ID: 1152594454

View in Genome Browser
Species Human (GRCh38)
Location 17:81231678-81231700
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594454_1152594467 -4 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594454_1152594468 3 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594454_1152594469 6 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594454_1152594466 -5 Left 1152594454 17:81231678-81231700 CCACCACCTCGACCCTGCCAGGG 0: 1
1: 0
2: 2
3: 33
4: 337
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594454 Original CRISPR CCCTGGCAGGGTCGAGGTGG TGG (reversed) Exonic