ID: 1152594462

View in Genome Browser
Species Human (GRCh38)
Location 17:81231690-81231712
Sequence CCCGGCCATTCCCCCTGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1152594462_1152594472 21 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594472 17:81231734-81231756 GCCCCCACTCCTGTCTCGCATGG 0: 1
1: 0
2: 0
3: 22
4: 159
1152594462_1152594478 24 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594478 17:81231737-81231759 CCCACTCCTGTCTCGCATGGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1152594462_1152594476 23 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594476 17:81231736-81231758 CCCCACTCCTGTCTCGCATGGGG 0: 1
1: 0
2: 0
3: 5
4: 144
1152594462_1152594468 -9 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594468 17:81231704-81231726 ATGGCCGGGTCAAGGGTGAGTGG 0: 1
1: 0
2: 0
3: 10
4: 145
1152594462_1152594469 -6 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594469 17:81231707-81231729 GCCGGGTCAAGGGTGAGTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 183
1152594462_1152594474 22 Left 1152594462 17:81231690-81231712 CCCTGCCAGGGGGAATGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1152594474 17:81231735-81231757 CCCCCACTCCTGTCTCGCATGGG 0: 1
1: 0
2: 1
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1152594462 Original CRISPR CCCGGCCATTCCCCCTGGCA GGG (reversed) Exonic