ID: 1152594458

View in Genome Browser
Species Human (GRCh38)
Location 17:81231681-81231703
Sequence TCCCCCTGGCAGGGTCGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594458_1152594472 30 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594458_1152594469 3 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594458_1152594468 0 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594458_1152594467 -7 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594467 17:81231697-81231719 AGGGGGAATGGCCGGGTCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 230
1152594458_1152594466 -8 Left 1152594458 17:81231681-81231703 CCACCTCGACCCTGCCAGGGGGA 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1152594466 17:81231696-81231718 CAGGGGGAATGGCCGGGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594458 Original CRISPR TCCCCCTGGCAGGGTCGAGG TGG (reversed) Exonic