ID: 1152594449

View in Genome Browser
Species Human (GRCh38)
Location 17:81231645-81231667
Sequence CTGTCAGCAGGAGTTGAGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 194}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594449_1152594463 22 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594463 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 2
3: 25
4: 306
1152594449_1152594456 11 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594456 17:81231679-81231701 CACCACCTCGACCCTGCCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 175
1152594449_1152594461 21 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594461 17:81231689-81231711 ACCCTGCCAGGGGGAATGGCCGG 0: 1
1: 0
2: 2
3: 20
4: 216
1152594449_1152594453 9 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594453 17:81231677-81231699 GCCACCACCTCGACCCTGCCAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1152594449_1152594457 12 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594457 17:81231680-81231702 ACCACCTCGACCCTGCCAGGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
1152594449_1152594466 28 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
1152594449_1152594467 29 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594449_1152594455 10 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594455 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 310
1152594449_1152594460 17 Left 1152594449 17:81231645-81231667 CCAAGCTCAACTCCTGCTGACAG 0: 1
1: 0
2: 0
3: 27
4: 194
Right 1152594460 17:81231685-81231707 CTCGACCCTGCCAGGGGGAATGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594449 Original CRISPR CTGTCAGCAGGAGTTGAGCT TGG (reversed) Exonic