intronic
986015784 5:3755571-3755593 GAGGCTCACCTGAGCCTGGGAGG - Intergenic
986018071 5:3775237-3775259 GAGGCTCACACAGGAGTGAGGGG + Intergenic
986832616 5:11597661-11597683 GAGGATCACCTGAGTCTGAGAGG - Intronic
986913152 5:12582864-12582886 GAGGATCACTTGGGCCTGGGAGG + Intergenic
987688248 5:21232859-21232881 GAGGATCACCTGAGCCTGAGAGG + Intergenic
988367828 5:30324296-30324318 GAGGATCACTTGAGCCTGAGAGG - Intergenic
988511084 5:31865400-31865422 CAGGATCACTTGGGCCTGAGAGG - Intronic
988529067 5:32011407-32011429 GAGGATCACTTGAGCCTGAGAGG + Intronic
988574270 5:32404904-32404926 GAGGATCACATGAGCCTGGGAGG - Intronic
988645933 5:33095109-33095131 GAGGATCACTTGAGCCTGAGAGG - Intergenic
988788696 5:34587505-34587527 GAGTCTCACAGAGGGTTGAGGGG - Intergenic
988828425 5:34964334-34964356 GAGGATCACTTGGGCCTGAGAGG - Intergenic
989026833 5:37077701-37077723 GAGGATCACTTGAGCCTGAGAGG - Intergenic
989149299 5:38282932-38282954 GAGGATCACTTGAGTCTGAGAGG - Intronic
990422950 5:55654925-55654947 GAGGATCACTTGAGCCTGAGGGG - Intronic
992153273 5:73927285-73927307 GAGGATCACATGAGCCTGGGAGG + Intronic
992856408 5:80866226-80866248 GAGGATCACCTGGGCCTGGGAGG - Intronic
993527036 5:88977627-88977649 GAGGATCACATGAGCCTGGGAGG + Intergenic
995355963 5:111238082-111238104 GAGGCAGACACAGGGCTGAGGGG + Intronic
995500585 5:112801304-112801326 CCGGCTCACATGATGCTGAGCGG + Exonic
995507040 5:112871396-112871418 GAGGATCACTTGAGGCTGGGAGG - Intronic
995679151 5:114697680-114697702 GAGGATCACTTGGGCCTGGGAGG - Intergenic
995749077 5:115435014-115435036 GAGGATCACTTGGGCCTGGGAGG + Intergenic
996297091 5:121932166-121932188 GAGGCTCACCTGAGCCTGGGAGG + Intergenic
997122546 5:131190042-131190064 GAGGATCACTTGAGCCTGAGAGG + Intronic
997333428 5:133084895-133084917 GAGGATCACCTGGGCCTGGGAGG - Intronic
997525888 5:134553081-134553103 GAGGATCACTTGAGGCTGGGAGG - Intronic
997542814 5:134678517-134678539 GAGGATCACTTGAGGCTGGGAGG - Intronic
998191279 5:140027068-140027090 GAGGCTCACTTGAGTCTGGGAGG - Intronic
998233270 5:140375404-140375426 GAGGATCACTTGAGTCTGAGAGG + Intergenic
998255756 5:140586139-140586161 GAGGGTCACTTGAGCCTGAGAGG + Intronic
998948586 5:147367592-147367614 GAGGATCACAAGGTGCTCAGCGG + Intronic
999121501 5:149213021-149213043 GAGGATCACTTGAGCCTGAGAGG + Intronic
1000010307 5:157225082-157225104 GAGGATCACTTGAGCCTGAGAGG - Intronic
1000033466 5:157423321-157423343 GAGGATCACCTGGGCCTGGGAGG - Intronic
1000065226 5:157688421-157688443 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1001083083 5:168681057-168681079 GAGGATCACTTGAGGCTGGGAGG + Intronic
1001470634 5:172009760-172009782 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1001473128 5:172029661-172029683 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1001815252 5:174663378-174663400 GAGGATCACTTAAGGCTGAGAGG - Intergenic
1003931526 6:10928626-10928648 GAGGATCACATGAGCCTGGGAGG - Intronic
1004212662 6:13666671-13666693 GAGGATCACTTGAGCCTGAGAGG + Intronic
1004261171 6:14109084-14109106 AAGGCACACTTGGGGCAGAGGGG + Intergenic
1004311776 6:14552288-14552310 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1004315368 6:14582183-14582205 GACACTCACTTGGTGCTGAGGGG - Intergenic
1004731294 6:18361772-18361794 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1005290143 6:24371516-24371538 GAGGCTCACTTGAGACTGGGAGG + Intergenic
1005414905 6:25589575-25589597 GAGGATCACTTGGGCCTGGGAGG - Intronic
1005621894 6:27628143-27628165 GAGGATCACATGAGCCTGGGAGG - Intergenic
1006026343 6:31149530-31149552 GAGGATCACCTGAGGCTGGGAGG - Intronic
1006226820 6:32545590-32545612 GAGGATCACACGAGCCTGAGAGG + Intergenic
1006350228 6:33515465-33515487 GAGGATCACATGAGTCTGGGAGG + Intergenic
1006491996 6:34395542-34395564 GAGGATCACTTGAGCCTGAGAGG + Intronic
1006494355 6:34410954-34410976 GAGGATCACTTGGGCCTGGGAGG + Intronic
1006648307 6:35530750-35530772 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1006660246 6:35635380-35635402 GAGGATCACTTGAGCCTGAGAGG + Intronic
1006761945 6:36470688-36470710 GAGGCTCACTTGAGCCTGGGAGG - Intronic
1007348565 6:41251600-41251622 GAGGCTGACATGAGACTTAGGGG + Intergenic
1007578580 6:42941573-42941595 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1007595178 6:43046723-43046745 CAGGCCCAGATGGGGCAGAGGGG + Intronic
1007689658 6:43691935-43691957 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1008457752 6:51731008-51731030 GAGGATCACCTGAGCCTGAGAGG - Intronic
1008619220 6:53255417-53255439 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1008834485 6:55808717-55808739 GAGGGCCTCATGGGGCAGAGGGG - Intronic
1008895188 6:56545100-56545122 GAGGATCACATGAGCCCGAGAGG - Intronic
1008965241 6:57308210-57308232 GAGGATCACCTGAGGCTGGGAGG - Intergenic
1011105716 6:83778109-83778131 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1011472233 6:87719287-87719309 CAGGCTGACAGGGAGCTGAGTGG + Intergenic
1011566142 6:88674447-88674469 GAGGATCACCTGAGCCTGAGAGG + Intronic
1011638328 6:89396513-89396535 GAGGATCACTTGAGCCTGAGAGG - Intronic
1012263610 6:97115103-97115125 GAGGATCACTTGAGCCTGAGAGG - Intronic
1012803940 6:103870795-103870817 GAGGCTCACATGGGGTTGGGTGG - Intergenic
1012903286 6:105032630-105032652 GAGGATCACTTGAGCCTGAGAGG + Intronic
1012995995 6:105975468-105975490 GAGTGTCACAATGGGCTGAGAGG + Intergenic
1013082323 6:106823516-106823538 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1013256769 6:108395489-108395511 GAGGCTCACCTGAACCTGAGAGG - Intronic
1013511870 6:110852140-110852162 GAGGATCACCTGAGGCTGGGAGG - Intronic
1014228261 6:118873080-118873102 GAGGACCACTTGGGCCTGAGAGG + Intronic
1014401525 6:120996275-120996297 GAGGATCACCTGGGCCTGGGAGG + Intergenic
1014444484 6:121511647-121511669 GAGGATCGCTTGAGGCTGAGAGG - Intergenic
1015544330 6:134346411-134346433 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1015910754 6:138165501-138165523 GAGACCCACATGGGGGAGAGGGG + Intronic
1016165241 6:140934406-140934428 GAGGATCACTTGAGGCTGGGAGG - Intergenic
1016348772 6:143145112-143145134 GAGGATCACTTGAGCCTGAGAGG - Intronic
1016447541 6:144149564-144149586 GAGGATCACTTGAGGCTGAGAGG - Intergenic
1016764870 6:147781243-147781265 GAGGATCACTTGAGTCTGAGAGG - Intergenic
1016819165 6:148331779-148331801 GAGGATCACCTGAGCCTGAGAGG - Intronic
1016895810 6:149051364-149051386 GAGGCGCCCATGGGGTTCAGAGG - Intronic
1017013236 6:150079190-150079212 GAGGATCACCTGGGCCTGGGAGG + Intergenic
1017668880 6:156750690-156750712 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1018838963 6:167505615-167505637 GAGGAGCTCATGGGGCTGACAGG - Intergenic
1019123713 6:169825333-169825355 GAGGCTCCCGGGGGGCTGAAAGG + Intergenic
1019193537 6:170267918-170267940 GAGCTGCACATGGGGCTGGGGGG - Intergenic
1019205645 6:170359503-170359525 GAGGCTCACTTGGGCCTATGGGG - Intronic
1019279085 7:191405-191427 GAGGCTCAGAGAGGGCGGAGAGG + Intergenic
1019983070 7:4635783-4635805 GAGGATCCCCTGGGCCTGAGAGG - Intergenic
1020143508 7:5625127-5625149 GAGGCTCACAAGCAGCAGAGTGG + Intronic
1020359835 7:7316143-7316165 GAGGCTGACATGGGGATGCCAGG + Intergenic
1022053353 7:26702242-26702264 GAGGATCACATGAGCCTGGGAGG - Intronic
1022467223 7:30660174-30660196 GAGGGTCACTGGGGGCTGAGGGG + Intronic
1022706853 7:32809823-32809845 GAGGATCACATGAGCCTGGGAGG + Intergenic
1022924054 7:35042632-35042654 GAGGATGTCAAGGGGCTGAGAGG - Intergenic
1023190514 7:37575751-37575773 GAGGATCACCTGAGCCTGAGGGG + Intergenic
1023702501 7:42906387-42906409 GAGGCTCACCTGAGCCTGGGAGG - Intergenic
1023790099 7:43747167-43747189 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1024082063 7:45864139-45864161 GAGGCTCTCAGAGGGCTGTGTGG + Intergenic
1025111615 7:56221689-56221711 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1025830300 7:65043162-65043184 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1025917459 7:65876954-65876976 GAGGATCACTTGAGCCTGAGAGG + Intronic
1026206585 7:68262916-68262938 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1026679889 7:72457843-72457865 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1026774330 7:73221713-73221735 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1026787666 7:73312079-73312101 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1027015187 7:74775099-74775121 GAGGATCACTTGGGCCTGGGAGG - Intronic
1027047556 7:75001164-75001186 GAGGATCACTTGGGCCTGGGAGG - Intronic
1027072844 7:75170854-75170876 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1028241580 7:88427363-88427385 GAGTTTCAAAAGGGGCTGAGGGG + Intergenic
1028542513 7:91958972-91958994 GAGGGTCACTTGAGCCTGAGAGG - Intronic
1028609454 7:92693340-92693362 CAGGATCACATAGGGCTGGGAGG - Intronic
1028710454 7:93901843-93901865 GAGGATCACTAGGGCCTGAGAGG + Intronic
1029100047 7:98121913-98121935 GAGGATCACTTGAGCCTGAGAGG + Intronic
1029244572 7:99189709-99189731 GAGGATCACTTGGGCCTGGGAGG - Intronic
1029385436 7:100240475-100240497 GAGGATCACTTGGGCCTGGGAGG + Intronic
1029406988 7:100381354-100381376 GAGGATCACTTGGGGCTGGGAGG + Intronic
1029583609 7:101455130-101455152 GAGGATCACTTGGGCCTGGGAGG - Intronic
1029606700 7:101603223-101603245 GAAGCTCCCACGGGGCTGGGAGG + Intergenic
1030713259 7:112778976-112778998 TAGGATCACATGAGCCTGAGAGG - Intronic
1031472954 7:122189680-122189702 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1032285212 7:130534491-130534513 GAGGCTCCAATGGGGGTGGGGGG + Intronic
1032355939 7:131210611-131210633 GAGGATCACCTGAGCCTGAGAGG + Intronic
1032517659 7:132518963-132518985 GAGTTTCACATGGGGCTGCCTGG - Intronic
1033116053 7:138626480-138626502 GAGGATCACTTGAGCCTGAGAGG - Intronic
1033231683 7:139603216-139603238 GAGGCTGTCAGGGGGTTGAGGGG + Intronic
1033263745 7:139866666-139866688 GAGGATCACTTGAGCCTGAGAGG + Intronic
1033278398 7:139989379-139989401 GAGGCTCAGAGAGGGCTGAAGGG + Intronic
1035259354 7:157651921-157651943 GAGGCTCACCTGCGGGTGAATGG - Intronic
1036140129 8:6200016-6200038 GAGGCTCACTTGAGCCTGGGAGG - Intergenic
1036552148 8:9825316-9825338 GAGGCTCACCTGAGTCTGGGAGG + Intergenic
1036805814 8:11832458-11832480 GTGGATCACATGAGCCTGAGAGG + Intronic
1037009684 8:13824925-13824947 AGAGCTCACATAGGGCTGAGAGG + Intergenic
1037288624 8:17327358-17327380 GAGGATCACTTGGGCCTGGGAGG - Intronic
1037983311 8:23270656-23270678 GAGGATCACTTGGGCCTGGGAGG + Intronic
1038168529 8:25107717-25107739 GAGATTCTCATTGGGCTGAGGGG - Intergenic
1038504218 8:28070683-28070705 GAGGATCACATGAGCCTGGGAGG - Intronic
1038600067 8:28931629-28931651 GAGGATCACTTGGGCCTGGGAGG - Intronic
1038799610 8:30737756-30737778 GAGGATCACGTGGGCCTGGGAGG + Intronic
1038802508 8:30762151-30762173 GAGGATCACTTGAGCCTGAGAGG - Intronic
1038816261 8:30907999-30908021 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1038841171 8:31186145-31186167 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1038922651 8:32102225-32102247 GAGGATCACCTGAGCCTGAGAGG - Intronic
1039262128 8:35783051-35783073 GAGGATCACTTGAGCCTGAGAGG + Intronic
1039451516 8:37678390-37678412 GAGGATCAATTGGGCCTGAGAGG + Intergenic
1039486110 8:37911335-37911357 GAGGCTCACTTGAGCCTGGGAGG - Intergenic
1041048033 8:53906013-53906035 GAGGCATGCATGGGGCTGAGAGG + Intronic
1042118856 8:65461947-65461969 GAGGATCACATGAGCCTGGGAGG + Intergenic
1042399555 8:68330560-68330582 GAGGCTCAGAAGGGGCGGTGGGG + Intronic
1042606273 8:70549968-70549990 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1042913789 8:73854057-73854079 GAGGATCACTTGAGCCTGAGAGG + Intronic
1043358368 8:79440504-79440526 GAAGGCAACATGGGGCTGAGAGG - Intergenic
1043440138 8:80269666-80269688 GAGGCTCACTTGAGCCTGGGAGG + Intergenic
1043660929 8:82739485-82739507 AAGGATCACATGGGCCTGGGAGG + Intergenic
1043817332 8:84817642-84817664 GAGGATCACTTGGGCCTGGGAGG - Intronic
1044235331 8:89823832-89823854 GAGGGTCACACTGAGCTGAGAGG - Intergenic
1044475299 8:92618828-92618850 GAGCCTCACAGGCGCCTGAGCGG + Intergenic
1044641329 8:94385011-94385033 GAGGATCACTTGGGCCTGGGAGG + Intronic
1044851170 8:96430153-96430175 GAGGATCACTTGAGTCTGAGAGG - Intergenic
1044871893 8:96627941-96627963 GAGGATCACCTGGGCCTGGGAGG - Intergenic
1044972339 8:97632213-97632235 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1045028179 8:98109683-98109705 GAGGATCACTTGGGCCTGGGAGG - Intronic
1045063507 8:98427109-98427131 AAGGCTCACAGGTGGCTGCGTGG - Exonic
1045473541 8:102534582-102534604 GAGGATCACTTGAGGCTGGGAGG + Intronic
1045533322 8:103004370-103004392 GGGGCTCACAAGGTGCTCAGTGG - Intergenic
1045747908 8:105445692-105445714 GAGGATCACTTGAGGCTGGGAGG - Intronic
1045989985 8:108295703-108295725 GAGGATCACATGGGCCTGGGAGG - Intronic
1047920788 8:129632363-129632385 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1048015985 8:130498434-130498456 GAGGTTCACTTGAGCCTGAGAGG - Intergenic
1048199547 8:132360405-132360427 GAGGCTCACATTCTGGTGAGAGG - Intronic
1048475211 8:134736683-134736705 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1048614453 8:136058773-136058795 GGGGCCCATATGGGGCTGAGTGG - Intergenic
1048742185 8:137573269-137573291 GAGGCTGACATGGGTCTCACTGG - Intergenic
1049099366 8:140568192-140568214 GAGGCTCACTTGAGCCTGGGAGG + Intronic
1049144832 8:140991904-140991926 GAGGATCACCTGAGGCTGGGAGG + Intronic
1049521509 8:143093828-143093850 GAGGATCACTTGAGTCTGAGAGG - Intergenic
1049723503 8:144133298-144133320 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1049782751 8:144436279-144436301 GACCCTGACATGGGCCTGAGAGG + Exonic
1049893619 9:93742-93764 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1049942136 9:557091-557113 GAGGATCACATGAGCCTGAGAGG + Intronic
1050005486 9:1125169-1125191 GAGGATCTCTTGGGCCTGAGAGG + Intergenic
1050166453 9:2769759-2769781 GAGGATCACTTGGGCCTGGGAGG - Intronic
1051249857 9:15148559-15148581 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1051620205 9:19043080-19043102 GAGGATCACTTGAGCCTGAGAGG + Intronic
1052929993 9:34048545-34048567 GAGGCACCCCTGGGGCTGGGTGG + Intronic
1052947151 9:34177773-34177795 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1053026809 9:34736394-34736416 GAGGGTCTCTTGAGGCTGAGAGG - Intergenic
1053149598 9:35734681-35734703 GAGGATCACTTGAGCCTGAGAGG - Intronic
1053443443 9:38134214-38134236 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1053500048 9:38580308-38580330 GAGGATCACATGGGCCCAAGAGG + Intergenic
1053658685 9:40247848-40247870 GAGGATCACTTGAGCCTGAGAGG - Intronic
1053734837 9:41093811-41093833 GAGGATCACTTGGGCCTGGGAGG + Intergenic
1053909061 9:42877117-42877139 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1054359352 9:64098803-64098825 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1054370804 9:64394122-64394144 GAGGATCACTTGAGCCTGAGAGG - Intronic
1054525913 9:66128374-66128396 GAGGATCACTTGAGCCTGAGAGG + Intronic
1054678437 9:67883870-67883892 GAGGATCACTTGAGCCTGAGAGG - Intronic
1054693544 9:68337587-68337609 GAGGATCACTTGGGCCTGGGAGG - Intronic
1054776038 9:69124262-69124284 GAGGATCACTTGAGCCTGAGAGG - Intronic
1055022758 9:71687774-71687796 GAGGGTCACTTGAGCCTGAGAGG + Intronic
1055079844 9:72258221-72258243 GAGGATCACTTGGGCCTGAGAGG + Intergenic
1055526590 9:77139794-77139816 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1055647788 9:78377214-78377236 GAGGATCACTTGGGCCTGAGAGG + Intergenic
1056423583 9:86454111-86454133 GAGGATCACATGAGCCTGGGAGG - Intergenic
1057634056 9:96746699-96746721 GAGGATCGCATGGGCCTGGGAGG + Intergenic
1057664088 9:97030232-97030254 GAACCACACATAGGGCTGAGTGG + Exonic
1057733945 9:97635498-97635520 GAGGATCACTTGAGCCTGAGAGG - Intronic
1058048023 9:100378231-100378253 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1058403749 9:104646937-104646959 GAGGGTCACTTGAGGCTGGGAGG + Intergenic
1059016666 9:110524799-110524821 GAGGGTCACTTGAGCCTGAGAGG - Intronic
1059191086 9:112327112-112327134 GAGGATCACTTGGGCCTTAGAGG + Intronic
1059644079 9:116246929-116246951 GAGGATCACTTGAGGCTGGGAGG + Intronic
1060171593 9:121466003-121466025 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1060266463 9:122114286-122114308 GAGGATCACATGAGCCTGGGAGG + Intergenic
1060988494 9:127835086-127835108 GAGGATCACTTGAGCCTGAGGGG - Intronic
1061051181 9:128196456-128196478 GAGGATCACTTGGGCCAGAGAGG + Intronic
1061096012 9:128456992-128457014 GGGGCCCACTTGGGGCCGAGCGG + Intronic
1061312652 9:129774233-129774255 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1061328979 9:129880459-129880481 GTGGGGCACATGGGGCTGTGGGG - Exonic
1061369569 9:130190883-130190905 GAGGATCCCAAGGGGCTGAGAGG + Intronic
1061392297 9:130324184-130324206 GTGGCTCCCAGGGGGCTGAGGGG - Intronic
1061889965 9:133613783-133613805 GAGGAGGAGATGGGGCTGAGAGG + Intergenic
1062559509 9:137134555-137134577 GAGGCTCACCTGAGCCTGGGGGG + Intergenic
1203523516 Un_GL000213v1:66368-66390 GAGGCTCAGATGGAGTTAAGTGG - Intergenic
1203694894 Un_GL000214v1:88806-88828 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1203704651 Un_KI270742v1:28628-28650 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1203559350 Un_KI270744v1:37185-37207 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1203641379 Un_KI270751v1:15257-15279 GAGGATCACTTGAGCCTGAGAGG - Intergenic
1186829396 X:13375777-13375799 GAGGATCACTTGGGCCTGGGAGG - Intergenic
1186915649 X:14217022-14217044 GAGGATCACTTGAGGCTGGGAGG + Intergenic
1187194805 X:17072750-17072772 GAGGCTGCCTTGGGGCTGGGTGG - Intronic
1187381189 X:18803544-18803566 GAGGATCACTTGAGCCTGAGAGG - Intronic
1187539371 X:20176679-20176701 GAGGATCACTTGAGCCTGAGAGG - Intronic
1187921430 X:24206424-24206446 GAGGATCACATGAGCCTGGGAGG - Intronic
1189061319 X:37756188-37756210 TAAGCTAAAATGGGGCTGAGAGG - Intronic
1189503184 X:41583829-41583851 GAGGATCACATGAGCCTGGGAGG - Intronic
1189507667 X:41628391-41628413 GAGGATCACTTGAGCCTGAGAGG - Intronic
1189684856 X:43553465-43553487 GAGGCCCACACTGGGCAGAGAGG + Intergenic
1189808614 X:44760659-44760681 GAGGATCACTTGAGGCTCAGAGG + Intergenic
1189987429 X:46566361-46566383 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1190112929 X:47606637-47606659 GAGGATCACTTGAGCCTGAGAGG + Intronic
1190337696 X:49272235-49272257 GGGGCTCACAGGTGGGTGAGTGG - Intronic
1190385192 X:49878276-49878298 GAGTCGGACATGAGGCTGAGAGG - Intergenic
1191021800 X:55868409-55868431 GAGGGTCACAAGGTGCTCAGTGG - Intergenic
1192108756 X:68342849-68342871 GAGGATCACCTGAGCCTGAGAGG + Intronic
1192322791 X:70105469-70105491 GAGGCTCACATAGGGGGCAGGGG + Intergenic
1192380557 X:70612043-70612065 GAGGATCACTTGGGCCTGGGTGG + Intronic
1193863355 X:86698615-86698637 GAGGCTCACCTGAGCCTGGGAGG - Intronic
1194655522 X:96569061-96569083 GAGGATCACATGGGACTAAGAGG - Intergenic
1194919709 X:99749969-99749991 GAGGGTCACAAGGTGCTCAGTGG + Intergenic
1195030475 X:100922821-100922843 CAGGCTCACATAGAGCTGATAGG + Exonic
1195109582 X:101632984-101633006 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1195691247 X:107627700-107627722 GAGGCTTACATGAGGCAGACAGG + Intergenic
1196415616 X:115467767-115467789 GAGGATCACTTGGGACTGGGAGG + Intergenic
1196424407 X:115555435-115555457 GAGGATCACTTGAGGCTGGGAGG - Intergenic
1196648362 X:118142906-118142928 GAGGATCACTTGAGGCTGCGAGG - Intergenic
1196655296 X:118211624-118211646 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1196670509 X:118361664-118361686 GAGGATCACTTGAGCCTGAGAGG + Intronic
1197764563 X:130051433-130051455 GAAGCCCAGAGGGGGCTGAGCGG - Intronic
1198031168 X:132754799-132754821 GAGGATCACTTGGGCCTGGGAGG - Intronic
1198201308 X:134422016-134422038 GAGGATCACATGAGCCTGGGAGG - Intronic
1200040304 X:153360635-153360657 GAGGATCACTTGAGCCTGAGAGG + Intergenic
1200764232 Y:7066854-7066876 GAGGTACTCAGGGGGCTGAGTGG + Intronic
1201012203 Y:9557964-9557986 GAGGTTCTCCTGGGGCTCAGTGG - Intergenic
1201284691 Y:12369027-12369049 GAGGGTCACAAGGTGCTCAGTGG + Intergenic
1202161852 Y:21942059-21942081 GAGGACCACATTGGGCTCAGAGG + Intergenic
1202229504 Y:22644314-22644336 GAGGACCACATTGGGCTCAGAGG - Intergenic
1202313652 Y:23551851-23551873 GAGGACCACATTGGGCTCAGAGG + Intergenic
1202339788 Y:23851589-23851611 AAGTGTCACATGGGACTGAGAGG - Intergenic
1202376672 Y:24244763-24244785 GAGGCACACATTGGTCTCAGTGG - Intergenic
1202494108 Y:25425356-25425378 GAGGCACACATTGGTCTCAGTGG + Intergenic
1202530978 Y:25818493-25818515 AAGTGTCACATGGGACTGAGAGG + Intergenic
1202557151 Y:26118744-26118766 GAGGACCACATTGGGCTCAGAGG - Intergenic