ID: 1152592071

View in Genome Browser
Species Human (GRCh38)
Location 17:81218650-81218672
Sequence CCAAGCAGGTTCCCAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 2, 2: 2, 3: 20, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152592071_1152592078 1 Left 1152592071 17:81218650-81218672 CCAGGCTTTGGGAACCTGCTTGG 0: 1
1: 2
2: 2
3: 20
4: 255
Right 1152592078 17:81218674-81218696 CCAAGGGTCCGCTACTGGCCCGG 0: 1
1: 0
2: 1
3: 2
4: 104
1152592071_1152592083 23 Left 1152592071 17:81218650-81218672 CCAGGCTTTGGGAACCTGCTTGG 0: 1
1: 2
2: 2
3: 20
4: 255
Right 1152592083 17:81218696-81218718 GCTGCCCTTACCCCGGAACTCGG 0: 1
1: 0
2: 0
3: 12
4: 98
1152592071_1152592080 16 Left 1152592071 17:81218650-81218672 CCAGGCTTTGGGAACCTGCTTGG 0: 1
1: 2
2: 2
3: 20
4: 255
Right 1152592080 17:81218689-81218711 TGGCCCGGCTGCCCTTACCCCGG 0: 1
1: 0
2: 0
3: 10
4: 175
1152592071_1152592076 -4 Left 1152592071 17:81218650-81218672 CCAGGCTTTGGGAACCTGCTTGG 0: 1
1: 2
2: 2
3: 20
4: 255
Right 1152592076 17:81218669-81218691 TTGGTCCAAGGGTCCGCTACTGG 0: 1
1: 0
2: 0
3: 2
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152592071 Original CRISPR CCAAGCAGGTTCCCAAAGCC TGG (reversed) Intronic
900288732 1:1914806-1914828 CCCACCAGACTCCCAAAGCCAGG - Exonic
900587659 1:3440889-3440911 CCAAGCATGGGCCCCAAGCCAGG - Intergenic
900881720 1:5386410-5386432 CAAAGCAGATTCCCAAAGGCTGG + Intergenic
901149214 1:7089292-7089314 CCGTGCTGGTACCCAAAGCCAGG + Intronic
901559080 1:10055525-10055547 CCAAGCTGGTTTCCAACTCCTGG + Intronic
901971448 1:12912138-12912160 CCAAGAGGGTCCCCAAACCCAGG + Intronic
902013720 1:13289602-13289624 CCAAGAGGGTCCCCAAACCCAGG - Intergenic
902994517 1:20213264-20213286 CCAGGCAGGTTCCTGAAGGCAGG + Intergenic
904185060 1:28697585-28697607 CAAAGCATGTTTCCAAAGCATGG - Intronic
906698632 1:47841690-47841712 AAAGGCAGGTTCCCAGAGCCAGG + Intronic
907261656 1:53222744-53222766 CCAAGTAGGTTTCTAAAGCCCGG + Intergenic
908833512 1:68205485-68205507 GGAAACAGGTTCTCAAAGCCAGG + Intronic
910694141 1:89994504-89994526 CCAAGCAGGTCTCCAACTCCTGG - Intergenic
916492472 1:165314079-165314101 CCAAGCCAGCTCCCTAAGCCAGG + Intronic
919597337 1:199580486-199580508 GCCAGGAGGTTCCCAAGGCCTGG + Intergenic
920022511 1:202966826-202966848 CCAAGTAGGAGCCCACAGCCAGG + Exonic
920364040 1:205438757-205438779 CCACCCATGTTCCCAAAGCCAGG + Intronic
922815751 1:228447610-228447632 CCAGGCTGGTCTCCAAAGCCTGG + Intergenic
922994122 1:229942639-229942661 CCACGCAGGCTGCCAAAGACTGG - Intergenic
923391437 1:233516662-233516684 CCCTGGAGGCTCCCAAAGCCAGG + Intergenic
924009111 1:239644842-239644864 CCCAGCAGGGTCCCATGGCCTGG + Intronic
1062794670 10:335558-335580 CCTAGAATCTTCCCAAAGCCTGG - Intronic
1063451355 10:6152401-6152423 CCATGGAGGCTCCCCAAGCCAGG + Intronic
1064384579 10:14878957-14878979 CCAGGCAAGCTCCCAAGGCCCGG + Intronic
1066309936 10:34186405-34186427 CCAATCAGATTCCCAAACACTGG + Intronic
1067675497 10:48372004-48372026 ACATGCAGGTTCCCAGAGCGTGG - Intronic
1068794336 10:61061629-61061651 CCAAGCTGGTCTCCAAATCCTGG + Intergenic
1069288010 10:66741279-66741301 ACAAGCAAATTCCCAAGGCCAGG + Intronic
1069964029 10:72098855-72098877 TTAAGCAGGCTGCCAAAGCCAGG - Intronic
1070764526 10:79048703-79048725 CCTGGCTGGTTCCCAAATCCAGG - Intergenic
1071672234 10:87619319-87619341 CCAAAGAGGTTCTCACAGCCAGG + Intergenic
1073544089 10:104334643-104334665 CCAAGGAGATGCCCATAGCCAGG + Intronic
1074703979 10:116115398-116115420 CCTGGCAGGTTCCCAGAGTCAGG + Intronic
1076529837 10:131136816-131136838 AAGAGCAGGTTCCCACAGCCAGG - Intronic
1077101695 11:825353-825375 CCTGGCAGGTTCCAAATGCCAGG - Exonic
1077232966 11:1466677-1466699 CCAAGCAGATGCTCAAAGCAGGG - Intergenic
1077240493 11:1508082-1508104 CCAAGAGGGTCCCCACAGCCAGG - Intergenic
1077282068 11:1750322-1750344 CCACGCAGGTTCCCTGAGCTGGG + Intronic
1078402998 11:11044585-11044607 CGGAGCAGTTTCCCAAGGCCTGG - Intergenic
1078579651 11:12528196-12528218 CTAAGCTGGTTCCCAAATCATGG - Exonic
1079203536 11:18394897-18394919 CCAAGCAGGGGTCGAAAGCCCGG + Intronic
1079820450 11:25120794-25120816 CCAAACAGGTTCACTAAGCATGG + Intergenic
1081540867 11:44033674-44033696 CCAAGCAGGATACCAAGTCCTGG + Intergenic
1081715990 11:45250938-45250960 CCACACAGGGTCCCACAGCCAGG - Intronic
1081785521 11:45744171-45744193 CCCATCAGTCTCCCAAAGCCGGG - Intergenic
1084797622 11:71519020-71519042 CCGGGCAGGTTCCTCAAGCCCGG - Intronic
1085511432 11:77090231-77090253 CCAGGCATGTTCCCACTGCCAGG - Intronic
1085530382 11:77189102-77189124 CCAATCCAGTTCCCACAGCCAGG - Intronic
1087655577 11:100918955-100918977 CCAAGCAAATTACCAAAGCTGGG - Intronic
1088073794 11:105821976-105821998 CCACGCAGGTTCCCAGAACCGGG + Intronic
1089079410 11:115763319-115763341 CCAGCTAGATTCCCAAAGCCAGG + Intergenic
1090117943 11:123994648-123994670 CCAGCCAGGTGCCTAAAGCCAGG + Exonic
1092259050 12:6942640-6942662 CCAAGCTGGTTTCCAACTCCTGG - Intergenic
1094082890 12:26556867-26556889 CCAGGCTGGTCCCCAAATCCTGG - Intronic
1094298126 12:28930953-28930975 CCAATCAAGGTCACAAAGCCAGG + Intergenic
1094808605 12:34115328-34115350 CCTAGCACCATCCCAAAGCCAGG + Intergenic
1099403056 12:82223676-82223698 GCAGGCTGGTTCCCAAAGACTGG + Intronic
1101116280 12:101534672-101534694 CAAAGGAGGTTCCCAAGGGCTGG + Intergenic
1101976984 12:109368258-109368280 CCAAGCAAGTGCCTAAAGCAGGG + Intronic
1103587083 12:121963867-121963889 CCAGGTAAGATCCCAAAGCCAGG - Intronic
1104690828 12:130825065-130825087 CCAAGCTGTTGCCCCAAGCCGGG + Intronic
1105889785 13:24674317-24674339 CCAAGCAACTTCACAAAGTCAGG + Intergenic
1107123370 13:36819305-36819327 CCAAGCAGGTGCTAAAAGCCCGG + Exonic
1110505965 13:76286398-76286420 CCAAGCAGTTTGCAAAAGCAAGG - Intergenic
1113052541 13:106229947-106229969 CCAAGACGGTTTCCAGAGCCTGG - Intergenic
1113400667 13:109989762-109989784 CAGAGCAGGTCACCAAAGCCAGG - Intergenic
1113441722 13:110334251-110334273 CCAAGCAGAGTTCCAAAGCTGGG - Intronic
1113611243 13:111646164-111646186 TCAAGGAGGTTCCAAAGGCCAGG - Intronic
1114660698 14:24341950-24341972 CCAAGTAGGCTCCAAAAGCATGG - Intergenic
1115034677 14:28842850-28842872 CCAAGCAGGTTGCCACTGGCTGG - Intergenic
1115889554 14:38011573-38011595 CCCGGCAGGTTCCCCAAGTCCGG - Intronic
1118348758 14:64958796-64958818 CCAACCAGGTGCCCAAAGCACGG + Intronic
1120994819 14:90409064-90409086 CCAAGGAGGATACCAAGGCCTGG - Intergenic
1122199287 14:100112602-100112624 CCAAGCATGCTCCTAAAGTCAGG + Intronic
1122823862 14:104360246-104360268 CCAGGCAGTTTCCCCAACCCAGG - Intergenic
1123758733 15:23416751-23416773 GCAAGGATGTTTCCAAAGCCCGG - Intergenic
1127870867 15:63072668-63072690 CCAAGCAGGGTCCCGGAGCCTGG + Intergenic
1129080153 15:73032454-73032476 CCAAGCAGGCTGCCAGAGCAAGG + Intergenic
1130322176 15:82850499-82850521 ACAAGCAGGTTCCCAAAGACAGG + Intronic
1131048913 15:89333792-89333814 CCAAGCTGGAGCCCAAAGCCAGG - Exonic
1134672745 16:16067842-16067864 CCAAGCACAATCCCCAAGCCAGG - Intronic
1135700795 16:24630842-24630864 CCAAGCCAGTTCCCAGTGCCTGG + Intergenic
1136140734 16:28286788-28286810 GCCATCAGTTTCCCAAAGCCTGG + Intergenic
1138094400 16:54200742-54200764 TGAAGCAGGAACCCAAAGCCTGG - Intergenic
1139651778 16:68365815-68365837 CCTGGCAGGATCCCAAAGGCTGG + Intronic
1139923694 16:70474449-70474471 ACAGTCAGGTCCCCAAAGCCAGG + Intronic
1141205106 16:81927514-81927536 CCAAGCACGTTCTCAATGTCTGG - Intronic
1141667730 16:85474551-85474573 GCAAGCACGTTCCCCAAGGCTGG - Intergenic
1141749241 16:85947113-85947135 CCTGCCAGGTTCCCCAAGCCTGG - Intergenic
1143016030 17:3891846-3891868 CCCAGGAGGCCCCCAAAGCCAGG + Intronic
1143554566 17:7652119-7652141 CCCAGAAGGCTCCCAAGGCCAGG - Intronic
1143610872 17:8016658-8016680 CCAGGCTGGTTCCTAAACCCCGG + Intronic
1145819928 17:27824407-27824429 CCAAGTTGGTTCACCAAGCCAGG + Intronic
1145918433 17:28591472-28591494 CCAAGCTGGTTTCAAATGCCTGG + Intronic
1146088381 17:29851647-29851669 CCAGGCAGGTTTCCAACTCCTGG - Intronic
1146123610 17:30215650-30215672 GCCAGCAGGACCCCAAAGCCCGG + Exonic
1146144766 17:30404092-30404114 CCCAGAAGGTTCCCAGACCCTGG - Intronic
1147457198 17:40545330-40545352 CCAAGCAGGACTCCAAGGCCTGG - Intergenic
1147587290 17:41659797-41659819 CCCAGCAGGTACCCAGAGCCAGG + Intergenic
1147654445 17:42080819-42080841 CCAAGCAGCTTCCCACAGCAGGG + Intergenic
1148455352 17:47808307-47808329 CCATCCATGTTCCCATAGCCTGG + Exonic
1148987631 17:51637464-51637486 CATGGCAGGGTCCCAAAGCCTGG + Intronic
1149317835 17:55455578-55455600 CCAAGCAGGTCCCAAACTCCTGG - Intergenic
1149337006 17:55645558-55645580 CCAAGCAGTTTCCCAAAGCCAGG - Intergenic
1149503995 17:57177896-57177918 CCAAGCAGGATCACGAAGTCAGG + Intergenic
1149640614 17:58200168-58200190 CCAAGTAGCTTCCCAGAGGCTGG + Intronic
1149726593 17:58901049-58901071 CCAAGCAATTTCCAAAATCCAGG + Intronic
1151670655 17:75570142-75570164 CCAAGGAGGTGACCACAGCCGGG - Exonic
1152135041 17:78498840-78498862 CCCTCCAGGGTCCCAAAGCCTGG - Intronic
1152251014 17:79212587-79212609 ACAAGCAAATTCCCAGAGCCTGG + Intronic
1152406075 17:80098641-80098663 TCAAGAAGGTTGCCTAAGCCGGG + Intronic
1152592071 17:81218650-81218672 CCAAGCAGGTTCCCAAAGCCTGG - Intronic
1152713382 17:81886146-81886168 CCAAGCAGGTGCCCTTGGCCCGG - Intergenic
1152758461 17:82096934-82096956 AGAGGCAGGGTCCCAAAGCCGGG + Intronic
1152910509 17:83002765-83002787 CCCAGCACGTTCCAAGAGCCAGG - Intronic
1153809262 18:8737575-8737597 CCAAGCAGGTGACCAACGCGAGG + Intronic
1154210559 18:12376035-12376057 CCAAGCTGGTTTCCAACTCCTGG + Intronic
1155491481 18:26405540-26405562 CCAAGCAGCTTGGCAGAGCCTGG + Intergenic
1156698047 18:39791615-39791637 CAGAGCAGTGTCCCAAAGCCAGG - Intergenic
1161302410 19:3549002-3549024 CCCAGCTGGTGCCCAAAGCCAGG - Intronic
1162487827 19:10972524-10972546 CCAAGCTGGTTCCAAACACCAGG - Intronic
1162932957 19:13966328-13966350 ACAAGCAGGTGCCCCAACCCTGG + Intronic
1162997974 19:14348502-14348524 CCAAGCAGGATCCCAGGGACTGG + Intergenic
1165207808 19:34205920-34205942 CCAAGCAAGTTGCCAATACCAGG + Intronic
1166320423 19:42014843-42014865 CCAGGCAGGTTTCCAACTCCTGG - Intronic
1166915721 19:46194922-46194944 CCAAGCTGGTTTCCAACTCCTGG + Intergenic
1166987166 19:46667804-46667826 CCAGGCTGGTTCCCAACTCCTGG - Intergenic
1167463747 19:49639664-49639686 CCCAGGAGGTGCTCAAAGCCAGG + Intronic
1168093720 19:54102599-54102621 CCACGCAGGTCCGCAAAGTCAGG + Intronic
925599874 2:5597342-5597364 CCAACCAGGTTCCCAGTGGCAGG - Intergenic
927461660 2:23304576-23304598 CCATGCAGGCTCCCTGAGCCTGG - Intergenic
928462175 2:31485267-31485289 CCAAGCAGGTCCTCCAGGCCTGG - Intergenic
928615856 2:33038934-33038956 CCAGGCAGGTGCCCAGAGGCAGG - Intronic
931052987 2:58434872-58434894 CCAAGCATATTCCCCCAGCCAGG + Intergenic
933567659 2:83970786-83970808 CCCAGCAGTTTGCCAAAGCTTGG + Intergenic
933599310 2:84313997-84314019 CCAGGCTGGTTCCCAACTCCTGG - Intergenic
934745601 2:96757622-96757644 CCAACCAGGTTCTCCAACCCCGG + Intergenic
934910907 2:98253600-98253622 CTAAGCATGGTCCCCAAGCCAGG - Intronic
937378658 2:121355619-121355641 TCAGGCAGCTTGCCAAAGCCAGG - Intronic
941785104 2:169489513-169489535 CCAAGCTGGTTTCCAACTCCTGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
947809802 2:232997211-232997233 AAAAGCAGGTTCCCAGGGCCCGG - Intronic
948583171 2:239001975-239001997 CCAAGAAGGGTCCCAAGCCCAGG - Intergenic
948948327 2:241233175-241233197 CCCAGCAGGATGCCAGAGCCAGG + Intronic
1169008645 20:2231165-2231187 CCAAGCATTTTGCCAAAGCTTGG + Intergenic
1169853553 20:10078922-10078944 CCAAGCAGGTTGCCACTGCTGGG + Intergenic
1169977831 20:11350568-11350590 CCAAGCAAGTTTCCAAACACAGG + Intergenic
1170818609 20:19736551-19736573 CCAGGCTGGTCTCCAAAGCCTGG - Intergenic
1170824402 20:19781403-19781425 CTAAACAGATCCCCAAAGCCAGG - Intergenic
1170878228 20:20271080-20271102 CCAGGCTGGTTCCAAAATCCTGG - Intronic
1171351557 20:24506788-24506810 CCACATCGGTTCCCAAAGCCAGG + Intronic
1172028200 20:31963903-31963925 CTCAGCAGGATCCCAAAGCAAGG + Intergenic
1172625552 20:36344675-36344697 CCAACCAGGCTCCCAAGACCAGG - Intronic
1173174914 20:40757241-40757263 ACAAACTGGTTCCCAAGGCCTGG + Intergenic
1173580594 20:44144021-44144043 CGAGGCTGGTTCCCGAAGCCAGG - Intronic
1173721031 20:45258360-45258382 GCAAGCAGGTTCCATCAGCCAGG - Intergenic
1174637352 20:52013252-52013274 CCAAGCTGGTTCCCACAGCAGGG - Intergenic
1176427750 21:6559217-6559239 CCAGGCAACTTCCCACAGCCTGG + Intergenic
1177127444 21:17212998-17213020 CCACAGAGGTTCCCAAACCCTGG - Intergenic
1177781728 21:25629356-25629378 CCAAGCTGGTTTCCAACTCCTGG + Intergenic
1179007023 21:37524216-37524238 CCAAGCTGGTCTCCAAATCCTGG - Intergenic
1179309689 21:40184774-40184796 CCCAGGAGTTTCCCAAAGGCAGG - Intronic
1179703242 21:43167534-43167556 CCAGGCAACTTCCCACAGCCTGG + Intergenic
1179898535 21:44377009-44377031 TCAAGCAGGTTCTCAAAGTGTGG - Intronic
1179898545 21:44377079-44377101 TCAAGCAGGTTCTCAAAGTGTGG - Intronic
1182452161 22:30428096-30428118 CCAAGCACGTGACCCAAGCCTGG - Intronic
1182802983 22:33046906-33046928 TCAGAGAGGTTCCCAAAGCCAGG - Intronic
1183259948 22:36788210-36788232 CCAGGCAGTCTCCCAGAGCCCGG - Intergenic
1183493444 22:38128612-38128634 CCAAGCAGCTTCCTAAGGCCAGG + Intronic
1184095562 22:42314520-42314542 CCCAGCTGCTTCCCAGAGCCGGG + Intronic
1185142279 22:49109154-49109176 CCTAGCAGGTTCTAAAAGCCTGG - Intergenic
949133094 3:529812-529834 GCAAGCAGCTTGCAAAAGCCAGG + Intergenic
950193143 3:10992030-10992052 CCCAGCTGGTACCCAGAGCCTGG + Intergenic
950574438 3:13823336-13823358 CCATGCAGCTTCCCAGTGCCTGG + Intronic
950742752 3:15063364-15063386 CCCAGCAGGTACCCAAAGACTGG + Intronic
951649317 3:24932068-24932090 CCAAGCAGGCTCCCCAAGTTGGG - Intergenic
953962853 3:47280494-47280516 CCAAGCTGGTTCCTAATTCCTGG - Intronic
954025323 3:47778525-47778547 CCAAGCTGGTCTCCAAATCCTGG + Intronic
954047234 3:47942898-47942920 CCAAGCTGGTCTCCAATGCCTGG - Intronic
954464283 3:50645637-50645659 CCAGGCAGGAGCCTAAAGCCTGG - Intronic
954529579 3:51307324-51307346 CCAAGCTGGTTCCAAACTCCTGG + Intronic
956099353 3:65751091-65751113 CCAAGCTGTTTCCCAGTGCCAGG - Intronic
957041738 3:75341168-75341190 CCATCCAGGTTCCCAGAGGCTGG - Intergenic
957835822 3:85587974-85587996 CCAAGCTGGTTTCCAATTCCTGG + Intronic
959679046 3:109071910-109071932 CCAGGCAAGTTCCCAAAAGCTGG + Intronic
960420120 3:117435130-117435152 CCCAGCATGTACCCAAAGCATGG + Intergenic
961046451 3:123711961-123711983 CCATCCAGGTTCCCAGAGGCTGG - Intronic
962294075 3:134164803-134164825 CCAAGCTGTTTCCCAAAGTTTGG + Intronic
962583247 3:136817580-136817602 CCAAGAATGTTCCCAAAGAGGGG - Intergenic
962665410 3:137649394-137649416 ACAAGCACATCCCCAAAGCCTGG + Intergenic
962707966 3:138063141-138063163 TAAAGCAGGTTCTCAAAGGCAGG - Intronic
963831714 3:150015956-150015978 CCAAGCAGCAACACAAAGCCAGG - Intronic
964302187 3:155300925-155300947 CGAAGTAGGTTCCCAATGCATGG + Intergenic
966679927 3:182631194-182631216 CCAAGCAGGCTCCCAAAGCCAGG + Intergenic
968045533 3:195622270-195622292 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968045544 3:195622305-195622327 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968045556 3:195622339-195622361 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968045580 3:195622408-195622430 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968045591 3:195622443-195622465 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968045603 3:195622477-195622499 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968045616 3:195622517-195622539 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968045643 3:195622595-195622617 CCAAGCACCTTCCCCAGGCCAGG - Intergenic
968064330 3:195750291-195750313 CCAAGCACCTTCCCCAGGCCAGG - Intronic
968308998 3:197667453-197667475 CCAAGCACCTTCCCCAGGCCAGG + Intergenic
968309012 3:197667492-197667514 CCAAGCACCTTCCCCAGGCCAGG + Intergenic
968676257 4:1882181-1882203 CCAATCAGGGACCCAAAGCAGGG - Intronic
971027922 4:22606856-22606878 CAAGGCAGCTCCCCAAAGCCTGG + Intergenic
971263350 4:25076670-25076692 CAAGGGAGGTTCCCAAAGGCTGG - Intergenic
972596066 4:40530888-40530910 CCAAGCTGGTCCCCAACTCCTGG - Intronic
972748660 4:41966938-41966960 CCAGGCTGGTTTCCAAATCCCGG - Intergenic
974256465 4:59461587-59461609 CCAAGCTGGTCTCCAACGCCTGG + Intergenic
977161992 4:93646370-93646392 CCCAGCTGGTTCCCAATGCAGGG - Intronic
978428562 4:108608041-108608063 CAAAGCAGGTTCCCCTAGCATGG + Intergenic
979836501 4:125375475-125375497 CCAAGTAGTTTGCCAAGGCCTGG - Intronic
981547097 4:145904563-145904585 CCAGGCATGTTCCCACAGCAGGG - Intronic
982646191 4:158027321-158027343 CCAGGAAGGTTCTCCAAGCCTGG + Intergenic
987877080 5:23691907-23691929 CCAAGCGGGTTGCCAATGCTGGG - Intergenic
988858755 5:35255010-35255032 CCAAGCAGGGTAGCAAATCCAGG - Intergenic
991170842 5:63624003-63624025 CCAAGCAGGTTCTCTAACCTAGG - Intergenic
996703964 5:126478226-126478248 CCAGGCTGGTTCCCAACTCCTGG - Intronic
998315830 5:141182380-141182402 GCAAACCGTTTCCCAAAGCCTGG + Exonic
998733800 5:145111588-145111610 CCGAGCAGCATGCCAAAGCCAGG - Intergenic
999206147 5:149849524-149849546 CCACTCAGGTTCCCTGAGCCTGG + Exonic
999893889 5:156007882-156007904 ACATGCAACTTCCCAAAGCCTGG - Intronic
1001420923 5:171586651-171586673 CCAGGCAGGTGCCCAGACCCTGG + Intergenic
1002854836 6:1027422-1027444 CCCAGCCCATTCCCAAAGCCTGG - Intergenic
1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG + Intergenic
1004339019 6:14791103-14791125 CTAGGCAGGATCCCAAAACCGGG + Intergenic
1004863957 6:19836264-19836286 CCAAGCGGGATCCCAGAGACTGG + Intergenic
1007292904 6:40800590-40800612 CCATGCAGGCTCCAACAGCCAGG + Intergenic
1007479509 6:42141197-42141219 GCATGCAGGTTGCCACAGCCAGG - Intronic
1007782359 6:44261892-44261914 CCAAGCATGTTCCCAGAGGTGGG - Intronic
1007802755 6:44411413-44411435 CCAACTAGGTTCCCAGAGACTGG - Intronic
1009888851 6:69656322-69656344 CCAGGCAGGTTCTCCAGGCCTGG + Intergenic
1013188315 6:107781349-107781371 CAAAAGAGGTTCCCCAAGCCGGG + Intronic
1013278139 6:108606627-108606649 ACAAGCAGGTTCAGAAAGCCAGG + Intronic
1014884974 6:126768952-126768974 CTAAGCAGGTTTCCCAAGCTTGG - Intergenic
1017238446 6:152141223-152141245 CTATGCAGGTTAACAAAGCCAGG + Exonic
1017426667 6:154329200-154329222 CCAAGCAGGTTTCAAACTCCTGG - Intronic
1017847591 6:158272958-158272980 CGGACCAGATTCCCAAAGCCAGG - Intronic
1018055205 6:160046383-160046405 CCCAGGAGGTTCCCAACGGCAGG - Intronic
1019119966 6:169794567-169794589 CCAGGCAGGCTCCCCAAGCCAGG + Intergenic
1020237756 7:6369743-6369765 CCAAGCTGGTTTCAAATGCCTGG + Intergenic
1021099968 7:16576638-16576660 CAAATCAGGTTCTTAAAGCCAGG - Intronic
1022160902 7:27710157-27710179 CCAAACAGGTTGTCAAAGCAAGG + Intergenic
1022515781 7:30974295-30974317 CCAGGCAGGACCCCAGAGCCAGG - Intronic
1026546347 7:71326246-71326268 CCAAGCAGGTCCCAAACTCCTGG - Intronic
1029669771 7:102021515-102021537 CCAAGCTGGTCCCGAATGCCTGG + Intronic
1030575697 7:111283456-111283478 GGAAGCAGCTTCCCAAAGCAGGG + Intronic
1031829454 7:126608471-126608493 GGAAGCAAGTTCCCAAGGCCTGG - Intronic
1032168066 7:129561425-129561447 CCAGGCAGGTTCCCAGGCCCTGG - Intergenic
1034887667 7:154810408-154810430 CCAAGCAGCCTCCCAACACCAGG - Intronic
1036706708 8:11052153-11052175 CCAAGCAGGTTCCCACCCCAGGG + Intronic
1040571942 8:48619279-48619301 CAAAGCAGGTTCCCAAACCCTGG - Intergenic
1045553908 8:103196712-103196734 CCAGGGAGGTTCACCAAGCCAGG - Intronic
1046961051 8:120113311-120113333 CCAGGCTGGTTCCCAACTCCTGG + Intronic
1050532394 9:6601838-6601860 CCAGGCAGGTTTCCAACTCCTGG + Intronic
1052837678 9:33264176-33264198 CCATGCAGGTCCCGAAAGCCCGG - Intronic
1053122079 9:35555156-35555178 CCAAGCAGCTGGCCAAGGCCCGG + Exonic
1056506291 9:87261206-87261228 CCAAGGACCTTCCCCAAGCCAGG - Intergenic
1059639514 9:116203050-116203072 CAATGCAGGTTCCCACACCCAGG + Intronic
1060492320 9:124093925-124093947 CCAAGGAGCTTCTCAAAGCCTGG + Intergenic
1061195088 9:129103119-129103141 CCAAGCAGGTGTCCCTAGCCCGG - Intronic
1061276389 9:129571349-129571371 TCACCCAGGGTCCCAAAGCCAGG + Intergenic
1061664784 9:132154186-132154208 CCAAGCTGGTTCCCAAGATCAGG + Intergenic
1061803367 9:133124982-133125004 CCATAGAGGTTCCCACAGCCTGG - Intronic
1186125701 X:6411639-6411661 CCAGGCTGGTCCCCAAATCCTGG - Intergenic
1187912427 X:24123087-24123109 CCAAGCTGGTTTCAAAATCCTGG + Intergenic
1190750722 X:53359294-53359316 CCCATCAGATTCCCAAACCCAGG + Intergenic
1191156769 X:57283080-57283102 CCAGGCAGGTTCCCATGGCTTGG - Intergenic
1192321304 X:70092671-70092693 CCAAGAAGGTGCCCCAGGCCAGG + Intergenic
1193602839 X:83529547-83529569 CCAACCATTTTCCCAAAGGCAGG - Intergenic
1194602622 X:95940929-95940951 CCCAGTAGGATCCCAGAGCCTGG + Intergenic
1194775149 X:97954158-97954180 CCAAGCAGGTCTCCAACTCCTGG - Intergenic
1195566289 X:106343196-106343218 CCAAGCAGGTTGCCACTGCTGGG + Intergenic
1195819264 X:108925666-108925688 CAAAGCTGGTCCCCAAAGACGGG + Intergenic
1199683644 X:150244817-150244839 CTAAGTAGGTTCCCAAATCCAGG - Intergenic
1200951912 Y:8905640-8905662 CCAAGCTGGTCTCCAAATCCTGG - Intergenic
1201323991 Y:12733854-12733876 CCAAGCCAGTTCACAAAGACTGG - Intronic
1201607339 Y:15801456-15801478 CCAGGCTGGTCCCCAAATCCTGG - Intergenic