ID: 1152590308

View in Genome Browser
Species Human (GRCh38)
Location 17:81208455-81208477
Sequence CTGCCTCAATGGCCCCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 234}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152590308_1152590312 -4 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590312 17:81208474-81208496 GCAGCTCCTCCCCAGCCCGCTGG 0: 1
1: 0
2: 5
3: 55
4: 453
1152590308_1152590325 25 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590325 17:81208503-81208525 GGCCGCAAGGGACAGTGGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 219
1152590308_1152590322 13 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590322 17:81208491-81208513 CGCTGGTTTGGAGGCCGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 95
1152590308_1152590324 24 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590324 17:81208502-81208524 AGGCCGCAAGGGACAGTGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 210
1152590308_1152590313 1 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590313 17:81208479-81208501 TCCTCCCCAGCCCGCTGGTTTGG 0: 1
1: 0
2: 1
3: 14
4: 182
1152590308_1152590315 4 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590315 17:81208482-81208504 TCCCCAGCCCGCTGGTTTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 132
1152590308_1152590323 20 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590323 17:81208498-81208520 TTGGAGGCCGCAAGGGACAGTGG 0: 1
1: 0
2: 1
3: 13
4: 207
1152590308_1152590321 12 Left 1152590308 17:81208455-81208477 CCCCACTGGGGCCATTGAGGCAG 0: 1
1: 0
2: 1
3: 29
4: 234
Right 1152590321 17:81208490-81208512 CCGCTGGTTTGGAGGCCGCAAGG 0: 1
1: 0
2: 2
3: 8
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152590308 Original CRISPR CTGCCTCAATGGCCCCAGTG GGG (reversed) Intronic
900900403 1:5512100-5512122 CTGCCTGAATGGCAGGAGTGGGG - Intergenic
902543081 1:17168034-17168056 CTGTCTCATTGGCAGCAGTGAGG - Intergenic
903138215 1:21322887-21322909 CTCCCTCCAAAGCCCCAGTGAGG - Intronic
904594180 1:31632696-31632718 CTGCCTCAATGGGTCCTGAGGGG - Intronic
906288346 1:44603001-44603023 CTGCCTCTATGGGCGCAGGGTGG - Intronic
911797086 1:102089174-102089196 CTGCATCAAGGGACCCACTGGGG - Intergenic
912433090 1:109640026-109640048 ATGCCTCAGTGTCCCCAGAGTGG + Intergenic
912472350 1:109914415-109914437 CTGCCTTCATTTCCCCAGTGGGG - Intronic
912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG + Intronic
913089136 1:115464770-115464792 CCCCCTCACAGGCCCCAGTGTGG - Intergenic
913430023 1:118780661-118780683 CTGCCTTAATTTCCCCAGAGGGG + Intergenic
914431549 1:147624137-147624159 CCCTCACAATGGCCCCAGTGGGG + Exonic
915556190 1:156662039-156662061 CTGGGACAAAGGCCCCAGTGAGG - Intergenic
917055737 1:170978957-170978979 CTGGCTCAATAGCCCTGGTGAGG + Intronic
919773215 1:201176292-201176314 CACCTCCAATGGCCCCAGTGAGG - Intergenic
920523752 1:206649722-206649744 CTGCCACAATTGACCCAGAGTGG + Intronic
922549271 1:226482198-226482220 CTGTCACAATGTCCCCAGGGTGG - Intergenic
923101993 1:230824225-230824247 CTGAATCAATAACCCCAGTGAGG + Intergenic
924517614 1:244779751-244779773 ATGCCCCAATGGCACCTGTGGGG + Intergenic
924591191 1:245406180-245406202 TTGCCTCAATTTCCCCAGAGTGG - Intronic
924627518 1:245708054-245708076 CTGCCTCTCGGGACCCAGTGAGG - Intronic
924735402 1:246750992-246751014 CTGCGTCAAGGGACCCACTGGGG - Intronic
924919602 1:248613834-248613856 CTGCCTCAAAGGGCACAGAGTGG + Intergenic
1063829825 10:9940190-9940212 CTGCCTCACTGGGCCAGGTGGGG + Intergenic
1066489416 10:35880111-35880133 CTGACACAACGGCCCAAGTGTGG - Intergenic
1069799009 10:71070779-71070801 CTGCCTAAAAAGACCCAGTGGGG + Intergenic
1070479583 10:76869272-76869294 CTGTCCCATTGGCCCCAGTGTGG + Intergenic
1071437580 10:85661637-85661659 CAGCCACAATGCACCCAGTGGGG + Intronic
1072197654 10:93130361-93130383 ATGCCTCAGTTTCCCCAGTGGGG + Intergenic
1075638547 10:124047954-124047976 CTGCCTCTATGGAGACAGTGAGG - Intronic
1075650353 10:124123956-124123978 CTACCTCCATGGTCTCAGTGGGG - Intergenic
1076016643 10:127033079-127033101 CTGCCTCAAAGGGCTTAGTGAGG + Intronic
1076942418 10:133618616-133618638 CACCCGCACTGGCCCCAGTGAGG - Intergenic
1077444420 11:2583699-2583721 CTGCATCCAGGGCCCCAGGGAGG - Intronic
1077869859 11:6252595-6252617 CTGCCCCATTGGCCCAAATGTGG - Intergenic
1077984759 11:7340796-7340818 CTGGCTCAGTAGCCCCAGTGGGG + Intronic
1078993102 11:16669555-16669577 CTGGCTCAATAGCCCCAGCCGGG - Intronic
1079426041 11:20342979-20343001 CTGCCTCCCTGGCTCCAGCGGGG - Intergenic
1081099693 11:38986585-38986607 CTGCCTCAGTGGCCACAGCCTGG + Intergenic
1082001380 11:47395289-47395311 CTGGGCCAATGGCCTCAGTGAGG - Intergenic
1083417132 11:62533177-62533199 TAGCATCACTGGCCCCAGTGTGG - Exonic
1083492055 11:63020612-63020634 CTGCCTCCAAGGGCCCAGGGAGG - Intergenic
1084890258 11:72233259-72233281 CAGCCTCCATGGCCCCTCTGAGG + Intronic
1088243254 11:107792335-107792357 GTGCCTCTAAGACCCCAGTGTGG + Exonic
1088557920 11:111081492-111081514 CTGCCTCAAGGCCCTCAGTGAGG - Intergenic
1088729819 11:112670934-112670956 CTGGCTCAATAGCCCCAGCAGGG - Intergenic
1090385361 11:126355278-126355300 CTGCCCCAGTTTCCCCAGTGAGG + Intergenic
1090574489 11:128086310-128086332 CTGCCTTAATGCAGCCAGTGAGG - Intergenic
1091557016 12:1581497-1581519 CTGCCTGAAGGGCCCATGTGAGG + Intronic
1092138545 12:6166975-6166997 CTGCCTCAGTGGCCAGCGTGGGG - Intergenic
1092586474 12:9906128-9906150 CTGCATCAAGGGGCCCACTGGGG - Intronic
1094263537 12:28528204-28528226 CCTCCTCAAGGGCCCCTGTGAGG + Intronic
1094784449 12:33830056-33830078 CTGCCTCACAGGCCCCAGGGAGG - Intergenic
1095508250 12:42921371-42921393 CTGCCTCCATGGACACTGTGTGG + Intergenic
1099502063 12:83426184-83426206 CCCCCTGAGTGGCCCCAGTGTGG + Intergenic
1102999964 12:117377748-117377770 CTGCCACAGTTGCCCAAGTGAGG + Intronic
1104391769 12:128397111-128397133 CAGCCTCACTGGCCCCAGGGTGG + Intronic
1104547270 12:129723609-129723631 CTGCATCACAGACCCCAGTGAGG - Intronic
1104802936 12:131566968-131566990 CTGCCCCTGTGGCCCCCGTGAGG + Intergenic
1105225598 13:18428654-18428676 CTGCATCAAGGGACCCACTGGGG + Intergenic
1105291303 13:19055408-19055430 CAGTCTCAGTGGCCCCAGGGTGG + Intergenic
1109904950 13:68828532-68828554 CTGTTTCAAAGGCCCCAGTGCGG - Intergenic
1112369643 13:98783761-98783783 CTAGCTCAGTGGCCCAAGTGTGG - Intergenic
1112419872 13:99238562-99238584 CTGCCTCATTGGCCCCTGAGAGG + Intronic
1114145959 14:19978856-19978878 CTGCATCAAGGGACCCATTGTGG + Intergenic
1114278517 14:21169368-21169390 CTGGCTTTATAGCCCCAGTGGGG - Intergenic
1115140647 14:30167571-30167593 CTGACTCAATGGGCTGAGTGAGG - Intronic
1116725801 14:48560466-48560488 CTGCATCAAGGGACCCATTGAGG + Intergenic
1117035068 14:51720206-51720228 CTGCCTCAATGCCCGAGGTGTGG - Exonic
1117820675 14:59645523-59645545 CTGGCTCAATAGCTCCAGTGGGG - Intronic
1118924639 14:70180842-70180864 GTGCCTCAAGGGCCCCAGGTTGG - Intronic
1119330442 14:73789458-73789480 CTGCCTGAAGGGCCCGAGGGAGG - Intronic
1121016779 14:90553702-90553724 ATGCCTCCAAGGCCCCAGAGAGG - Intronic
1122092985 14:99352282-99352304 CTGCCTCCGTGGCTCCAGTCAGG + Intergenic
1122595408 14:102887000-102887022 CTGCCAGAAGGGCCCCTGTGTGG + Intronic
1124162210 15:27282890-27282912 CAGCCTCACTGGCCCCAGGTAGG + Intronic
1126564234 15:50077858-50077880 ATCCCACAATGGCCCCAGTCAGG - Intronic
1127983488 15:64050888-64050910 CTGCCTCCCTTGCCCCACTGTGG - Intronic
1129254338 15:74325569-74325591 TGGGCTCCATGGCCCCAGTGTGG + Intronic
1129382662 15:75177964-75177986 CTGGCTCACTGGGGCCAGTGGGG - Intergenic
1132115981 15:99136943-99136965 CTGCACAAATGGCCCCAGGGTGG + Exonic
1132657595 16:1047898-1047920 CTGCCTGAGTGGCCCCACAGTGG - Intergenic
1134107506 16:11494526-11494548 CGGCTTCAGTGCCCCCAGTGGGG - Intronic
1135377776 16:21964268-21964290 GTGCCTCACTGCCGCCAGTGGGG - Intronic
1135480095 16:22814772-22814794 CTGCCTCCGCGGCCCCAGCGCGG + Exonic
1135842646 16:25890662-25890684 CTGGCTCAATTTCCCCAGAGAGG - Intronic
1136147438 16:28323603-28323625 CTGTCCCACTGGCCACAGTGTGG - Exonic
1139274492 16:65714787-65714809 CTGTCTGAGTGGCCCCAGTCAGG - Intergenic
1140004648 16:71062842-71062864 CTTCCTCAAGGGCCCTAGGGTGG + Intronic
1140052022 16:71489689-71489711 CTTCCTCAATGGCCCGTGAGTGG - Intronic
1140070892 16:71648867-71648889 CTGCCCCACTGGGCACAGTGTGG - Exonic
1141668683 16:85480171-85480193 CGGCCTCAAGGGCCCCAGCCAGG + Intergenic
1141785229 16:86195201-86195223 CTGCCTCACAGGCCCACGTGTGG + Intergenic
1146400088 17:32495039-32495061 ATGCCTGAAGGGCCCCAGAGAGG + Intronic
1146774156 17:35597082-35597104 CTGCCTCAGTGGCCCCGGAGCGG - Intronic
1146847734 17:36195238-36195260 CGACCTCAGTGGGCCCAGTGGGG - Exonic
1151909026 17:77069237-77069259 CTGCCTCAGTTTCCCCAGTGTGG - Intergenic
1152096191 17:78273075-78273097 CTGTCTGAAGGGCACCAGTGTGG - Intergenic
1152590308 17:81208455-81208477 CTGCCTCAATGGCCCCAGTGGGG - Intronic
1154325374 18:13387230-13387252 CTGCCTCCACGACCCCACTGTGG - Intronic
1154527780 18:15310868-15310890 CTGCATCAAGGGACCCACTGGGG - Intergenic
1157411785 18:47469263-47469285 GTGCCTCAATGACCACAGTGAGG + Intergenic
1157585934 18:48801133-48801155 CTGCCCCACTGGACTCAGTGAGG - Intronic
1159209522 18:65298683-65298705 CTGCCTAGTTGGCCCTAGTGAGG + Intergenic
1161363254 19:3863393-3863415 CTGTCTCAATGTCCCCACTCCGG + Intronic
1162418630 19:10553196-10553218 CTGGCTGAATGGCCCCAGACTGG - Exonic
1163527452 19:17830370-17830392 CAGCATCATAGGCCCCAGTGGGG - Intronic
1165493793 19:36140579-36140601 CGGCCTAAAGGGCCCCAGGGCGG - Intronic
1165559710 19:36668321-36668343 CTCCCGCAGTGGCCCCTGTGGGG + Intergenic
1165781698 19:38438422-38438444 CTGTCTCAGGGGCCCCAGGGAGG + Intronic
1166346821 19:42171654-42171676 CTGCCTCCCTGGCCTCACTGCGG + Intronic
1166646206 19:44533424-44533446 CTGAGTGAATGGCCTCAGTGAGG - Intergenic
1167396790 19:49234867-49234889 CTCCCCAAATGGCCCCAGAGAGG - Intergenic
1167436388 19:49481062-49481084 CTGTCTCCGTGGCCCCAGAGGGG - Intronic
1168211401 19:54893384-54893406 CTGCCTCAACCTCCCAAGTGTGG + Intergenic
925859950 2:8164582-8164604 CTGCCTCCATGGGCACAGTGTGG - Intergenic
926210771 2:10868001-10868023 CTCCATCCTTGGCCCCAGTGAGG + Intergenic
927093252 2:19728416-19728438 CTGCCCCAGTGGCCCCAAGGCGG - Intergenic
928944876 2:36763174-36763196 CTGACTCACTGGACCCAGGGTGG - Intronic
929542034 2:42829948-42829970 GTGCCACCATGGCCCCAGTAGGG + Intergenic
929873604 2:45778080-45778102 CTTCCTCAATGCTCCCAATGAGG - Intronic
930708437 2:54527130-54527152 CTTTCTCCATGGCCCCAGTGAGG + Intronic
934530821 2:95087471-95087493 CTTCCTCAAGGGCCCCCGGGGGG + Exonic
935440855 2:103094191-103094213 CTGGCTCAATAGTTCCAGTGGGG + Intergenic
935919331 2:107994109-107994131 CTGCCTCAACAGCCTCAGTCAGG - Intronic
936029529 2:109059898-109059920 CTGCCTCACAGGCCTGAGTGTGG + Intergenic
936153702 2:110035278-110035300 CTTCCTCCCTGGCCCCACTGTGG - Intergenic
936190983 2:110336137-110336159 CTTCCTCCCTGGCCCCACTGTGG + Intergenic
936716479 2:115192472-115192494 CTGCATCAAGGGACCCACTGGGG - Intronic
937099761 2:119259740-119259762 CAGCCTTAGTAGCCCCAGTGAGG - Intronic
937243606 2:120478044-120478066 CTGCCTGAGTGGCCCAAGAGAGG - Intergenic
937253987 2:120541758-120541780 CTGCCTTAATGAGCACAGTGTGG - Intergenic
937984723 2:127633342-127633364 CTTCCCCAATGACACCAGTGAGG + Exonic
940021899 2:149164736-149164758 CTGCCTCACTGGCCCTAGGTGGG + Intronic
941934135 2:170970213-170970235 CTCCATCAATGGCTGCAGTGTGG - Intergenic
948881502 2:240859854-240859876 CTGGCTAAATGAACCCAGTGTGG - Intergenic
1168889660 20:1286610-1286632 CTGCTTCTATGGCTCCATTGTGG + Intronic
1170823932 20:19777315-19777337 CTGCTCCAAAGGCCCCAGTGGGG - Intergenic
1171824613 20:29883677-29883699 CTTCCTCTCTGGCCACAGTGAGG + Intergenic
1173255566 20:41392341-41392363 CTGCTGCACTGGCCCCAGGGAGG - Intergenic
1173953284 20:47010351-47010373 CTGCCTAGATGGCACCAGTGGGG + Intronic
1174591157 20:51646137-51646159 CTGCCTCAAATGCCCATGTGAGG + Intronic
1176327937 21:5518583-5518605 CTGCCTCAAGGTCCCCTATGAGG - Intergenic
1176399820 21:6302368-6302390 CTGCCTCAAGGTCCCCTATGAGG + Intergenic
1176437337 21:6686736-6686758 CTGCCTCAAGGTCCCCTATGAGG - Intergenic
1176461599 21:7013806-7013828 CTGCCTCAAGGTCCCCTATGAGG - Intergenic
1176485160 21:7395584-7395606 CTGCCTCAAGGTCCCCTATGAGG - Intergenic
1176769652 21:13057677-13057699 CTGCATCAAGGGACCCACTGGGG + Intergenic
1177570670 21:22882168-22882190 CTGTCTCAATGGCCACAGTCAGG - Intergenic
1179258255 21:39736600-39736622 CTTCCTCTCTTGCCCCAGTGTGG + Intergenic
1180516756 22:16151621-16151643 CTGCATCAAGGGACCCACTGGGG + Intergenic
1180706823 22:17815381-17815403 CTGCCTCAGTGGTGACAGTGTGG - Intronic
1180830320 22:18902420-18902442 CTGCCTCACTGGCCCTGGTGAGG - Intergenic
1181069392 22:20323113-20323135 CTGCCTCACTGGCCCTGGTGAGG + Intergenic
1181766546 22:25096279-25096301 CTGCCACCCTGACCCCAGTGGGG - Intronic
1181808696 22:25390725-25390747 GTGCCACAAGGGCTCCAGTGTGG + Intronic
1181853530 22:25766899-25766921 CTGTGGCAATGGCCCAAGTGAGG + Intronic
1182096224 22:27627758-27627780 CTGCCTCAGTTTCCTCAGTGGGG - Intergenic
1183095038 22:35546923-35546945 CTTCCTCAATGGCCGCTTTGAGG + Exonic
1185360384 22:50403380-50403402 CAGCCTCAAAGGCCACAGTGAGG - Intronic
1203280409 22_KI270734v1_random:127691-127713 CTGCCTCACTGGCCCTGGTGAGG - Intergenic
951682864 3:25312754-25312776 CTGCATAGATGGCCCCACTGGGG + Intronic
952842531 3:37660533-37660555 CTGCCTCCACTGCCCCAGTCTGG + Intronic
954199955 3:49018267-49018289 CTGCCTGCAGGGCCCCGGTGTGG - Exonic
954654241 3:52184241-52184263 CTGCCTCAGGGGCCCCTTTGAGG + Intergenic
956695722 3:71917661-71917683 CTACCACAATGGCCAGAGTGAGG - Intergenic
957538670 3:81539673-81539695 CTGACTGAATGGCGACAGTGAGG + Intronic
958151475 3:89699246-89699268 CTTCCCCAAGGGCCCCTGTGAGG - Intergenic
961329192 3:126128871-126128893 CAGCCTCAAAGACCCAAGTGTGG + Intronic
961452772 3:127009808-127009830 CTGCCTCCATGGCCCCAGTCTGG - Intronic
963025319 3:140913434-140913456 CTGCCTCAACTGCCCCAGGTGGG - Intergenic
963918119 3:150879330-150879352 CAGCAGCACTGGCCCCAGTGTGG - Intronic
966885586 3:184376315-184376337 CCGCCTCCATGGCCCCAGGAAGG - Exonic
968490574 4:888723-888745 CTGCCTCAGGGGCCCCTGTGGGG + Intronic
968658768 4:1790071-1790093 CTGCCTCAAAGGCCCCAGAAGGG + Intergenic
968911000 4:3476987-3477009 CTGCCCTAATGTCCCCAGTGAGG + Intronic
969669569 4:8582260-8582282 CTGCCTCAGTTGCCTCTGTGTGG + Intronic
969714369 4:8861220-8861242 CTGGCTCCAGGGCCCCAGCGGGG + Intronic
970794325 4:19893104-19893126 CTGGTGCAATGGACCCAGTGGGG - Intergenic
972181910 4:36477083-36477105 CTGCCTCAATGGTCCCTGAAAGG - Intergenic
972583928 4:40419475-40419497 CTGCCTTCCTGGCCCCAGGGGGG - Intergenic
977786999 4:101047701-101047723 CCGCCTCAGTCTCCCCAGTGAGG + Intronic
983275823 4:165616207-165616229 CTACCTCAATGGAACCATTGAGG - Intergenic
985282654 4:188302363-188302385 CTGTCTCAGTGACCTCAGTGGGG + Intergenic
985573418 5:662678-662700 CGGCCTCCCTGGCCCCAGCGCGG - Exonic
986440810 5:7780006-7780028 CTGCCTCAGTGGCTCAAGTTTGG + Intronic
986793644 5:11188440-11188462 CTCCCTGACTGGCCCCAGTGTGG - Intronic
987207929 5:15646500-15646522 CTGCCTCTATGGCTACAGCGGGG + Intronic
987767783 5:22257154-22257176 CTTTCTGAAAGGCCCCAGTGTGG - Intronic
989106247 5:37865934-37865956 TTTACTCAATGGCCTCAGTGGGG - Intergenic
989572640 5:42959240-42959262 CTACCTCATTGGCCCATGTGGGG + Intergenic
993250398 5:85513631-85513653 CTCCCTCAATTTCTCCAGTGGGG + Intergenic
993351277 5:86853309-86853331 CTGGCTCAATAGCCCTGGTGGGG + Intergenic
993851451 5:93015343-93015365 CTGCCTCAGCCTCCCCAGTGGGG + Intergenic
994242764 5:97444185-97444207 CTGGCTCAATGTCCCCAGCAAGG + Intergenic
998810153 5:145958319-145958341 CTCCCTGAATGGCCCCAGCTGGG + Intronic
999648906 5:153746568-153746590 CTGCCTCAGTGGGCCAGGTGTGG - Intronic
1001208573 5:169788608-169788630 CTGCCCTTATGGCCCCAGTAAGG + Intronic
1001955905 5:175848058-175848080 CTGCCTCAACAGCCCCAGGCTGG + Intronic
1002878567 6:1232768-1232790 CTGCCCCGATGTCACCAGTGTGG + Intergenic
1003144617 6:3499254-3499276 CTGCCCCAATCACCCCAGGGCGG - Intergenic
1007947164 6:45837064-45837086 CTGCCTCCAGGGCCCATGTGAGG + Intergenic
1008025255 6:46628777-46628799 ATGGCTCAAAGGCCCCAGAGTGG - Intronic
1008173229 6:48234608-48234630 CTGGCTCAATAGCCCCAGCAAGG - Intergenic
1008211437 6:48729533-48729555 CTGGCTCAATAGCCCCAGATAGG - Intergenic
1008294309 6:49757164-49757186 CTGACTTGATAGCCCCAGTGGGG + Intergenic
1009056977 6:58347972-58347994 CTGCCTCAATGGCCCCTGATGGG + Intergenic
1009234266 6:61103597-61103619 CTGCCTCAATGGTCCCTGATGGG - Intergenic
1010366424 6:75057416-75057438 CTGCCTCATTTCCCCCTGTGTGG - Intergenic
1013157118 6:107503531-107503553 CTGCCTCACTTCCCCTAGTGTGG - Intronic
1014254117 6:119144414-119144436 CTGCCTAAATTGCTCCAGTGGGG + Intronic
1014690890 6:124562255-124562277 GTGTCTCAATGGCACTAGTGTGG - Intronic
1017983832 6:159425317-159425339 GTGTATCAATGGCCCCAGAGAGG + Intergenic
1018163809 6:161074957-161074979 CAGCCTCCATGGCAACAGTGAGG - Intronic
1018391689 6:163346030-163346052 CTGACTCAGTGGCCCCAGCGAGG - Intergenic
1019175382 6:170156857-170156879 CTGCCTCTGTGGCCCATGTGTGG - Intergenic
1019742995 7:2684408-2684430 CTGCCTCAGTTTCCCCAGGGTGG - Intronic
1019973857 7:4564077-4564099 GTGTGCCAATGGCCCCAGTGGGG + Intergenic
1020358649 7:7303895-7303917 CTGCCTCAAGGACCCCTGTGAGG + Intergenic
1020745272 7:12071905-12071927 CTGCATCAAGGGACCCATTGGGG + Intergenic
1020850552 7:13347425-13347447 CTTCCACAAGGGTCCCAGTGAGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1024036125 7:45509063-45509085 CAGCCTCAATGGCCCACATGGGG - Intergenic
1025182730 7:56831815-56831837 CTGCCTCAATGGCCTCTCTAGGG - Intergenic
1025689196 7:63745159-63745181 CTGCCTCAATGGCCTCTCTAGGG + Intergenic
1032472417 7:132188240-132188262 CTGCCAGAATGGGACCAGTGAGG + Intronic
1034283358 7:149868616-149868638 CTGCCACACTGGCACCTGTGTGG + Intergenic
1037832815 8:22199202-22199224 GAGCCTCGATGCCCCCAGTGGGG - Intronic
1041700711 8:60786211-60786233 CAGCATCAGTGGCCCCATTGTGG + Intronic
1042633297 8:70844566-70844588 CAGCCTCAAGTGCACCAGTGGGG + Intergenic
1043171597 8:76972842-76972864 CTCCCTCCTTAGCCCCAGTGGGG - Intergenic
1044773841 8:95666955-95666977 CTTCCTCAATGGAACCAGTCTGG - Intergenic
1048235228 8:132683385-132683407 GTGCCTCAATGGGCTCAGAGGGG - Intergenic
1048448354 8:134510009-134510031 CTGACTCAGTGGCCCAAATGAGG - Intronic
1048663314 8:136632214-136632236 CTGCCTCTAAGACCCCAGAGTGG - Intergenic
1049389579 8:142360911-142360933 CTGCCTCAGAGGCCCTACTGGGG - Intronic
1049402451 8:142434575-142434597 CTGCCTCAGTAGCCCAAGGGAGG - Intergenic
1049714654 8:144084159-144084181 CTGCCTGAATGGCCCCAGCTCGG - Exonic
1050314852 9:4390950-4390972 CTTTCTCAAAGGCCCCAATGTGG - Intergenic
1050824079 9:9922069-9922091 CTGCCTATATGCCCACAGTGTGG + Intronic
1052766990 9:32651127-32651149 CTGGCTCAATAGCCCCAGCAGGG - Intergenic
1053705570 9:40749680-40749702 CTGCATCAAGGGACCCACTGGGG - Intergenic
1053748614 9:41230614-41230636 CTCCCTCTCTGGCCACAGTGAGG - Intergenic
1054337762 9:63822774-63822796 CTCCCTCTCTGGCCACAGTGAGG + Intergenic
1054415647 9:64873287-64873309 CTGCATCAAGGGACCCACTGGGG - Intergenic
1054858789 9:69928760-69928782 CTGCATCAAGGGACCCACTGGGG - Intergenic
1055977731 9:81971152-81971174 CTCCCTGAATGTCTCCAGTGAGG + Intergenic
1057706770 9:97400213-97400235 CTGCCTCAGTGTGCTCAGTGAGG + Intergenic
1060201594 9:121654682-121654704 CTGGCTCAAAGGCCACAGGGTGG - Intronic
1060732716 9:126048413-126048435 CTGTCCTACTGGCCCCAGTGAGG - Intergenic
1061399755 9:130361950-130361972 CTGCCTGCTTTGCCCCAGTGGGG + Intronic
1061922126 9:133788072-133788094 CTGCCTCAGTCGCCTCACTGGGG + Intronic
1062119373 9:134825917-134825939 GTCCCTCCATGGCCCCAGCGGGG + Intronic
1062171513 9:135137392-135137414 CTCCCTCCCTGCCCCCAGTGGGG - Intergenic
1203434172 Un_GL000195v1:121875-121897 CTGCCTCAAGGTCCCCTATGAGG + Intergenic
1203445471 Un_GL000219v1:50629-50651 CTCCCTCTCTGGCCACAGTGAGG + Intergenic
1190626717 X:52344160-52344182 CTACCTCTGTGGCCCCAGTATGG - Intergenic
1190701291 X:52991669-52991691 CTACCTCTGTGGCCCCAGTATGG + Intronic
1191987251 X:66995090-66995112 CTGTCTCGCTGGCACCAGTGTGG + Intergenic
1192221283 X:69198940-69198962 CTGCCTCAATGGGCTAGGTGAGG - Intergenic
1193423109 X:81308280-81308302 CTGGCTAAAGGGCTCCAGTGGGG + Intergenic
1195943197 X:110181918-110181940 CTGCCTTAATGTGCCCTGTGTGG + Intronic
1196085305 X:111677884-111677906 TTGCCTCTATGGGCCCTGTGGGG - Intronic
1199635069 X:149806313-149806335 CTGCCTCCCAGGCCCCAGAGAGG + Intergenic
1199674729 X:150178456-150178478 CTCTCTAAAAGGCCCCAGTGTGG - Intergenic