ID: 1152594452

View in Genome Browser
Species Human (GRCh38)
Location 17:81231657-81231679
Sequence GGCCCTGAGTGACTGTCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 191}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594452_1152594466 16 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199
1152594452_1152594456 -1 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594456 17:81231679-81231701 CACCACCTCGACCCTGCCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 175
1152594452_1152594468 24 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594452_1152594463 10 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594463 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 2
3: 25
4: 306
1152594452_1152594467 17 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594452_1152594457 0 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594457 17:81231680-81231702 ACCACCTCGACCCTGCCAGGGGG 0: 1
1: 0
2: 1
3: 14
4: 142
1152594452_1152594469 27 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594452_1152594453 -3 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594453 17:81231677-81231699 GCCACCACCTCGACCCTGCCAGG 0: 1
1: 0
2: 2
3: 17
4: 265
1152594452_1152594455 -2 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594455 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 310
1152594452_1152594461 9 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594461 17:81231689-81231711 ACCCTGCCAGGGGGAATGGCCGG 0: 1
1: 0
2: 2
3: 20
4: 216
1152594452_1152594460 5 Left 1152594452 17:81231657-81231679 CCTGCTGACAGTCACTCAGGGCC 0: 1
1: 0
2: 0
3: 11
4: 191
Right 1152594460 17:81231685-81231707 CTCGACCCTGCCAGGGGGAATGG 0: 1
1: 0
2: 0
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594452 Original CRISPR GGCCCTGAGTGACTGTCAGC AGG (reversed) Exonic