ID: 1152590750

View in Genome Browser
Species Human (GRCh38)
Location 17:81210714-81210736
Sequence AGACCCGAGGTCCCATCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152590750_1152590752 -10 Left 1152590750 17:81210714-81210736 CCACAGGATGGGACCTCGGGTCT 0: 1
1: 0
2: 1
3: 11
4: 98
Right 1152590752 17:81210727-81210749 CCTCGGGTCTCCAGTTTCCCAGG 0: 1
1: 0
2: 1
3: 14
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152590750 Original CRISPR AGACCCGAGGTCCCATCCTG TGG (reversed) Intronic
901217726 1:7564135-7564157 CGACCCCATGTCCCCTCCTGGGG + Intronic
901852625 1:12025664-12025686 AGACGGGAGGTCACATCATGGGG - Intronic
904977056 1:34464745-34464767 AGCCCTAAGATCCCATCCTGAGG - Intergenic
907299796 1:53479577-53479599 AAACAAGAGGACCCATCCTGTGG - Intergenic
907359695 1:53904531-53904553 AGTGCCTAGGACCCATCCTGGGG + Intronic
911103372 1:94111178-94111200 AGACTCCAGGTCACATTCTGGGG + Intronic
913321067 1:117588817-117588839 AGAGCCCAGTGCCCATCCTGTGG - Intergenic
915168723 1:153963252-153963274 TGCCTCTAGGTCCCATCCTGGGG - Exonic
915248464 1:154572169-154572191 ACGCCCGGGGTCCCAGCCTGCGG - Intronic
917980220 1:180264673-180264695 AAAACCCAGGTCCCCTCCTGAGG + Intronic
918362683 1:183774895-183774917 AGACTGGAGGTCCTCTCCTGAGG - Intronic
1063945851 10:11175617-11175639 TGACCGGAGGCCCCCTCCTGGGG - Intronic
1067408537 10:46045040-46045062 AGGCCCGGGGTCCCCTCCTGAGG + Intronic
1069676450 10:70252007-70252029 AGACCCTGGTTCCCAACCTGGGG + Exonic
1075574559 10:123569453-123569475 AGGCCAGAAGTCCAATCCTGTGG - Intergenic
1077301004 11:1846939-1846961 AGACCCGTGTCCCCGTCCTGAGG - Intergenic
1077383882 11:2260027-2260049 AGACCTCAGGTAGCATCCTGGGG - Intergenic
1080459182 11:32438563-32438585 AGAGCTGAGGTTCCATTCTGGGG - Intergenic
1082774313 11:57234189-57234211 AGCCAAGAGGTCCAATCCTGAGG + Exonic
1084014744 11:66371766-66371788 GGAGCCCAGGTCCCAGCCTGCGG - Exonic
1084565608 11:69926796-69926818 AAAGCCGAGGTCCCTTCCCGGGG + Intergenic
1089169709 11:116503521-116503543 AGACCCGAAGCCCTGTCCTGGGG + Intergenic
1089343570 11:117776088-117776110 AGACCCAAGGTCCTCTCTTGGGG + Intronic
1090231993 11:125113927-125113949 AGACCCCAGGTCAGAGCCTGGGG + Intergenic
1103433817 12:120908890-120908912 AAAGCAGAGGACCCATCCTGGGG - Intergenic
1103744750 12:123114935-123114957 AGACCCGAGATCCCTGCATGAGG + Intronic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1108193045 13:47962869-47962891 GGTCCCAAGGTCCCTTCCTGAGG - Intronic
1108338388 13:49470877-49470899 AGACCCAAGATTTCATCCTGGGG - Intronic
1111580093 13:90211481-90211503 AGAACCAAGTTCCCATGCTGTGG + Intergenic
1113139727 13:107133785-107133807 AGACCAGATGACCCATCCTGTGG - Intergenic
1113774403 13:112934605-112934627 AGACTTGAGGTCCCAACCAGTGG - Intronic
1113889930 13:113730433-113730455 AGACCCATCATCCCATCCTGAGG + Intronic
1114634541 14:24179869-24179891 AGACCCGGGCAGCCATCCTGCGG - Exonic
1125525704 15:40372857-40372879 ACACCCGAGGGCCCTACCTGGGG + Intergenic
1127291081 15:57571782-57571804 AGCCCCATGGTGCCATCCTGGGG - Intergenic
1129798366 15:78395211-78395233 AGAGCCGCGGTCTCATCCTCTGG - Intergenic
1135591488 16:23708088-23708110 AGCCCTGAGGTCCCATCGGGTGG + Intronic
1138148277 16:54631641-54631663 TCAACCGAGGTCCCATCATGAGG + Intergenic
1140440595 16:74984849-74984871 AGACCCTAGGCCCCGTACTGAGG - Intronic
1141612136 16:85187794-85187816 ATAGCCGAGGGCCCTTCCTGTGG + Intergenic
1141705703 16:85663264-85663286 TGTCCCGGGGTCCCCTCCTGGGG - Intronic
1141764895 16:86051852-86051874 GGACCCAAGGTCCCAGCCTGGGG + Intergenic
1141845367 16:86604665-86604687 AGCCCCCAGGCCCCCTCCTGGGG - Intergenic
1142204423 16:88776109-88776131 GGACCCGAGATCCCACACTGTGG + Intronic
1142262116 16:89047957-89047979 AGACCCGAGGCCACTGCCTGTGG - Intergenic
1145879769 17:28344629-28344651 AGGCCCTATCTCCCATCCTGTGG + Exonic
1149694624 17:58607271-58607293 CTACCTGAGGTTCCATCCTGAGG + Intronic
1152590750 17:81210714-81210736 AGACCCGAGGTCCCATCCTGTGG - Intronic
1152711101 17:81870935-81870957 AGACCTGAGGGCCCCTCCTTGGG - Intronic
1152732277 17:81978078-81978100 AGACCCGCGTTCCCATTCCGGGG + Intronic
1154102596 18:11489854-11489876 AGAACCTAGGTCCCTTCATGGGG + Intergenic
1161406477 19:4094152-4094174 AAGCCCGGGGTCTCATCCTGTGG + Intronic
1161475649 19:4483401-4483423 AGGGCCGAGGTTCCCTCCTGTGG + Intronic
1164905601 19:31964979-31965001 AGACCCCAAATCCCATGCTGTGG + Intergenic
1165255636 19:34576118-34576140 AGACGTGAGGACTCATCCTGGGG - Intergenic
1166102096 19:40576999-40577021 ACTCCTGAGGTCCCATCCTCGGG + Intronic
1166972085 19:46575752-46575774 AGAGACAAGGTCCCATCATGTGG - Intronic
1167434814 19:49473361-49473383 GGATTCGAGGTCCCATCCTGGGG - Intronic
1168419553 19:56192410-56192432 GGCCCAGAAGTCCCATCCTGAGG - Intronic
932259742 2:70317198-70317220 AGGCCTGAGGTCGCCTCCTGTGG - Intergenic
937260770 2:120585781-120585803 AGACCATATGTCCCATCCTCAGG - Intergenic
938252053 2:129822951-129822973 AGACCTGAGGAACCATGCTGAGG + Intergenic
938614825 2:132986949-132986971 AGAACCCAGGACCCATCCTATGG + Intronic
938883765 2:135621176-135621198 AGACCTGAGTTCTCATCCTCCGG + Intronic
942232683 2:173874511-173874533 CCACCAGAGGGCCCATCCTGGGG + Intergenic
946368871 2:219268048-219268070 AAATCCCAGGTCCAATCCTGGGG - Intronic
948803348 2:240442652-240442674 ACACCCAAAGTCACATCCTGAGG + Intronic
1178361960 21:31956103-31956125 AGACCTGAGGTCCCAGCCTGGGG + Intronic
1179882119 21:44297246-44297268 GGGCCCGTGGCCCCATCCTGTGG + Intronic
1184322646 22:43754339-43754361 AGACCTGGGTTTCCATCCTGGGG - Intronic
1185207022 22:49545776-49545798 AGACCCAGGGTCCCTGCCTGTGG - Intronic
951744397 3:25961234-25961256 AGTCCCCAGGTCCTCTCCTGCGG - Intergenic
953374931 3:42420704-42420726 CGCCCAGAGGTCCCAGCCTGGGG + Intergenic
953454746 3:43032583-43032605 ATGCCTGAGGTCCCCTCCTGGGG - Exonic
953512849 3:43560245-43560267 AGCCCAGAGCTCCCATCTTGTGG - Intronic
954412545 3:50377316-50377338 AGACCCAAGGTCACCTCCTGGGG + Intronic
954452063 3:50577081-50577103 GGCCCAGAGGTCCCATGCTGTGG + Exonic
960011633 3:112840539-112840561 AGACCCCACCTCCCATACTGGGG + Intronic
962444779 3:135454693-135454715 AGATTTGAGGTCCCATCCTGAGG - Intergenic
963031344 3:140981210-140981232 AGACCTTAGGTTACATCCTGAGG + Intergenic
968287087 3:197515054-197515076 AGAGCAGAGCTCCCATCCTGGGG + Intronic
968597535 4:1493129-1493151 AGACCCGAGGTGTGAACCTGTGG - Intergenic
977504631 4:97886780-97886802 AGACCCCACGTCCAATACTGGGG - Intronic
977681914 4:99806663-99806685 TGACCAGAGGTCCCATGGTGGGG - Intergenic
985481363 5:112999-113021 AGACCCGTGGCCCTGTCCTGGGG - Intergenic
986643296 5:9892542-9892564 GAACCCTGGGTCCCATCCTGAGG - Intergenic
995834725 5:116388680-116388702 AGAGCAGAGGTCCCCTCCTTGGG - Intronic
998818187 5:146034350-146034372 TGCCCCGAGGTCCCAGCCTGTGG - Intronic
1000342662 5:160289530-160289552 AGACCAGAGGAGCCATTCTGGGG + Intronic
1001703115 5:173721660-173721682 TGGCCTGAGGTCCCATCCTCGGG - Intergenic
1006436411 6:34028004-34028026 TGCCCCGATGCCCCATCCTGGGG - Intronic
1019299348 7:295677-295699 ACAGCCCAGGTGCCATCCTGAGG - Intergenic
1019899075 7:4005902-4005924 ACACCTGTGGTCCCAGCCTGGGG + Intronic
1024156951 7:46635983-46636005 ACACCAGATTTCCCATCCTGAGG + Intergenic
1029614600 7:101648408-101648430 AAAGCCCAGGTCCCATGCTGGGG + Intergenic
1035661702 8:1352890-1352912 AGACCGGAGGCCCCATTCTCAGG - Intergenic
1037048405 8:14338247-14338269 AGACCAGAAGGCCCATCTTGTGG - Intronic
1039858625 8:41437605-41437627 GGGCCCAAGCTCCCATCCTGGGG + Intergenic
1049304427 8:141893448-141893470 AGCCCCCAGTTCCCTTCCTGTGG + Intergenic
1049646901 8:143739605-143739627 AGAGCCCAGGTGCCTTCCTGCGG + Intergenic
1059663072 9:116420543-116420565 AGACCAGAGGTCTCTACCTGAGG + Intergenic
1061184205 9:129042542-129042564 TGACCTGAGGTCACATCCTGGGG + Intronic
1061918674 9:133770263-133770285 AGACCAGGAGTCCCACCCTGGGG - Intronic
1062710547 9:137972917-137972939 AGTCCCGAGGTACCACCCTGTGG - Intronic
1194916899 X:99718162-99718184 AGGCTCCAGGTCCAATCCTGTGG + Intergenic
1200080880 X:153575772-153575794 ACACCCGAGGGCCCCTCCTCTGG - Intronic
1200211693 X:154349463-154349485 GGACCCGGGGCCCCATGCTGGGG + Exonic
1200272556 X:154699422-154699444 AGACCAGAGGCACCAGCCTGGGG + Exonic
1201647618 Y:16252898-16252920 AGATCCCACGTCCCATCCTATGG + Intergenic
1201655193 Y:16332403-16332425 AGATCCCACGTCCCATCCTATGG - Intergenic