ID: 1152590826

View in Genome Browser
Species Human (GRCh38)
Location 17:81211179-81211201
Sequence GGGCCTCTGTGGCCCCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152590826_1152590831 7 Left 1152590826 17:81211179-81211201 CCACGCTGGGGCCACAGAGGCCC 0: 1
1: 0
2: 3
3: 27
4: 324
Right 1152590831 17:81211209-81211231 TTCCTCATTCAATCCCTGCTGGG 0: 1
1: 0
2: 3
3: 13
4: 190
1152590826_1152590834 20 Left 1152590826 17:81211179-81211201 CCACGCTGGGGCCACAGAGGCCC 0: 1
1: 0
2: 3
3: 27
4: 324
Right 1152590834 17:81211222-81211244 CCCTGCTGGGCTGTGCTCCCAGG 0: 1
1: 0
2: 8
3: 82
4: 652
1152590826_1152590830 6 Left 1152590826 17:81211179-81211201 CCACGCTGGGGCCACAGAGGCCC 0: 1
1: 0
2: 3
3: 27
4: 324
Right 1152590830 17:81211208-81211230 ATTCCTCATTCAATCCCTGCTGG 0: 1
1: 0
2: 0
3: 15
4: 148
1152590826_1152590836 21 Left 1152590826 17:81211179-81211201 CCACGCTGGGGCCACAGAGGCCC 0: 1
1: 0
2: 3
3: 27
4: 324
Right 1152590836 17:81211223-81211245 CCTGCTGGGCTGTGCTCCCAGGG 0: 1
1: 0
2: 4
3: 51
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152590826 Original CRISPR GGGCCTCTGTGGCCCCAGCG TGG (reversed) Intronic
900138024 1:1126771-1126793 GGGCCGCTGAAGCCGCAGCGAGG - Intergenic
900183358 1:1322102-1322124 GGGCCTCTGTGAGCCTGGCGTGG - Intronic
900473741 1:2866712-2866734 GGGCCACTTTGACCCCAGGGCGG + Intergenic
901262810 1:7885944-7885966 GGGCCTGTGTGGCCCTTGTGGGG + Intergenic
901776444 1:11563487-11563509 GGGCCTTTGTGTCCCCAGCAGGG + Intergenic
901808125 1:11750456-11750478 GGGCCTCTGTGGTGCCACCATGG - Exonic
902212433 1:14913625-14913647 TGCCCTCAGTGGCCCCAGCATGG - Intronic
902806988 1:18867326-18867348 GGGCTCCTGAGGCCCCAGCCTGG + Intronic
903320374 1:22539368-22539390 TGGCCTCTGTGACCTCAGCCAGG + Intergenic
903917985 1:26778446-26778468 GGGTCTCTGTAGCACCAGCTTGG + Intronic
904751002 1:32741607-32741629 CGCCCTCTCGGGCCCCAGCGGGG + Intergenic
905262742 1:36730926-36730948 GGGCCTCTGTGGCCCCTGCCAGG - Intergenic
905626192 1:39491851-39491873 CGGCGTCTGCGGCCTCAGCGCGG - Exonic
905768393 1:40622027-40622049 GGGCTTGTGTGGGCCCAGCATGG - Exonic
906125208 1:43423235-43423257 GGCCTGCTGTGGCCCCAGCACGG - Exonic
908127182 1:61043421-61043443 GGGCCTCTGTGGCTGGAGCCCGG - Intronic
913250986 1:116911412-116911434 GGGCCCCGGTGTCCCCAGCAGGG - Intronic
913971527 1:143421278-143421300 GTGCCTGTGTGGCCGGAGCGTGG - Intergenic
914065904 1:144246891-144246913 GTGCCTGTGTGGCCGGAGCGTGG - Intergenic
914113247 1:144719463-144719485 GTGCCTGTGTGGCCGGAGCGTGG + Intergenic
914824923 1:151133284-151133306 GGGGCTCTGGGCCCCCACCGTGG + Exonic
916807246 1:168270519-168270541 GGGGCCATGTGGCCCCAGCATGG - Intergenic
918355951 1:183706712-183706734 GGGGCTCTGTGGGCCCACGGGGG - Intronic
920249876 1:204616465-204616487 GGGCCACTGTGGACCCATCAAGG - Intergenic
920677066 1:208045567-208045589 GGGCTCCTGTGGCCACAGAGTGG + Intronic
922669067 1:227495053-227495075 GGGGCTCTGAGGGCCCAGCGCGG - Intergenic
922670530 1:227506249-227506271 GGGGCTCTGAGGGCCCAGCGCGG + Intergenic
922745178 1:228039272-228039294 CTGCCTCTGTGGCCCCATCCTGG - Intronic
922811242 1:228416677-228416699 GGGACTTTGTGGCGTCAGCGGGG + Intronic
923047633 1:230367255-230367277 GGGCATCGGTGGCCTCAGCTGGG - Intronic
1063097144 10:2918124-2918146 GGGCGTCTGTTGGCCCAGCAAGG - Intergenic
1065093035 10:22253213-22253235 GGGCTTCTCTGGCACTAGCGAGG - Intergenic
1067085204 10:43234541-43234563 GGGCCTCTGTAGCACCGGCGTGG - Intronic
1067840191 10:49669578-49669600 GAGCCTCAGTGGCTCCAGCTGGG + Intergenic
1068711639 10:60141370-60141392 AGGCCTCTGTTGCCCCAGATAGG + Intronic
1069532468 10:69229481-69229503 GGGCATCTGGGGCCCCTGGGAGG + Intronic
1069746503 10:70718042-70718064 GGGCCTTGGTGGCCTCAGCCTGG + Intronic
1069852481 10:71419104-71419126 GTTCCTCTGTGGCCTCAGCATGG + Intronic
1071424657 10:85536948-85536970 GTGTCTCTGTGGCCCCATCTTGG + Intergenic
1071560626 10:86644597-86644619 AGGACTCTGTGTCCCCAGCAGGG - Intergenic
1075004282 10:118819134-118819156 GGGCCTCTGAGGCCTAAGAGGGG - Intergenic
1075622090 10:123935385-123935407 TGGTCTCTGTGGCCCCACCCAGG - Intronic
1075780696 10:125015491-125015513 GCCCGGCTGTGGCCCCAGCGAGG - Intronic
1075859548 10:125662631-125662653 GGGCCTCTGTTGACCCGGCTGGG + Intronic
1076160861 10:128243182-128243204 GTGGCTCTGTGGCTCCAGAGTGG - Intergenic
1076649788 10:131979992-131980014 GGGCCACTGTGGGCTCGGCGTGG - Intronic
1076686980 10:132202592-132202614 GGGACTGTTGGGCCCCAGCGTGG + Intronic
1077096538 11:801465-801487 GCTCCTCAGTGGCCCCAGGGGGG + Exonic
1077373195 11:2193214-2193236 GGGCCTCAGTGTCCCCACCTGGG + Intergenic
1077488696 11:2850689-2850711 GGCCCTTTGTGGCCTCACCGCGG + Intergenic
1078190913 11:9091774-9091796 CGGCCGCGGTGGCCCGAGCGCGG + Intronic
1078537143 11:12184365-12184387 GGGCATCTGTGTCCCAAGAGAGG + Intronic
1078598617 11:12711485-12711507 GGGTCTCTGAGGCTCCAGGGAGG - Intronic
1079388428 11:20000735-20000757 TGACCTCTGTGGCACCAGAGAGG - Intronic
1080385543 11:31808918-31808940 GTGGTTCTATGGCCCCAGCGAGG - Intronic
1080743463 11:35086662-35086684 GGGCACCTGTAGTCCCAGCGAGG + Intergenic
1083330614 11:61896733-61896755 GGACCTCTGAGGACCCAGAGTGG - Intergenic
1083623999 11:64062732-64062754 GGGCATCTGGGGCCTCAGCCTGG - Intronic
1084426530 11:69087153-69087175 TGGCCTCTGGGGTCCCAGCAAGG - Exonic
1084512617 11:69615700-69615722 AGGCCTCTCTGGCCCCTGCATGG - Intergenic
1084549304 11:69831371-69831393 GGGCATCAGTGGCCCCAGGTGGG - Intergenic
1084745007 11:71164452-71164474 GGGCCCCAGTGTCCCCAGTGAGG + Intronic
1085509486 11:77080973-77080995 AGGCCTCTGTGGACCAAGAGTGG - Intronic
1087212375 11:95457237-95457259 AGGCCGCTGTGGCTCCAGCGTGG - Intergenic
1090355176 11:126135704-126135726 GAGCCTCTGTGTCCCCTGCCTGG - Intergenic
1092194609 12:6541691-6541713 GCGCCTCTGTTGCCCCCGCCAGG + Intronic
1092257824 12:6936868-6936890 GGGCCTCAGAGACCCCAGGGAGG - Exonic
1092995166 12:13942955-13942977 GGGCCTCTGAGGGACCAGAGGGG - Intronic
1094814115 12:34166865-34166887 GGGGCTCTGAGGGCCCAGCTCGG - Intergenic
1095491101 12:42734516-42734538 GTACCACTGTGGCACCAGCGTGG - Intergenic
1096878405 12:54648050-54648072 GGAGCCCTGTGGCCCCAGCCTGG - Intronic
1097269466 12:57765365-57765387 CGGCGTCTGAGGCGCCAGCGGGG - Exonic
1102519662 12:113470636-113470658 GGGCCTCAGTTTCCCCAGCCTGG - Intronic
1103561672 12:121796135-121796157 GTTCCTCAGTGGGCCCAGCGCGG - Intronic
1106248259 13:27966490-27966512 TGTCCTCTGTGGCTCCAGCCAGG - Intronic
1106776935 13:33017286-33017308 GGCCCTCTGTCTCCCCTGCGTGG - Intronic
1112294771 13:98177039-98177061 GGGCCTCGGTGCCACCCGCGGGG + Exonic
1112562749 13:100528612-100528634 GGGCCTCTGTTCTCCCAGCCGGG - Intronic
1113902025 13:113802819-113802841 GGGCGTCTGGGGGCCCAGGGTGG - Intronic
1113906728 13:113822725-113822747 AGGGCTCTGTGGCCCCGGGGTGG + Intronic
1114155128 14:20093843-20093865 GCCCTTCTGTGGCCCCAGTGTGG + Intergenic
1117817339 14:59611560-59611582 GGGTGTCTGTAGCCCCATCGTGG + Intronic
1120847688 14:89140269-89140291 GGGCCTCTGTGTGACCAGCAAGG + Intronic
1121011316 14:90521810-90521832 GGGCCTCAGTTTCCCCAGCTGGG - Intergenic
1122317541 14:100835020-100835042 TGGCCTCTGTGTCCCCAGGAGGG + Intergenic
1122366683 14:101198593-101198615 GCTCCTCTGTGCCCCCAGCCTGG + Intergenic
1122414143 14:101540777-101540799 GGGCCTCTGGGGCCACAGGCTGG + Intergenic
1122876109 14:104666124-104666146 CGGCCACAGAGGCCCCAGCGGGG + Intergenic
1124360070 15:29030068-29030090 GTGCCTCTGTGGCCTGAGCCGGG + Intronic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1126677284 15:51171491-51171513 TCGTCTCTGTGACCCCAGCGTGG + Intergenic
1128082340 15:64864142-64864164 GAGCCTCAGAGGCCCCAGCAGGG - Intronic
1128502561 15:68237455-68237477 GGGTCTCTGTTGCCCAAGCTGGG - Intronic
1129893718 15:79089185-79089207 GGGCCTCAGTGTCCCCATCTAGG + Intronic
1131480041 15:92772962-92772984 GAGCCTCTGTGGCCGCAGTCTGG - Intronic
1202952493 15_KI270727v1_random:52175-52197 CGGCCTCTATGGCCCCGGCCAGG - Intergenic
1132558039 16:581056-581078 GGGCCACTGTGCCTCCAGCCTGG + Intronic
1132598172 16:762588-762610 GGGCCCATGTGGCCCCAGGCTGG + Intronic
1132684155 16:1155295-1155317 AGGCCTCTGTAGCCTCAGGGTGG + Intronic
1132830276 16:1924589-1924611 GGTCCTCAGTTTCCCCAGCGCGG - Intergenic
1133139280 16:3732391-3732413 GGGACTCTGAGGCCCCTGCGGGG + Intronic
1133232024 16:4371495-4371517 GGGCCTCTGCGGCCCTGGAGAGG - Intronic
1133284478 16:4684177-4684199 TGGCCAATGTGGCCCCAGGGAGG - Intronic
1133839633 16:9395684-9395706 GGGTCTCTTTGGCTCCAGAGGGG + Intergenic
1134135394 16:11673639-11673661 GGGCCACTGTGTCCCCACCCTGG - Intronic
1134292628 16:12914745-12914767 GGGCCTGTGTGGCCTTAGCACGG + Intronic
1135480095 16:22814772-22814794 CTGCCTCCGCGGCCCCAGCGCGG + Exonic
1136103193 16:28010421-28010443 GGGCCTCTGTGTCCCCCTTGGGG - Intronic
1136544878 16:30949225-30949247 GCGCCTCGGGGGCCCCAGCCGGG - Exonic
1136568512 16:31083632-31083654 GGGCACCTGTGGCCCCAGGCAGG + Exonic
1138111132 16:54324889-54324911 GGGCTTGTGTGTGCCCAGCGGGG - Intergenic
1138221053 16:55250741-55250763 TGGGCTCTGTGGCTCCAGCTTGG - Intergenic
1138417079 16:56877762-56877784 TGGCCTCTGTGGCGCAGGCGTGG + Intronic
1138584410 16:57960775-57960797 GGGCTTCTGGGGCCCCAGGAGGG - Intronic
1138605887 16:58088439-58088461 GGGGCTCTGTAGCCCAAGCCTGG - Intergenic
1139515287 16:67449133-67449155 GGGCCTCAGTGCCACCAGCCTGG - Intronic
1139659302 16:68410029-68410051 GGGCCTCTCTGACCCTAACGAGG + Intronic
1141463397 16:84191517-84191539 GGGTCCCTGTGCCCCCAGCAGGG + Exonic
1141577932 16:84976675-84976697 TGGCCTCTGTGAGCCCAGCCCGG + Intronic
1141659987 16:85436594-85436616 GGACCTCGGTAGCCCCAGTGGGG + Intergenic
1142116231 16:88357491-88357513 GGGCCTCGGTGGCATCAGCCAGG + Intergenic
1142151567 16:88514719-88514741 GGGCCTTTGGTGCCCCAGGGAGG + Intronic
1142173155 16:88633371-88633393 GGCGCTCTGTGCCCCCAGTGTGG + Intergenic
1142381999 16:89738198-89738220 GGCCCTCTGTGGTCACAGAGGGG - Exonic
1142440332 16:90094090-90094112 GGGGCTCTGAGGGCCCAGCCCGG + Intergenic
1142473995 17:179445-179467 GGCCCTCTGTGGCACCAGGAGGG + Intronic
1142627998 17:1204121-1204143 GGGCATCTTAGTCCCCAGCGGGG + Intronic
1142980406 17:3668167-3668189 GGGCCTCCGTGTCCCCAGACGGG - Intronic
1143153958 17:4823881-4823903 GGGCCTCAGTGGTCCCCGCTGGG + Intergenic
1143273619 17:5693909-5693931 GGCCCTCTGTGTGCCCAGCCTGG + Intergenic
1143316685 17:6038260-6038282 GGGCCAGTGTGGCCAGAGCGGGG + Intronic
1143697493 17:8630948-8630970 GGGCCTCTGTGGCCTGGGCTGGG - Intergenic
1145127889 17:20316881-20316903 GGGCTGGTATGGCCCCAGCGGGG - Intronic
1147931444 17:43983937-43983959 TGGCGTCTGTGTACCCAGCGGGG + Intronic
1147998697 17:44375478-44375500 GGGCCTCTGTGGGCCACGCTTGG - Intronic
1148746750 17:49922591-49922613 GGGTCTTTGTGCCCCCAGCTGGG - Intergenic
1149657412 17:58317562-58317584 GGGCCTCTATTGCCCCCTCGTGG - Intronic
1149943757 17:60899182-60899204 TGGCCTCAGTGGCCACAGCTAGG + Intronic
1149990165 17:61378695-61378717 GGGTTTCTGTGGCCCCTGAGAGG + Intronic
1150623396 17:66824704-66824726 GCCCCTCTGTGGCCCCCCCGGGG - Intergenic
1151801715 17:76383223-76383245 GGGACGCTCTGGACCCAGCGGGG + Intronic
1151853525 17:76706139-76706161 GGGCCTCTGTGACGGCAGTGTGG - Intronic
1151853529 17:76706160-76706182 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853533 17:76706181-76706203 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853541 17:76706223-76706245 GGGCCTCTGTGACGGCAGAGTGG - Intronic
1151853549 17:76706265-76706287 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853553 17:76706286-76706308 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853560 17:76706328-76706350 GGGCCTCTGTGATGGCAGCGTGG - Intronic
1151853568 17:76706370-76706392 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1151853572 17:76706391-76706413 GGGCCTCTGTGACGGCAGCGTGG - Intronic
1152139129 17:78526038-78526060 GGGCCTCTTGGGGCCCAGTGGGG - Intronic
1152240803 17:79160017-79160039 GGGCCTCCCTGGCCCCAGGAAGG + Intronic
1152519296 17:80845948-80845970 GGCCCTCACCGGCCCCAGCGCGG + Intronic
1152529271 17:80907521-80907543 CGGCCTCTCTGGGTCCAGCGTGG + Intronic
1152590826 17:81211179-81211201 GGGCCTCTGTGGCCCCAGCGTGG - Intronic
1152760096 17:82103288-82103310 GGGACTGTGTGACCCCAACGGGG - Intronic
1152912457 17:83013196-83013218 GGGGCTCAGTGGCCCCAGCGTGG - Intronic
1154214845 18:12408250-12408272 GGGCCTCTGTGCCTGCAGCCAGG - Intronic
1156485528 18:37463343-37463365 GTGCCTCTGAGGGCCCAGCAAGG - Intronic
1157623010 18:49026915-49026937 GGGACACTGTGGGCCCAGGGAGG + Intergenic
1158773710 18:60552739-60552761 GGGCGGCTGTGGCCCCACCCAGG - Intergenic
1160107528 18:75992046-75992068 GGGTCTTTGTGGCCTCAGCAGGG + Intergenic
1160568639 18:79801819-79801841 GGGCTCCTGTGCCCCCAGCAGGG + Intergenic
1160771209 19:831963-831985 GGGCCCCTCTGGCCGGAGCGGGG - Exonic
1160893696 19:1393056-1393078 GAGCCTCTGTGGGACCAGTGGGG - Intronic
1160991653 19:1862793-1862815 GGGGCTCCGGGGGCCCAGCGAGG - Intronic
1161227954 19:3156054-3156076 GGGCCTGTGTGTGCCCAGCATGG + Intronic
1161714626 19:5868255-5868277 GGGGATCTGGGGCCCCAGGGAGG + Intronic
1162114650 19:8421627-8421649 GGGCCTCTGTAGGGCCAGTGAGG - Intronic
1162806183 19:13139056-13139078 GGTCCTCTGGGGCCTCAGAGAGG + Exonic
1162926569 19:13933231-13933253 GGGGCTCTGCGGCCGCTGCGGGG - Exonic
1163125792 19:15243521-15243543 GAGCACCTGTGGCCCCAGCCTGG + Intronic
1163241158 19:16064666-16064688 GGGTCTCTGGGGACACAGCGGGG + Intergenic
1163249145 19:16115878-16115900 GGGCCTCTCTGAACCCAGGGTGG - Intronic
1163828043 19:19534837-19534859 GGGCCTCTGCATCTCCAGCGGGG + Intronic
1165014566 19:32871151-32871173 AGGGCTGTCTGGCCCCAGCGGGG - Intergenic
1165161551 19:33819848-33819870 AGGCCTCCCGGGCCCCAGCGTGG - Intergenic
1165900348 19:39166769-39166791 CGGCCTCTGTGGCCCCCATGAGG + Intronic
1166551010 19:43666101-43666123 GGGTCTCTGTTGTCCCAGCTGGG + Intronic
1167171370 19:47834491-47834513 GGCCCTAAGTGGCCCCAGTGTGG + Exonic
1167272942 19:48516680-48516702 TGCCCTCTGTGGCCCCTGCCTGG - Intergenic
1167290016 19:48619376-48619398 GGGCCTCTCTGGCCCTACCCAGG + Exonic
1167369633 19:49072757-49072779 GGGGCACTGTGACCCCGGCGGGG + Exonic
1167614249 19:50523170-50523192 GGGCCTCAGTGCACCCGGCGTGG - Intronic
1168126277 19:54285382-54285404 GGGCCTCTGGAGGCCCAGAGGGG - Intergenic
1168349319 19:55667090-55667112 GGGTCTGTGTGGCCCCAGTCTGG + Intronic
1168544739 19:57240866-57240888 GGGACCCTGTGGCCCTAGCGGGG - Intronic
925205195 2:2000174-2000196 GAGCCTCTGTGGCCACAACCTGG + Intronic
927714335 2:25342242-25342264 CGGCCTCTGCGGCCCCGCCGGGG + Intronic
927949709 2:27159289-27159311 GGGCCTCTGGGGCCCAAGGGAGG - Intergenic
929001257 2:37349184-37349206 GGGCATCTTTGCCCCCAGAGGGG + Intronic
933129070 2:78650814-78650836 GGGCCTCTGTGTGCCCAGGCTGG + Intergenic
933728079 2:85437680-85437702 GGGCGTCTGGGGCCCTGGCGTGG + Intergenic
933728327 2:85438600-85438622 AGGCCTTTGTGGCCACAGAGTGG - Intergenic
934176221 2:89582211-89582233 GTGCCTGTGTGGCCGGAGCGTGG - Intergenic
934286531 2:91656572-91656594 GTGCCTGTGTGGCCGGAGCGTGG - Intergenic
935512660 2:103995267-103995289 GGGCCTCTGTTTCCCCAGGGTGG + Intergenic
937273386 2:120669552-120669574 GGGCCTCTGTTGCACCCCCGCGG + Intergenic
941784171 2:169479774-169479796 GGGCCACTGTGGCCCTCTCGAGG + Intronic
946254791 2:218434611-218434633 AGGCCTTTGAGGTCCCAGCGCGG + Exonic
947257409 2:228181389-228181411 GGTCCCCTGTAGCTCCAGCGAGG + Intronic
947506727 2:230713289-230713311 GGGCCGGTGAGGGCCCAGCGGGG - Intronic
947593583 2:231397841-231397863 GGCCTTCTGTGGCTCCAGGGTGG - Exonic
947833570 2:233159219-233159241 GGGCCTCTGTGCCCCCACAGTGG + Intronic
948449581 2:238060888-238060910 GGGCCGCCGAGCCCCCAGCGGGG - Exonic
948601748 2:239111465-239111487 GGGCCACAGTGGGCACAGCGCGG - Intronic
948797300 2:240411648-240411670 GGGCCTCTTGGGCCACAGGGTGG - Intergenic
948887674 2:240892255-240892277 GGAGCCCTGTGGCCCCAGCCTGG - Intronic
1170852506 20:20017598-20017620 TGGACCCTGTGGCCCCAGGGAGG - Intronic
1172771332 20:37384288-37384310 CGGCCACCGCGGCCCCAGCGCGG + Exonic
1173949426 20:46978697-46978719 AGGCCCCGGTGGCCCCAGGGAGG + Intronic
1174252583 20:49230728-49230750 GGGCCTCTGTGACTGCAGTGGGG + Intronic
1174414807 20:50359701-50359723 GGGGCCCTGTGGCCACAGAGAGG + Intergenic
1174540902 20:51288559-51288581 GGGCCTCTATGGCCCCTCCCTGG + Intergenic
1175368398 20:58470818-58470840 GGCTCTCTGTGGCCACAGTGGGG - Intronic
1175746193 20:61459106-61459128 AGGCCCCAGTGGCCCCAGCATGG + Intronic
1175967050 20:62664979-62665001 TGGCCTCGGTGGCCCCGGCCAGG - Exonic
1176063922 20:63184470-63184492 GGGCCTCTGTGGCCAGAGGAGGG - Intergenic
1178493691 21:33070293-33070315 GGGCCGCTGTGGCCGCAGCATGG - Exonic
1178534867 21:33403267-33403289 GGGCCTCTGCGGCTGCAGCGCGG - Exonic
1179286156 21:39978948-39978970 ATGGCTCTGTGGCCCCAGCGAGG - Intergenic
1179545781 21:42111463-42111485 GGCCATCTGTGGCCCCAGGAGGG - Exonic
1179554090 21:42161757-42161779 TGGCCTGTGTGGCCTCAGGGCGG - Intergenic
1179921067 21:44507871-44507893 TGGGCTCCGTGGCCCCTGCGTGG - Intronic
1180065727 21:45411274-45411296 TGGCCTCTTTAGCCCCAGCATGG - Intronic
1180066143 21:45413495-45413517 GGGCCTCTTTTGCCCCAGCGAGG + Intronic
1180088845 21:45523743-45523765 GGCCCTGTGTGGCCCCAGCCAGG - Intronic
1180192534 21:46172950-46172972 GGGCCTCTGGAACCCCAGCTGGG + Intronic
1181417953 22:22773633-22773655 GTGCATCTGTGGTCCCTGCGTGG - Intronic
1183411316 22:37656480-37656502 GGGCTTCTGTGGGCCAAGGGTGG - Intronic
1183422928 22:37722834-37722856 TGGCCTGTGTGACCCCAGGGAGG - Intronic
1183457557 22:37930882-37930904 GAGCCTCAGAGTCCCCAGCGGGG + Intronic
1183524795 22:38316876-38316898 GGGCCTCGGAGGGCCCAGCGGGG + Intronic
1184309819 22:43633912-43633934 GGCCCTGTGTGGCCCCTGCTAGG - Intronic
1184478940 22:44736188-44736210 GGGCCTCGCTGGCCGCTGCGTGG - Intronic
1185082639 22:48718337-48718359 GAGCCTCTGTGGGGGCAGCGGGG + Intronic
1185118906 22:48954039-48954061 AGGGCTCTGTGCCGCCAGCGAGG + Intergenic
1185249085 22:49790151-49790173 GGGCCTGTGTGGTCCCGGCTGGG - Intronic
1185249097 22:49790178-49790200 GGGCCTCTGTGGTCCCGGCTGGG - Intronic
1185273235 22:49938105-49938127 GGGCCTCTGTCCCCCCAGGAAGG - Intergenic
1185287874 22:50010582-50010604 CGGCCTCCGAGCCCCCAGCGGGG - Intronic
950130980 3:10546513-10546535 GGGGCTGAGTGGCCCCAGCGGGG - Intronic
950543344 3:13625114-13625136 TGGCCTCTGTGGCCCGGGGGTGG + Intronic
950543364 3:13625184-13625206 TGGCCTCTGTGGCCCGGGGGTGG + Intronic
950626678 3:14252637-14252659 TGCCATGTGTGGCCCCAGCGAGG + Intergenic
953575132 3:44107212-44107234 TGGCCTCTGTGGCCCAGGTGAGG - Intergenic
953675418 3:44997857-44997879 GGGCCTCTGGGGCCTCACCCAGG - Intronic
953879934 3:46686337-46686359 GAGCCTGTGTGGCCACAGCCTGG + Exonic
954109580 3:48426618-48426640 GGGACACTGTGGCCACAGCCCGG + Intronic
954594892 3:51815858-51815880 GTACCTCTGAGGCCCCAGCTGGG - Intergenic
954786784 3:53099211-53099233 GGATCTCTGTGGCACCAGCATGG - Intronic
956345276 3:68271289-68271311 GGGCTTCTGTGGGTCCAGCTGGG - Intronic
956677932 3:71753416-71753438 CGGCCACCGTGACCCCAGCGCGG + Intronic
961168603 3:124780247-124780269 GGGCCTCTGCAGACCCAGAGTGG - Intronic
961446672 3:126984322-126984344 GAGCCTCTGTCCCCTCAGCGCGG + Intergenic
961455761 3:127023127-127023149 GGGCCTCTGAGGGGCCAGCCTGG + Intronic
961632277 3:128309832-128309854 GGAACTCTGAGGCCCCAGAGTGG - Intronic
961647358 3:128399797-128399819 GGGCCTCTCTGTCCCCAGCCGGG + Intronic
962498336 3:135965512-135965534 GAGCCGCTGTGGCCTCGGCGAGG - Intergenic
965741062 3:171874986-171875008 AGGCCTTTGAGGCCCCAGGGTGG - Intronic
968092464 3:195907779-195907801 CTGCCTCTGTGGCCCCACCCTGG - Intronic
968502561 4:957769-957791 GGGCCTGTGTGGCCACGGCAAGG + Intronic
968600402 4:1506019-1506041 GGGCCTCTGTCCCCCCAGGAGGG + Intergenic
968649015 4:1753102-1753124 GGGGCTCTGGGGTCCCAGCTGGG + Intergenic
968654263 4:1771844-1771866 GGGCCTCTGTGGGCTGAGCTGGG - Intergenic
968657193 4:1783706-1783728 AGGCCTCTGTGGGGCCAGGGAGG + Intergenic
968902387 4:3437802-3437824 GGGCCTCTGGGGCCACTGCTGGG + Intronic
969702281 4:8774147-8774169 GGTCCTTTGCAGCCCCAGCGTGG + Intergenic
976504903 4:85835429-85835451 GGGCGTCTGTAGTCCCAGCTGGG + Intronic
977666258 4:99649993-99650015 GGGGCTCTGTGGCCCTGGGGGGG + Exonic
979919342 4:126478742-126478764 TGACCTCTGGGGCCCCAGAGAGG - Intergenic
985162646 4:187060677-187060699 TTGCCTCTGCTGCCCCAGCGAGG + Intergenic
985441500 4:189984782-189984804 GGGGCTCTGAGGGCCCAGCCCGG - Intergenic
985560045 5:580667-580689 GGACCTTTGCGGCCACAGCGAGG + Intergenic
985573418 5:662678-662700 CGGCCTCCCTGGCCCCAGCGCGG - Exonic
985651476 5:1109686-1109708 GGGCCTTGGTGTCCCCAGCCTGG - Intronic
985665729 5:1180749-1180771 GTGCCTCTGAGGCCCCTGTGGGG + Intergenic
986007190 5:3677902-3677924 GGGCCAGTGTGGCCTCAGCAGGG + Intergenic
986016938 5:3765833-3765855 ATGACTCTGTGGCCCCAGCATGG + Intergenic
988996974 5:36724203-36724225 GGGCCTCTGCCTCCCCAGCCAGG + Intergenic
997232194 5:132253305-132253327 GGGCCTCTCTGGGCCCAGCTAGG + Intronic
999155631 5:149455640-149455662 TGGGCTCTGTGGCACCAGCCTGG + Intergenic
999427229 5:151498819-151498841 GGGCCCCTGTGGACCCATCCTGG + Intergenic
999736732 5:154518569-154518591 AAGGCTCTGTGGCCCCAGCACGG - Intergenic
1000337306 5:160251478-160251500 TGGCCTCTGTGTGCCCAGGGAGG + Intergenic
1001434544 5:171688978-171689000 GGGCTTCTGAGGCCCAAGGGAGG - Intergenic
1001539521 5:172527550-172527572 TGGCATCTGTGGCCCCACTGAGG - Intergenic
1001894087 5:175363801-175363823 TTGGCTCTGTGGCCCCAGCATGG + Intergenic
1002385041 5:178860203-178860225 GGGCCTCTGTGGGCGCGGGGGGG + Intronic
1002388785 5:178892786-178892808 GGGCGTCTGTAGTCCCAGCTAGG + Intergenic
1002605811 5:180382059-180382081 GGGCCAGTTTGGCCCCAGCCTGG + Intergenic
1005980837 6:30835359-30835381 TGGCCTCTGTGCCCCTAGCTGGG - Intergenic
1006752666 6:36388191-36388213 GGACCTGTGGGGCCTCAGCGGGG - Intergenic
1007431913 6:41781376-41781398 GGGCGTCTGGGGCCCCAGGAGGG - Exonic
1015499506 6:133917955-133917977 GAGCCTCTGTGGCCTCAGGCAGG - Intergenic
1016671942 6:146719573-146719595 CGGGCTCTGTGTCCCCAGCTCGG - Intronic
1016890915 6:149005975-149005997 GGACCTCTTTGGCCACAGTGGGG - Intronic
1018391689 6:163346030-163346052 CTGACTCAGTGGCCCCAGCGAGG - Intergenic
1018428134 6:163701399-163701421 GTGGATCTGTGGCCCCAGGGAGG - Intergenic
1019177088 6:170165473-170165495 GGGGCTGCGTGGCCCCTGCGGGG - Intergenic
1019482867 7:1274466-1274488 GGGCATCCGTTGCCCCAGCAGGG + Intergenic
1019484212 7:1281239-1281261 GGGGCTCTATGGCCCGGGCGGGG - Intergenic
1019735068 7:2646539-2646561 AGGCTTCTGTGGCTCCAGCAAGG - Intronic
1020111563 7:5450909-5450931 GGGCCTCTCAGCCCCCAGCAAGG + Intronic
1020259289 7:6521636-6521658 GTGACTCTGTGTCCCCAGCATGG + Intronic
1024970912 7:55069474-55069496 GGGCCTGTGAGGCCCCATGGTGG - Intronic
1024993507 7:55254471-55254493 GCACCCCTGCGGCCCCAGCGCGG + Intronic
1029127345 7:98303676-98303698 GTGCCTCTGGGGGCCCAGCATGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030138609 7:106284267-106284289 GGTCCTCTGCGGCTCCGGCGCGG - Intronic
1030754695 7:113273219-113273241 CAGCCTCTGTGGCTCCAGCCGGG - Intergenic
1030976140 7:116125966-116125988 GGGCCTCTGTGGTATCAGGGTGG - Intronic
1033755905 7:144398354-144398376 GTTTCCCTGTGGCCCCAGCGGGG - Exonic
1035221388 7:157408447-157408469 GAGCCTGTGTGTCCCCAGAGGGG - Intronic
1035230489 7:157463029-157463051 TGTCCTCTGTGGCAGCAGCGTGG + Intergenic
1035242236 7:157539778-157539800 GGACCTGTGGGGCCCCAGAGAGG - Exonic
1036076428 8:5507381-5507403 GGGCCTCTGTGGCTGCAGAAAGG - Intergenic
1036750272 8:11439476-11439498 GCCCCACTGTGGCCACAGCGTGG - Intronic
1037777954 8:21848097-21848119 GGGCCTCAGTGGAACCAGCAGGG - Intergenic
1038283138 8:26183503-26183525 GGGCCTGTGTGGCCAGGGCGAGG - Intergenic
1039087926 8:33798532-33798554 GGGCCCCTGTAGTCCCAGCTTGG - Intergenic
1039268415 8:35854241-35854263 GGGCTGCTGGGGACCCAGCGAGG - Intergenic
1039463248 8:37763121-37763143 GGGCGTCTCTGGCCTCCGCGGGG - Intronic
1039478524 8:37854830-37854852 TGGCCTCTCTGGCCCTACCGGGG + Intergenic
1039552075 8:38450577-38450599 GGGAGCCTGTGGCCCCAGCACGG - Intronic
1040016758 8:42706479-42706501 GAGCATCTGTGCCCTCAGCGTGG + Intronic
1047111485 8:121794082-121794104 TGCCCTCTGAGGCCCCAGAGAGG + Intergenic
1049006648 8:139859890-139859912 AGGGGTCTGTGGCCCCAGAGGGG - Intronic
1049204601 8:141357900-141357922 TGCCCTCTGTGTCTCCAGCGGGG - Exonic
1049271523 8:141698667-141698689 GGTCCTCTGTGGCTCCACCACGG - Intergenic
1049573929 8:143381971-143381993 GAGCCCCTGGGGCCCCAGAGGGG + Intronic
1049605203 8:143526107-143526129 TGCCCTCTGTGGCCCCACTGGGG - Intronic
1049661719 8:143822503-143822525 GGGCTTGTGTGGCCCGAGAGAGG - Intronic
1051355464 9:16236011-16236033 GGGGCTCTCTGGCCACAGTGTGG - Intronic
1056965948 9:91163013-91163035 GGGTCTCTGTGGCGACAGGGAGG - Intergenic
1060814657 9:126628209-126628231 GGCCCTCTGAGTCCCCAGCCAGG - Intronic
1060962074 9:127688114-127688136 GGGACCCTGTGGCCCCTGGGAGG - Intronic
1061160958 9:128893475-128893497 GAGGCTCTGAGGCCCCAGTGAGG + Intronic
1061444524 9:130630376-130630398 TGGCATCTGTGGCCTCAGCTTGG + Intronic
1061502885 9:131013835-131013857 GGGACCCTGTGGCCCCTGAGGGG + Intronic
1061507039 9:131037209-131037231 TGGCCTCTGTGTCCCCACCATGG - Intronic
1061584342 9:131556268-131556290 GGGGCTCTGTGGACCCACTGGGG - Intergenic
1061856424 9:133444128-133444150 GGCCCTATCTGGCCTCAGCGGGG - Intronic
1062096181 9:134705165-134705187 GGGTGTCTGTGGCCCCACAGAGG + Intronic
1062119373 9:134825917-134825939 GTCCCTCCATGGCCCCAGCGGGG + Intronic
1062266378 9:135688252-135688274 GTGCCTCTCTGGTCCCAGGGAGG + Intergenic
1062285863 9:135772222-135772244 GGGCCTCTGTGGGTACAGTGAGG - Intronic
1062519544 9:136951990-136952012 GGGCCTCTGAACCCCCAGCATGG + Intronic
1062591450 9:137276580-137276602 CGGCCTCTGTGGGACCAGAGCGG - Intergenic
1062717232 9:138017326-138017348 GGGCTTCTGTGGCCTGAGCGGGG + Intronic
1185506720 X:637154-637176 GGGCGTCTGTGGCCTCAGTGAGG + Intronic
1197728387 X:129791479-129791501 GGGCCTCTGATGCCCCAGTCGGG + Intronic
1197776255 X:130120586-130120608 GGGGCTCTGTGGGGCCTGCGAGG + Intergenic
1200684222 Y:6245393-6245415 GGCCATCTGCGGGCCCAGCGGGG - Intergenic
1201048411 Y:9908993-9909015 GGCCATCTGCGGGCCCAGCGGGG + Intergenic