ID: 1152591792

View in Genome Browser
Species Human (GRCh38)
Location 17:81217183-81217205
Sequence GTGGGCACACAGCTGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 481}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152591781_1152591792 14 Left 1152591781 17:81217146-81217168 CCAGAGTGAATAATGATCTAGGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG 0: 1
1: 0
2: 4
3: 68
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152591792 Original CRISPR GTGGGCACACAGCTGGGGCA AGG Intronic
900000920 1:14518-14540 GAGGCCACACAGCTGGGGCGGGG - Intergenic
900020634 1:185039-185061 GAGGCCACACAGCTGGGGCGGGG - Intergenic
900151756 1:1181980-1182002 GTGCACACAGAGCTGGGGCAGGG + Intronic
900330778 1:2133495-2133517 GCGGGCGCACAGCTGGGGAGGGG - Intronic
900560877 1:3305498-3305520 GTGGGCAAACAGATGGGAAATGG - Intronic
900611096 1:3544964-3544986 GTGCTCACCCAGCTGGGGTAGGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900869113 1:5289275-5289297 GTGGGAGCACAGGTGGGGCCAGG - Intergenic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
901860486 1:12071209-12071231 GTGGGCAGATAGTTGGGGCCAGG + Intronic
902060167 1:13635183-13635205 GGGGACACTCAGCTGGGGGATGG + Intergenic
902395917 1:16132494-16132516 GTGGGCACAGATATGGGGGAAGG + Intronic
902465206 1:16613270-16613292 GCGGGCGCACAGCTGGGTCGAGG - Intronic
902809685 1:18881014-18881036 GTGAGCACACACCAGGGACAAGG - Intronic
903018477 1:20377236-20377258 GAGGTCACACAGCTGGGACCTGG - Intergenic
903141516 1:21342036-21342058 GGGGGCACAGAGCCGGGGAATGG + Intronic
903499949 1:23795280-23795302 GTGGGGAAACAGCTGAGGGAAGG - Exonic
903516068 1:23911837-23911859 GTGGTTACAGAGCTGGGGCCAGG + Intronic
903742903 1:25568610-25568632 GTGGCTACAGAGCAGGGGCAAGG - Exonic
904400077 1:30250464-30250486 GAGGTCACGCAGCTGGGGAATGG - Intergenic
904470948 1:30735898-30735920 ATGGGCACATAGGTGGGGCAAGG + Intronic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
906790703 1:48656541-48656563 GTGGGGACTCAGCAGGGGCCTGG + Intronic
906950438 1:50330958-50330980 GTGGGAAGACGGCTGGGGCAGGG - Intergenic
907260938 1:53218246-53218268 GTGGGCACCTGGCTGGGGCGAGG - Intronic
907269263 1:53281075-53281097 AAGGGCACACAGCTGGGAAATGG - Intronic
907314731 1:53560999-53561021 GGGGGCACACAGTAGGGGCTTGG - Intronic
908027516 1:59968495-59968517 GTGGGCACACAGCCTGAACAGGG + Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912354304 1:109042265-109042287 GCGGGCCCAAAGCTGGGGCGGGG + Intergenic
912960294 1:114190060-114190082 GTGAGAACACAGGTAGGGCAGGG - Intergenic
913051782 1:115123016-115123038 GTTACCACAGAGCTGGGGCAAGG - Intergenic
913939006 1:125085874-125085896 GTGGGCAAAAAGCCGAGGCAGGG + Intergenic
913939353 1:125087115-125087137 GTGGGCAAAAAGCCGAGGCAGGG + Intergenic
914928129 1:151906518-151906540 GTGGGCACACAGCGTGGGACTGG + Intronic
916056690 1:161073194-161073216 GTGGGGACACCGGTGGGGCCGGG + Intronic
916205048 1:162308309-162308331 GTGGGCACACAGGTGGAGTTGGG + Intronic
916205137 1:162308935-162308957 ATGGTCACACAGCTGCTGCATGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916794000 1:168148685-168148707 GTGGGCACAAAGAGAGGGCAAGG + Intergenic
917629599 1:176879102-176879124 ATGGTCACAGGGCTGGGGCATGG + Intronic
918210792 1:182349317-182349339 GTAAGCACACAGCTGGGCCTGGG - Intergenic
919798747 1:201337878-201337900 GTGGGCACAGAGCAGAGGCTTGG + Intergenic
920030311 1:203033748-203033770 GTGGGCAGACAGCTGAGGTCAGG + Intronic
920088158 1:203432983-203433005 GTGGACAGAGAGCTGGGCCATGG + Intergenic
920438194 1:205961669-205961691 CTGGGCCCAGAGCTGGGGGATGG + Intergenic
920955623 1:210618170-210618192 GTTGGCACAGAGATGGGACATGG + Intronic
921286856 1:213616734-213616756 GTGGGCACCCAGGGTGGGCAGGG + Intergenic
921939887 1:220828420-220828442 GTGGAGCCACAGCTGAGGCATGG - Intergenic
922465888 1:225845448-225845470 GTGGGCTCCCAGCATGGGCAGGG - Exonic
922476668 1:225911415-225911437 GTGGGCACCCAGCCGGGGCTGGG + Intronic
923198992 1:231693926-231693948 GTGTGCCCACTGCTGGGGAAAGG - Exonic
923830533 1:237550637-237550659 GTGCGCACGCTGCTGGGGTACGG + Exonic
924608337 1:245553923-245553945 GTGGGGACACTGCTGGGAGAGGG + Intronic
1062921916 10:1286627-1286649 GTGGTCATGCAGCTGGGGGAAGG - Intronic
1062928948 10:1339947-1339969 GTGGGCTCACAGCTGGGGGTGGG + Intronic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1064012213 10:11743630-11743652 GGGTGCCCACAGCAGGGGCAGGG + Intronic
1065791358 10:29263529-29263551 ATGGGCAGACAGCTGGGCCATGG - Intergenic
1065890698 10:30118771-30118793 GTGGCCACAGAGGTGGGGCCAGG - Intergenic
1066243644 10:33561504-33561526 GTGGGCACTCAGATGGGGGAAGG + Intergenic
1066482413 10:35809780-35809802 GTTGGCACACAGCTGAGTCACGG - Intergenic
1067069992 10:43124305-43124327 GTGTGCACACTGCTGGGGCGTGG + Intronic
1067074980 10:43172973-43172995 AGGGGCACATAGCTGGGCCAGGG + Intronic
1067291522 10:44946992-44947014 CTGGTCACACAGCTGGTGAAGGG - Intergenic
1067302973 10:45031342-45031364 GTGGGGGCACAGCTGGGGGGTGG - Intergenic
1067712245 10:48658600-48658622 GTGGGTACACAGCTGGGAACAGG + Intergenic
1068142915 10:53028764-53028786 GTGGGTGCACGGCAGGGGCAAGG - Intergenic
1069604434 10:69730760-69730782 GTTGGCACAAAGCTGGGGGTGGG + Intergenic
1069788833 10:71006479-71006501 GAGGCCACACAGCTTGGGCAGGG + Intergenic
1069832512 10:71289839-71289861 GTGGGCAGACATCCGGGGCTGGG + Intronic
1069847453 10:71382486-71382508 TTGAGCACACAGCTGGGCAAGGG - Intergenic
1069900698 10:71705169-71705191 GTGGGCACAGGCCTGGGTCAGGG + Intronic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070311359 10:75276122-75276144 GTGGGGACGCAGGAGGGGCAGGG + Intergenic
1070559084 10:77552323-77552345 GAGGTCACACAGCTGGGAAATGG - Intronic
1070864913 10:79702495-79702517 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1070878702 10:79840627-79840649 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071105552 10:82089951-82089973 GAGGGCAAAGAGCTGGGGCAGGG - Intronic
1071631807 10:87224716-87224738 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1071645261 10:87356937-87356959 GCGGCCACACTGCAGGGGCAGGG - Intergenic
1072781584 10:98255431-98255453 TTGGCCACACAGCTGGGAAATGG + Intronic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1073450231 10:103604751-103604773 GTAGGTACAGGGCTGGGGCAGGG - Intronic
1073664009 10:105509642-105509664 GTGGGCAGAAAGCTAGGGAATGG + Intergenic
1075521306 10:123145248-123145270 GTGGGCACGGGGCTGGGGCAAGG - Intergenic
1075800710 10:125151905-125151927 GTGGGCACGGAGCGGGGGGAGGG + Intronic
1075959839 10:126558842-126558864 GTGGGCACTGAGCTGGGCCCTGG - Intronic
1076258780 10:129049626-129049648 GCGGTCACACAGCTGGTGAAGGG + Intergenic
1076491662 10:130866006-130866028 CTGGGCTCACATCTGTGGCAGGG - Intergenic
1077156050 11:1092220-1092242 GTGGGAACAGAGCAGGGGCGAGG - Intergenic
1077222042 11:1422132-1422154 GGGGGCCCACAGCTGGGGCTGGG - Intronic
1077231975 11:1461779-1461801 GTGGGGGCGCCGCTGGGGCAGGG + Intronic
1077341116 11:2026769-2026791 GTGGGAGCGCAGCCGGGGCAGGG + Intergenic
1077453356 11:2663970-2663992 GTGGGCAGAGAGCTTGGGGATGG - Intronic
1077467776 11:2741765-2741787 GCGCGCAGACAGCTGGGGCTGGG + Intronic
1077478239 11:2801048-2801070 GTGGGTGCAGGGCTGGGGCAGGG + Intronic
1077488952 11:2851653-2851675 CTGAGCACCCAGCTGGGGCCAGG - Intergenic
1077505836 11:2929641-2929663 GGGGCCGGACAGCTGGGGCACGG - Intergenic
1078055192 11:8003553-8003575 GTGGGCAGGCAGCTGGGGGCGGG - Intergenic
1078335965 11:10463409-10463431 ATGAGCACACTGCTGGGGCTGGG - Intronic
1078740213 11:14059313-14059335 CTGGGCACAAAGTTGGGTCAAGG + Intronic
1079081393 11:17415723-17415745 CTGCACAAACAGCTGGGGCAAGG + Intronic
1080525726 11:33115009-33115031 CTGGGCACATAGCAGAGGCAGGG + Intronic
1080690078 11:34549130-34549152 CAGGGCACACAGTTTGGGCAGGG - Intergenic
1080723799 11:34874885-34874907 GTGGGCACAGAATAGGGGCATGG - Intronic
1081152270 11:39647602-39647624 GTGGCAACTCAGCTGGGGGATGG - Intergenic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1083726691 11:64632108-64632130 GGTGGCTCACAGATGGGGCAAGG + Intronic
1083779427 11:64910271-64910293 GTGGGAGAAGAGCTGGGGCAGGG + Intronic
1083808818 11:65090857-65090879 GTGGGACCACAGCTGGGCCTTGG - Intronic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084274391 11:68044099-68044121 GTGGGCAGTCAGCGGGGGCTGGG - Intronic
1084648733 11:70475690-70475712 GTGGGTGCACTGCTGGGCCAGGG + Intronic
1084651441 11:70491770-70491792 GAGGGCACACAGCTGGAAAAGGG - Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085026979 11:73242086-73242108 GTGTGTAGAGAGCTGGGGCAAGG + Intergenic
1085195688 11:74670323-74670345 GTGGGCACTCAGCAGAGTCAGGG - Intergenic
1085461958 11:76699508-76699530 GGGGGCACACATCTGAGGCAGGG - Intergenic
1085472816 11:76769026-76769048 GTGGGCAGGAAGCAGGGGCATGG + Intergenic
1085820093 11:79783240-79783262 GTGGGGAGACAGCTGTGGAAGGG + Intergenic
1087598540 11:100284116-100284138 GTGGGGCCACTGCTGGGGAATGG + Intronic
1087671643 11:101113867-101113889 GTAGGCTAGCAGCTGGGGCAAGG - Intronic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1088815530 11:113418254-113418276 GTGGGCATCCAGCTGGGGTGTGG + Intronic
1089677496 11:120099566-120099588 GTGGGCACACGGTTGGAGCAGGG + Intergenic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090425186 11:126602669-126602691 GCGGATCCACAGCTGGGGCAGGG - Intronic
1090986522 11:131771630-131771652 GTGTGTACACAGCTGGTGCTTGG - Intronic
1091044749 11:132315653-132315675 GAGGGCACATGGCTGGGCCATGG - Intronic
1202824101 11_KI270721v1_random:81958-81980 GTGGGAGCGCAGCCGGGGCAGGG + Intergenic
1091374008 12:14633-14655 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1092261546 12:6955795-6955817 GAGGGGAGGCAGCTGGGGCAGGG - Intronic
1092290356 12:7156621-7156643 GTGGGCACACAGCTGCACAAAGG - Intronic
1092917130 12:13199183-13199205 CTGGGCAGACCGCTGGGGAAAGG + Intronic
1093184344 12:16002873-16002895 TTCAGCACAAAGCTGGGGCAGGG - Intronic
1094432806 12:30388548-30388570 GTGGGCACATAGCATGGGCCAGG + Intergenic
1094553879 12:31478605-31478627 GTGGGAAGACAGCTTGAGCACGG + Intronic
1095672276 12:44875788-44875810 GTGGCCGCAGAGCTGGGGCTGGG - Intronic
1095941885 12:47732807-47732829 GTGGGCAGTGTGCTGGGGCAGGG - Intergenic
1096186030 12:49581108-49581130 GTGTGCAGAGAGCAGGGGCAGGG + Intronic
1096242369 12:49966243-49966265 GTGGGGACACTGGTGGGCCAAGG - Intergenic
1096798023 12:54090705-54090727 GTGGGGCCACTGCAGGGGCAGGG + Intergenic
1097190154 12:57215963-57215985 GGGGGCAGAGAGCTGGGGCTGGG + Intergenic
1098084873 12:66831638-66831660 GTGGTCACACAGCTGGAAAATGG + Intergenic
1100371991 12:93976870-93976892 GTAAGCACACAGCAGGGCCAAGG - Intergenic
1102035609 12:109769031-109769053 GTGGTCACGGAGCTGGGGCCGGG + Exonic
1102119549 12:110429636-110429658 GTGGGGACGCAGCAGGTGCAGGG + Intergenic
1102504503 12:113375047-113375069 GTGGGCACACACGTGGGGAGTGG + Intronic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1102973564 12:117190181-117190203 GTGGGCGCGCAGCCGGGGCGCGG + Intronic
1104048964 12:125183925-125183947 AGAGTCACACAGCTGGGGCATGG + Intergenic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1104795187 12:131512243-131512265 GTTGGCCCTCAGCTGGGGCCTGG - Intergenic
1106293603 13:28389549-28389571 GGGGGCCCAGAGCTGGGGCCCGG + Intronic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1117339882 14:54783903-54783925 GTGAGCACTCAGCGGGGTCAGGG + Intronic
1118355539 14:65010556-65010578 GTGGGCAGACAGATGGGGTGGGG - Intronic
1119567621 14:75641957-75641979 GTGGCAACATAGATGGGGCAGGG + Intronic
1122138893 14:99650389-99650411 GTGGACTCACAGGTGGGGGAGGG + Intronic
1122174318 14:99905911-99905933 GGGGGCACACACCTGGGCAAAGG - Intronic
1122601924 14:102925755-102925777 GTGGGAACAGCGCAGGGGCAGGG + Intronic
1122856149 14:104561129-104561151 TGGGGCAGGCAGCTGGGGCAGGG - Intronic
1123033092 14:105460347-105460369 GTGCCCACAGAGCTGGGGAAAGG - Exonic
1123706630 15:22955505-22955527 GTGGGCAGGCAGCAGGGGCTGGG + Intronic
1123723780 15:23082559-23082581 GTGGGCACAGTGTTGGGGCTAGG + Intergenic
1124244345 15:28056904-28056926 GGGGGCAGGCAGCTGGGGCAGGG - Intronic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1126096747 15:45095630-45095652 CTGGTCTCAGAGCTGGGGCAGGG - Intronic
1126424462 15:48511845-48511867 GAGAGCACTCAGCTGGGGCAAGG - Intronic
1128112943 15:65087942-65087964 GATGGCCCACAGCTGGGGGAGGG + Intergenic
1128702443 15:69814114-69814136 CCGGGCACACAGCGGGGGCTGGG - Intergenic
1128728651 15:70006221-70006243 TAGGGCACACAGCCAGGGCAAGG + Intergenic
1129077507 15:73009656-73009678 AGGGGACCACAGCTGGGGCATGG - Intergenic
1129198260 15:73983698-73983720 CTGGGCACTCAGCTGGGGACCGG + Exonic
1129272205 15:74424929-74424951 TTGGGCCCACAGCCAGGGCAGGG + Intronic
1129310912 15:74708391-74708413 GGGGCCACACACCTGAGGCAGGG - Intergenic
1129333507 15:74839535-74839557 GTGAGCAGACGGCTGGGGCTGGG - Intronic
1129391451 15:75222989-75223011 GGGGGCACATAGCTGGGGGTGGG - Intergenic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1129519979 15:76179433-76179455 GGGGGCACACAGCTAGTCCAGGG + Intronic
1129540164 15:76342134-76342156 ATGGGGACACAGGTGGGGCGTGG - Exonic
1129878159 15:78990444-78990466 GGGGCCACACAGCTGCGACAAGG - Intronic
1130195527 15:81777159-81777181 CTGGGAACATGGCTGGGGCATGG - Intergenic
1130313031 15:82771474-82771496 GTGGGGTTACAGCTGGGGTAGGG - Intronic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131748618 15:95479896-95479918 GTGGGCATACTGCAGGGGAATGG + Intergenic
1132452590 15:101976422-101976444 GAGGCCACACAGCTGGGGCGGGG + Intergenic
1132454310 16:14204-14226 GAGGCCACACAGCTGGGGCGGGG - Exonic
1132578969 16:676510-676532 GTGGGCAGGCGGCAGGGGCACGG + Intronic
1133039482 16:3052761-3052783 CTGGCCACACCGGTGGGGCAAGG + Intronic
1133043326 16:3072394-3072416 CTGGCCACACGGGTGGGGCAAGG + Intronic
1134279068 16:12802130-12802152 GAGGGCAAACCCCTGGGGCATGG + Intronic
1136573646 16:31110785-31110807 GTGGGCAGACATCTGGGGCAGGG + Intronic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1137585323 16:49660808-49660830 GGAGACACAGAGCTGGGGCAGGG + Intronic
1138247740 16:55479720-55479742 GTGGGCACACAGCGTGGGGGAGG + Intronic
1138345225 16:56316416-56316438 GTGGGCACACAGATGGCTCAGGG - Intronic
1138529415 16:57627013-57627035 GTGGGCCAATACCTGGGGCAGGG - Intronic
1138532283 16:57640931-57640953 GTGGGAACACAGATAGGGAAGGG + Intronic
1138533426 16:57647172-57647194 GTTGCCACACAGATTGGGCAGGG - Intronic
1138549580 16:57740214-57740236 GTGGGCCCAAACCTGGGCCAGGG - Intronic
1138550279 16:57744020-57744042 ATGGGAACAGAGCGGGGGCAGGG + Intronic
1139424285 16:66869534-66869556 GTGAACACACAGCTGGGGGAGGG + Intronic
1139426160 16:66881019-66881041 GGGGGCACCCAGCTGGGGTACGG + Intronic
1139597444 16:67966650-67966672 GTGGGCACTGAACTGGGGAAGGG + Intronic
1140939504 16:79708192-79708214 GGTGGCACACAGGTGGGGCTGGG - Intergenic
1141148255 16:81547069-81547091 GTGGGCACACAGATGTGGGATGG + Intronic
1141268894 16:82521360-82521382 CGGGGCTGACAGCTGGGGCATGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142217459 16:88836854-88836876 GTGGTCACTCGGCTGGGGCTGGG + Intronic
1142262699 16:89050277-89050299 GGCGGCACACACCCGGGGCATGG + Intergenic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1143882032 17:10037002-10037024 GGGTTCACACAGCTGGGGCCGGG - Intronic
1144199526 17:12927648-12927670 GTGGGCAGGAAGCTGGGTCATGG - Intronic
1145302100 17:21648017-21648039 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1145328446 17:21850801-21850823 GTGGGCCCACAGAAGGGGAAAGG - Intergenic
1145348210 17:22055299-22055321 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1145415370 17:22710085-22710107 GTGGGCCCACAGAAGGGGAATGG - Intergenic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146788880 17:35740411-35740433 GTGGGCAGACACCTGCTGCAGGG + Exonic
1147550340 17:41437446-41437468 GTGGGCCCACAGGTGGTGCAGGG + Exonic
1147675491 17:42202368-42202390 GGGGACACACAGCTGGGGAGGGG + Exonic
1147690070 17:42309434-42309456 GGGGGCACACAGCTGGGGAGGGG - Exonic
1147960182 17:44162524-44162546 GTGGCCACACAGCACTGGCAGGG - Intergenic
1148236630 17:45973519-45973541 GAGGGAACACTGCTGGGGCTGGG + Intronic
1148733301 17:49850984-49851006 GTGGGCGCACAGCAGGGACGAGG + Intergenic
1148742107 17:49898726-49898748 GTGGGCACACAGCCTGGCCTTGG - Intergenic
1148772678 17:50076263-50076285 GTGAGGATTCAGCTGGGGCAGGG + Intronic
1148791774 17:50177206-50177228 GTGGGACCACAGCGGGGACAGGG - Intergenic
1149610690 17:57955857-57955879 GAGGACGCACAGCTGGGGCTTGG + Intergenic
1149996907 17:61410412-61410434 GTGGGCAGCCTGTTGGGGCAGGG - Intergenic
1150005009 17:61463895-61463917 GTGGGCCAACAGCTGAAGCAGGG - Intronic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150444907 17:65221258-65221280 GAGGGCACAGAGTTGGGGGAGGG + Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1151205710 17:72505116-72505138 ATGGACACACAGCTGTGGGACGG + Intergenic
1151561582 17:74872779-74872801 GTCGGAGCAGAGCTGGGGCAGGG - Intronic
1151784884 17:76270555-76270577 GTGGGGACACAGGAGGGCCAGGG + Exonic
1151930688 17:77229849-77229871 ATGTGCCCACAGCTGGGACAAGG + Intergenic
1152582142 17:81170875-81170897 GTGGGTACAGGGCTGGGGCTGGG - Intergenic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152644221 17:81461387-81461409 GGGTGCACATAGCTGGGGCTGGG - Exonic
1152721108 17:81924204-81924226 GTGGGCACTCACCCGGGGCAGGG - Intronic
1153925445 18:9831619-9831641 GTGGGCACGGCGCTGTGGCATGG + Intronic
1154491326 18:14924591-14924613 GGGAGCACACAGCAGGGGCTGGG + Intergenic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155202187 18:23526993-23527015 GTGGGCACACAGGAGGGGAGTGG + Intronic
1155868389 18:30995165-30995187 GTGGGCACACAGGTGAGGAAAGG - Intronic
1156472213 18:37384406-37384428 GAGGACACATAGGTGGGGCAGGG + Intronic
1158029730 18:52948888-52948910 TTGGTCACACAGCTAGGGAATGG + Intronic
1158511981 18:58098528-58098550 GTGGTCACACAGCTGGAAGATGG - Intronic
1158617556 18:59002031-59002053 GTGGCCACACAGCTGGTGATTGG - Intergenic
1158850724 18:61493584-61493606 GTGGGCACACATGTGGGGTCAGG - Intronic
1159941359 18:74411395-74411417 GTGGGCACCCAGGAGGGGCTAGG - Intergenic
1160103375 18:75945451-75945473 GTGGGGACACAGCTTTGTCATGG + Intergenic
1160123205 18:76148426-76148448 ATGGGCACTCACCTGGGGGAGGG - Intergenic
1160218595 18:76956197-76956219 GGGGGCACACAGCTGTGCCCTGG - Intronic
1160427877 18:78790708-78790730 GTGGACACACAGATGGGGAGCGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160535036 18:79587098-79587120 GTGGACACACATCTGTGGGAGGG + Intergenic
1160748561 19:722940-722962 GTGGGGTCACCTCTGGGGCATGG + Intronic
1160753276 19:745291-745313 GAAGGGACACAGCTGGGCCAAGG - Intronic
1160804612 19:986750-986772 GTGGGCACAGAGATGTGCCAGGG + Intronic
1161068892 19:2250817-2250839 GTGGGCACGCGGCTGGCTCAGGG - Intronic
1161170565 19:2810531-2810553 GGCGGCACACAGCTGGGGCCTGG + Intronic
1161197450 19:2994863-2994885 GTGGGCAGTGAGCTGGGGTAGGG - Intronic
1161203174 19:3027524-3027546 GAGGGCACATAGCAGAGGCAGGG - Intronic
1161320496 19:3638583-3638605 GTGGGCACAAGGCCGGGGAAGGG + Intronic
1161440325 19:4287849-4287871 GTTGGGTCACAGCTGGTGCATGG - Intronic
1161558830 19:4959419-4959441 GTCGTCACACAGCTGGGCGAGGG - Intronic
1161962305 19:7529512-7529534 GTGGGCACCCAGATGGGGGTGGG - Intronic
1162176261 19:8832482-8832504 GTGGGCACAAAGTTGGGCCCTGG + Exonic
1162267501 19:9587893-9587915 GTGGGCACACACCTGGACAAGGG + Intergenic
1163115679 19:15187560-15187582 GTGGGGCCACAGCTGGGGGCGGG - Intronic
1163325596 19:16601108-16601130 GAGGTCACACAGCTGGGTCTGGG + Intronic
1163420925 19:17213227-17213249 GTGGCCACAAATCTGGGACAAGG + Exonic
1163703857 19:18800992-18801014 GAGGGGACGCAGCTGGGGCACGG - Intergenic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1166741062 19:45115088-45115110 CTGGGGACACAGCAGTGGCAAGG + Intronic
1167043705 19:47038014-47038036 GTGGCAACCCAGATGGGGCAGGG + Intronic
1167072465 19:47228653-47228675 ATGGGCACACAGGAGGGACAGGG + Intronic
1167423588 19:49417768-49417790 GTGGGCACACAGCTAAGTCTCGG + Exonic
925303221 2:2831725-2831747 GAGGACACAGAGCTGAGGCAGGG + Intergenic
925384726 2:3454233-3454255 GAGGGCACACAGGTAGGACACGG - Intronic
927492712 2:23531215-23531237 GTGGCCAGACAGCTGGGACCAGG + Intronic
928023385 2:27721171-27721193 GTGGGCAGGGAACTGGGGCAGGG + Intergenic
928393192 2:30924923-30924945 GTGAGCACAGAGCATGGGCATGG - Intronic
928612944 2:33008880-33008902 GTGGGGACACAGCCAGTGCAAGG + Intronic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
932420465 2:71598466-71598488 GGGGCCACAAAGCTGGAGCAGGG - Intronic
932466641 2:71928424-71928446 GCTGGCAAACAGCTGGGGCTTGG - Intergenic
936021873 2:109001350-109001372 GTGGGGTCACAGTAGGGGCAGGG + Intergenic
936568803 2:113598896-113598918 GAGGCCACACAGCTGGGGCGGGG + Intergenic
936950335 2:117971650-117971672 GAGGTCACACAGCTGGGAAATGG + Intronic
937226897 2:120375363-120375385 ATCGGCCGACAGCTGGGGCAAGG - Intergenic
937434274 2:121867362-121867384 GGGGGCACTCAGCTGGGGTATGG + Intergenic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938178710 2:129160834-129160856 GGGAGCACACAGGTAGGGCAAGG + Intergenic
938678064 2:133658568-133658590 GTGGGCACACAACTCAGGCTTGG + Intergenic
938919798 2:135985235-135985257 CTGGCCCCACTGCTGGGGCAAGG + Intronic
939023967 2:136989762-136989784 GTGGGCAGCCAGCTGGGAGAGGG + Intronic
939275133 2:139990672-139990694 GTGGGCACACAGCACGGGATTGG - Intergenic
939636500 2:144589527-144589549 GAGGGCACACAGCTAGCACATGG + Intergenic
940035901 2:149311688-149311710 ATGGACACAGAGCTGTGGCATGG + Intergenic
940704374 2:157085414-157085436 GTAGGCAAACAGCAGTGGCATGG - Intergenic
940892864 2:159051997-159052019 TAGGGCATACAGCTGGGGAATGG + Intronic
944314125 2:198267176-198267198 GTGGGCAGAGGGCTGGGGAACGG + Intronic
946327543 2:218992591-218992613 CTGGGACCTCAGCTGGGGCAGGG + Intronic
946353272 2:219169286-219169308 GTGAGCACAGAGCAAGGGCAAGG - Exonic
946707795 2:222475831-222475853 AAGGGCACACAGATGGGGCCTGG - Intronic
947634342 2:231672630-231672652 GGTGGCAGACAGCTGGGCCACGG + Intergenic
947722142 2:232376693-232376715 GTGGGCACTGAGCTGGAACATGG - Intergenic
948220570 2:236266135-236266157 GGGGCCCCAGAGCTGGGGCAGGG - Intergenic
948743009 2:240060507-240060529 GTGGGCAGGCAGGTGGGCCATGG - Intergenic
948815503 2:240508165-240508187 CTGGGCACACAGCAGGGAGAAGG - Intronic
948867725 2:240784013-240784035 CTGGGCACTCAACTCGGGCAGGG - Intronic
1168763179 20:363620-363642 GCTGGCACACAACAGGGGCAGGG - Intronic
1169202660 20:3720348-3720370 CTGGACACACAACTGAGGCAAGG - Intergenic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1170579392 20:17686448-17686470 GTGGTGTCACTGCTGGGGCAAGG + Intergenic
1171558166 20:26096764-26096786 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1171849856 20:30300535-30300557 GTGGGGACACTGCAGGGGCAGGG + Intergenic
1171971450 20:31567440-31567462 GAGGGCAAACAGTGGGGGCAGGG - Intronic
1172011608 20:31849072-31849094 GTGGGCACAGATGTGGGACATGG - Intronic
1172272894 20:33664328-33664350 GATGGCAGTCAGCTGGGGCAAGG + Intronic
1172501970 20:35434009-35434031 GTGGGCACACAGCAGGTGGGTGG + Exonic
1172520766 20:35564048-35564070 GTAGGGACACAGCTGGGCCTGGG + Intergenic
1172781002 20:37437099-37437121 GTGGCCAGACAGCTGGGTCTGGG - Intergenic
1172870499 20:38132599-38132621 GGGGTCACACAGCGGGGGAATGG + Intronic
1174111913 20:48203028-48203050 GAGGCCACACAGCTGCTGCATGG - Intergenic
1174146381 20:48455379-48455401 GTGGTCACACCAGTGGGGCAGGG + Intergenic
1174169222 20:48605793-48605815 GAGGCCACACAGCTGCTGCATGG + Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1175259200 20:57664146-57664168 GTGGGAACACGGCTGGGGCCAGG - Intronic
1175832826 20:61976461-61976483 GTAGGCCCACAGCTGGAGCTGGG + Intronic
1175890412 20:62313463-62313485 GTGGGCACAGGGCTGGGTCAGGG + Intronic
1176102376 20:63370367-63370389 GTGGGCCCCCAGCTGGGGCCAGG - Intronic
1176144579 20:63559878-63559900 GTGGGAACACAGGTGAGGCCAGG - Intronic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176652833 21:9565850-9565872 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1177851884 21:26358607-26358629 GTTGGCACACGGTTGGGGAAAGG + Intergenic
1178341208 21:31786784-31786806 GTGGGGACACATCTGGCACATGG + Intergenic
1179033815 21:37742929-37742951 GTGGGCACACATCTGCAGGAAGG - Intronic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179727072 21:43346686-43346708 GTGGGCCCCGAGCTGGGGAATGG - Intergenic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180174601 21:46081562-46081584 GTGGGCCCAGAGCAGGGACAGGG + Intergenic
1180842550 22:18966067-18966089 GTAGGCACAAATCTGGTGCAGGG - Intergenic
1180975529 22:19845790-19845812 GTGTGAACACTGCTGGGGCTGGG + Intronic
1181039914 22:20187159-20187181 GTCTGCACACAGCAGGGGCTGGG + Intergenic
1181106323 22:20577863-20577885 GAAGGCACAGAACTGGGGCAAGG + Intronic
1181310049 22:21939739-21939761 GTGGGCTGACAGTTGGGGAAGGG - Intronic
1181495280 22:23284116-23284138 GTGGGGTCACTGCTGGGACAGGG - Intronic
1182698183 22:32210222-32210244 TTCAGCTCACAGCTGGGGCAGGG - Intergenic
1183058130 22:35319487-35319509 ATGGGCCCACAGCAGTGGCAAGG + Intronic
1183086863 22:35491910-35491932 CAGGGGACACATCTGGGGCAGGG - Intergenic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183605305 22:38864398-38864420 GTGGTCACTCACCTGGGGGAGGG + Exonic
1184273285 22:43396822-43396844 GTGGGCCCTTGGCTGGGGCAGGG + Intergenic
1184478827 22:44735771-44735793 GAGGGGACAGAGCTGGGGCAAGG + Intronic
1185148589 22:49152027-49152049 ACGGGCACACAGCGGGGACACGG + Intergenic
1185231689 22:49687480-49687502 TGGAGCACACAGCTGGGGCTGGG + Intergenic
1185248293 22:49785218-49785240 GGGAGCCCACAGCTGGGGCAGGG + Intronic
1185338336 22:50280697-50280719 GAGGGCACACAGGTGGCGCCGGG - Intronic
1185347090 22:50315183-50315205 GTGGCCCCAAAGCCGGGGCAGGG + Intronic
950519061 3:13485442-13485464 GGAGGCGCTCAGCTGGGGCAGGG + Intronic
950569792 3:13792917-13792939 GTGAGCTCACACCTGGGGGAAGG + Intergenic
950593311 3:13955218-13955240 GGAGGCACTCAGCTGGGGCCAGG - Intronic
950678469 3:14568894-14568916 GAGGCCACACAGCTGGTGAAGGG - Intergenic
950712560 3:14823182-14823204 GGAGGCACTCAGCTGGGGGATGG - Intronic
951706847 3:25552243-25552265 GTGGGCAAACAGGCTGGGCAAGG + Intronic
953411871 3:42695154-42695176 GTGGTGACAAAGTTGGGGCATGG - Intronic
953814626 3:46144410-46144432 GTGGGCACAGAGGTGGGTCATGG - Intergenic
954363515 3:50134596-50134618 TGGGGCCCAGAGCTGGGGCAAGG + Intergenic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
954610854 3:51943853-51943875 GGGGGGACACAGCTGGGCCCTGG - Intronic
955716150 3:61832432-61832454 GTGGGTAAGCATCTGGGGCAGGG + Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
956175411 3:66468618-66468640 GTGGGCACCCAGCTCTGGCCTGG + Intronic
957429586 3:80084885-80084907 GTGGACACAAACATGGGGCAGGG - Intergenic
960973956 3:123157774-123157796 GTTGGCACACTGGTGGGGAAAGG + Intronic
961048445 3:123725912-123725934 GGGAGCAGAGAGCTGGGGCAGGG + Intronic
961314660 3:126026307-126026329 GGGGGCTCACAGCTGGGGCATGG + Intronic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962851527 3:139311755-139311777 GAGGTCACACAGCTGGGAAATGG + Intronic
962950341 3:140212851-140212873 GGGGGCACACAGCTCAGGCATGG - Intronic
964223175 3:154368976-154368998 ATGGGCGCACAGCAGGGGCAAGG + Intronic
965572924 3:170189650-170189672 GAGGTCACAGAGCTGGTGCATGG - Intergenic
966650960 3:182300526-182300548 GTGAGAAGACAGCTAGGGCAGGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
966885886 3:184377996-184378018 ATGGGCTCCCAGCTGGGGGAGGG - Intronic
967109564 3:186281693-186281715 GTGGGCACAAAGGTGGGGAAAGG + Intronic
968426074 4:524255-524277 GGGGGCACACAGCCCAGGCATGG - Intronic
968521391 4:1036182-1036204 GTCAGCGCACGGCTGGGGCATGG - Intergenic
968603729 4:1521862-1521884 GTGGGCACTCACCTGGGGGCCGG - Intergenic
968752405 4:2396825-2396847 GAGGGCGGACAGCTGGGGGAGGG + Intronic
968827206 4:2907856-2907878 GTCGGCACTCAGCGGGGGCTTGG + Intronic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969323105 4:6424900-6424922 GTGGCCACACAGCTGGGCAGTGG - Intronic
969476455 4:7425006-7425028 CTCGGCCCACAGATGGGGCAAGG - Intronic
969521132 4:7678342-7678364 GAGGGCACCCAGCTGGTGGACGG - Intronic
969521205 4:7678707-7678729 GAGGGCACCCAGCTGGTGGATGG - Intronic
970475001 4:16413036-16413058 GTGGCCACACAGCAGGAGGATGG - Intergenic
970510803 4:16779778-16779800 GTGGGCACCCAGCTGATGCCTGG - Intronic
971493554 4:27239849-27239871 GTGGGCACATAGATGTGCCAAGG + Intergenic
973604318 4:52571399-52571421 TCTGGCACACAGCTGGGGTATGG - Intergenic
974968892 4:68801796-68801818 ATGGGCGCACAGCAGGGGCAAGG + Intergenic
975169480 4:71216457-71216479 CTGGGCACATGGCTGAGGCATGG - Intronic
975911771 4:79275688-79275710 GTGTGCACAGATCTAGGGCAAGG + Intronic
976322073 4:83727507-83727529 GTGGGCAGACGGCTAGGGAATGG + Intergenic
978598251 4:110401789-110401811 GTGGGAACAGAGGTGGGGTAGGG + Intronic
979445616 4:120808589-120808611 GTGGGCACACAGCGCGGGACTGG - Intronic
985538402 5:476797-476819 GTGGGCACCCGGCTGGGGCACGG + Intronic
985761674 5:1752160-1752182 GTCGGCACAGAGCAGGGGCAGGG - Intergenic
986064365 5:4221260-4221282 GTGGGGCCACAGCTGGTGCACGG - Intergenic
990450056 5:55925336-55925358 GTGGGAATCCAGCTGGGCCAGGG - Intergenic
991638816 5:68733324-68733346 CTGGGCAGGCAGGTGGGGCAAGG - Intergenic
992611461 5:78511691-78511713 GCAGGCAGACAGCTGGTGCAGGG - Intronic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
996749064 5:126871126-126871148 GAGGTCACACAGCTGGGCGAGGG - Intronic
997429916 5:133830445-133830467 AAGGGCACAGGGCTGGGGCAAGG + Intergenic
997472568 5:134124962-134124984 GAGGTCACACAGCAGGGGGAGGG - Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
997657557 5:135566686-135566708 GTGGACATGCATCTGGGGCATGG + Intergenic
998139209 5:139690441-139690463 GAGGGAACACAGTTGGGGCGTGG - Intergenic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
1000072811 5:157756689-157756711 GTGGGGAAAAAGCTGAGGCACGG - Exonic
1001052465 5:168424047-168424069 GAGGGCAAGCAGCTGGGCCAAGG + Exonic
1001193563 5:169652208-169652230 GTGGGCACAGTGCCAGGGCAGGG + Intronic
1001205599 5:169759861-169759883 ATGGGCACTCAGCTTGGGGATGG + Intronic
1001317316 5:170653030-170653052 GAGAGCACACAGCTGGGTCGGGG + Intronic
1001388711 5:171361171-171361193 TTGGGCACAAAACTGGGGCGGGG - Intergenic
1001402250 5:171452352-171452374 GTTGGCACACAGATGGCCCAAGG - Intronic
1001686264 5:173597094-173597116 GTGTGGACACACCAGGGGCATGG - Intergenic
1001742546 5:174065796-174065818 GTGGCCACACAGCTAGGATAAGG - Intronic
1002132073 5:177087670-177087692 TTGGGTACACAGCTTGGGCTGGG - Intronic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002467404 5:179414459-179414481 GTGGCCCGACAGCAGGGGCAAGG - Intergenic
1002616521 5:180459557-180459579 GTGGGCACACAGCGCGGGACTGG + Intergenic
1002704517 5:181151260-181151282 GAGGGCAGACAGCTGCGGGAGGG + Intergenic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1006045047 6:31288045-31288067 ATTGGAACACAGCTGGGGTAAGG + Intronic
1006327415 6:33364974-33364996 GTGGGGAAACAGCTGAGGGAAGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006474369 6:34245185-34245207 GTGGGGACGCAGCAGGTGCAGGG - Exonic
1006877954 6:37314967-37314989 GAGGGCTAACAGCTGGGCCAGGG - Intronic
1006911529 6:37566493-37566515 GGGCGCCCACAGCCGGGGCATGG - Intergenic
1006986705 6:38180288-38180310 GTGGCCACGCTGCTGGGGCTGGG + Intronic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1011411856 6:87074462-87074484 GTGGGGACCCAGCTGGGGCCTGG + Intergenic
1013267299 6:108512410-108512432 GAGGACACAGAGCTGGGGGATGG + Intronic
1013923254 6:115435902-115435924 GTGGGCACAGACCTGGCACATGG - Intergenic
1018974248 6:168552853-168552875 GTGGGCTCTCTGCTGGGGCCTGG - Intronic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019299256 7:295386-295408 GTGGGAGCAGAGCTGGGCCAGGG - Intergenic
1019694414 7:2437172-2437194 GTGTGGACACAGCTGGAGGATGG - Intergenic
1020026506 7:4903622-4903644 GTGGGCACGCAGCCGGGGTGTGG + Intergenic
1020276902 7:6630137-6630159 GTGGACTCGGAGCTGGGGCAGGG - Intergenic
1020743799 7:12055582-12055604 GTGGGCATAGAGCTGGGGTCTGG - Intergenic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1021953819 7:25803461-25803483 GTGGGCACACAGCACCGGCCAGG - Intergenic
1022026498 7:26452699-26452721 GTGGGTACACATCTAGGGCTGGG - Intergenic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1024178546 7:46864378-46864400 GAGGGCATTCAGCTGGGGGAGGG - Intergenic
1025279179 7:57614562-57614584 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1025305552 7:57850938-57850960 GTGGGCCCACAGAAGGGGAAGGG + Intergenic
1027685326 7:81273578-81273600 GTGGGCTCACATCTGGCTCAAGG + Intergenic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029134448 7:98359211-98359233 GGTGGCACACTGCTGGGGCGTGG - Intronic
1029694283 7:102202765-102202787 GGGGACACACAGCTTGGGGATGG + Intronic
1031993071 7:128210466-128210488 GAGGCCACATAGCTGGCGCAGGG - Intergenic
1034056193 7:148037397-148037419 GTGGGCACACAGCTGCGGATTGG - Intronic
1034199421 7:149273832-149273854 GATGGCATACAGCTTGGGCATGG - Intronic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1034470984 7:151254219-151254241 TTTGGGACACGGCTGGGGCAGGG - Intronic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1035862665 8:3046764-3046786 GTGAGCACACAGATGTGGCTGGG - Intronic
1035947436 8:3980973-3980995 GTGGGTACAAAGGTGGGGAAAGG - Intronic
1037725875 8:21482345-21482367 GTTGGCAGACATGTGGGGCATGG - Intergenic
1037806403 8:22060017-22060039 AGGGACACACAGCTGGGGGAGGG + Intronic
1037992423 8:23330462-23330484 GTGGGAAGACAGCTTGGGAAGGG - Intronic
1039888775 8:41670738-41670760 GGGGTCACACAGGTGGGGAAAGG + Intronic
1040000939 8:42575588-42575610 GTGGGCACACAGCACGGGACTGG + Intergenic
1040531567 8:48270533-48270555 GGGAGCATGCAGCTGGGGCACGG + Intergenic
1041618508 8:59936088-59936110 GTGGGTACAAAAGTGGGGCAAGG + Intergenic
1042835340 8:73074785-73074807 GAGGGCACACAGTGGGTGCAGGG + Intronic
1043725978 8:83611304-83611326 GTGGGGAGACAGCTGAGGCCCGG + Intergenic
1043873990 8:85464310-85464332 GTGGCCTCGCAGCTGGGGCAAGG - Intronic
1047030097 8:120867398-120867420 GTGGGTAAGAAGCTGGGGCAGGG - Intergenic
1047258722 8:123236969-123236991 GCGGGCAAACAGCTGGAGGATGG + Intronic
1048340758 8:133536943-133536965 GAGGACACCCAGCTGGTGCATGG - Intronic
1048467989 8:134683528-134683550 GTGGCCAGACAGCTGGAGGAAGG + Intronic
1048780148 8:137990929-137990951 ATGGGCACACGGCAGGGGCAAGG + Intergenic
1048974864 8:139665589-139665611 GTGGGCACAGAGCCAGGGCAAGG - Intronic
1049015315 8:139915740-139915762 GTTAGCAGACAGCTGTGGCAAGG - Intronic
1049276181 8:141721189-141721211 GTGTGGACACAGCTGGGGGGAGG - Intergenic
1049429223 8:142551419-142551441 AGGGTCACACAGCTGGGGCCTGG + Intergenic
1049441789 8:142612964-142612986 GGGGGCACCCAGCTGGACCAGGG + Exonic
1049690042 8:143954310-143954332 AGGGGCACACTGCTGGGGCCGGG - Intronic
1049785734 8:144449826-144449848 GCGGGCACACAGATGGGGGCGGG + Exonic
1049883726 9:14629-14651 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1052116107 9:24649825-24649847 CCAGGCACACAGCTGTGGCAGGG - Intergenic
1053307217 9:36993563-36993585 GAAGGGACACAGCAGGGGCAGGG + Intronic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1053442159 9:38125537-38125559 GTGAGCACACAGCTAGGACAGGG - Intergenic
1055088127 9:72335126-72335148 GTGGTCACACAGCTGCTTCACGG + Intergenic
1055270680 9:74554763-74554785 GGGGGCACACTGCTGTGGCCTGG - Intronic
1055342195 9:75295931-75295953 GTGGGGCCACTGCTGGGGGATGG + Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056102299 9:83311584-83311606 GGGGGCACACGGATGGGTCAGGG - Intronic
1056308990 9:85320940-85320962 GTGGACACAGGGCTGTGGCAAGG + Intergenic
1057184552 9:93049647-93049669 GTGGGGACAGGGCTGGGGCAGGG + Intergenic
1057277171 9:93682124-93682146 ATGGGCACATGGCAGGGGCAGGG - Intergenic
1057695913 9:97323005-97323027 GTGGGGACATAGCTGGGGAGGGG - Intronic
1057955960 9:99408178-99408200 GCGGGCACGCAAGTGGGGCAGGG + Intergenic
1059282043 9:113143269-113143291 TAGGGCACACAGCTGGTGAAGGG - Intergenic
1059358424 9:113719363-113719385 ATGGGCCCACAGTTGAGGCAGGG - Intergenic
1059392730 9:114009117-114009139 GTGGGCACACAGCTGAGAACAGG + Intronic
1059444778 9:114331406-114331428 CTGGGCACGCAGCAGGGGCTGGG + Intronic
1059452333 9:114378158-114378180 GTGTGCACATAGCAGGAGCAGGG - Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060664892 9:125427044-125427066 CAGGGCACACAGCTAAGGCACGG - Intergenic
1060887083 9:127161836-127161858 GTGGCCACACAGCTGGGAACTGG - Intronic
1061037207 9:128120507-128120529 CAGGGCACACAGCTGGGCCGTGG - Intergenic
1061662304 9:132138265-132138287 GAGGGGACAGAGCTGGGCCAGGG + Intergenic
1062009680 9:134260275-134260297 GTGGGGACAGACCCGGGGCATGG + Intergenic
1062246624 9:135571702-135571724 GTGGGCACACACCTGGACAAGGG + Intergenic
1062463806 9:136672540-136672562 GTGGGCCCTCAGCTGAGGGAAGG + Exonic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1062630993 9:137462999-137463021 GTGGGCACACGGCTGTGTCCTGG + Intronic
1062720816 9:138043134-138043156 GTGGGAGCACAGCTGGGGTGTGG + Intronic
1203630562 Un_KI270750v1:69391-69413 GTGGGCCCACAGAAGGGGAAGGG - Intergenic
1185575697 X:1170467-1170489 CTGGGCACACAGCAGGGGAGAGG - Intergenic
1186739055 X:12497970-12497992 GTGGGCACCAGGCTGGGGGAAGG + Intronic
1186841596 X:13489728-13489750 GTGGGCAGAGGGCTGGGGAATGG - Intergenic
1190246069 X:48691213-48691235 GTGGGCACAGAGCAGGTGGAGGG - Exonic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1192312760 X:70030077-70030099 GTGGCCACACAGCTGTAGCAAGG - Intronic
1195177675 X:102326746-102326768 GCTGGCTCACGGCTGGGGCAGGG - Intergenic
1195181189 X:102360347-102360369 GCTGGCTCACGGCTGGGGCAGGG + Intergenic
1197278004 X:124502380-124502402 GGGAGCACACAGCTGGGGGCTGG + Intronic
1198281605 X:135148275-135148297 GAGGGCACACATGTGTGGCAGGG + Intergenic
1198289354 X:135224247-135224269 GAGGGCACACATGTGTGGCAGGG - Intergenic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1200115237 X:153767130-153767152 GTGGGCACTCGGCTGGGTCACGG - Exonic
1200402088 X:156025530-156025552 GAGGCCACACAGCTGGGGCGGGG + Intergenic
1201556366 Y:15267635-15267657 GTGGGCGCACAGCTTGGGACAGG + Intergenic